ID: 1174195848

View in Genome Browser
Species Human (GRCh38)
Location 20:48772339-48772361
Sequence GCGCACCTGCGCCTTCTTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174195848_1174195857 14 Left 1174195848 20:48772339-48772361 CCCCCAAGAAGGCGCAGGTGCGC No data
Right 1174195857 20:48772376-48772398 CTGTTTCTGGTGAATCAGGCCGG No data
1174195848_1174195853 1 Left 1174195848 20:48772339-48772361 CCCCCAAGAAGGCGCAGGTGCGC No data
Right 1174195853 20:48772363-48772385 GCTCGTGGCAGCCCTGTTTCTGG No data
1174195848_1174195854 10 Left 1174195848 20:48772339-48772361 CCCCCAAGAAGGCGCAGGTGCGC No data
Right 1174195854 20:48772372-48772394 AGCCCTGTTTCTGGTGAATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174195848 Original CRISPR GCGCACCTGCGCCTTCTTGG GGG (reversed) Intronic