ID: 1174196703

View in Genome Browser
Species Human (GRCh38)
Location 20:48777336-48777358
Sequence GAGGGTATGAAGGCTTTCGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 70
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 64}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174196693_1174196703 4 Left 1174196693 20:48777309-48777331 CCCCCGGCCACACACCACCATTC 0: 1
1: 0
2: 2
3: 28
4: 260
Right 1174196703 20:48777336-48777358 GAGGGTATGAAGGCTTTCGCTGG 0: 1
1: 0
2: 0
3: 5
4: 64
1174196692_1174196703 11 Left 1174196692 20:48777302-48777324 CCAGGAGCCCCCGGCCACACACC 0: 1
1: 0
2: 0
3: 28
4: 388
Right 1174196703 20:48777336-48777358 GAGGGTATGAAGGCTTTCGCTGG 0: 1
1: 0
2: 0
3: 5
4: 64
1174196696_1174196703 1 Left 1174196696 20:48777312-48777334 CCGGCCACACACCACCATTCTCT 0: 1
1: 0
2: 7
3: 35
4: 410
Right 1174196703 20:48777336-48777358 GAGGGTATGAAGGCTTTCGCTGG 0: 1
1: 0
2: 0
3: 5
4: 64
1174196689_1174196703 23 Left 1174196689 20:48777290-48777312 CCAGCATGAGGCCCAGGAGCCCC 0: 1
1: 0
2: 1
3: 33
4: 339
Right 1174196703 20:48777336-48777358 GAGGGTATGAAGGCTTTCGCTGG 0: 1
1: 0
2: 0
3: 5
4: 64
1174196700_1174196703 -10 Left 1174196700 20:48777323-48777345 CCACCATTCTCTTGAGGGTATGA 0: 1
1: 0
2: 1
3: 7
4: 118
Right 1174196703 20:48777336-48777358 GAGGGTATGAAGGCTTTCGCTGG 0: 1
1: 0
2: 0
3: 5
4: 64
1174196694_1174196703 3 Left 1174196694 20:48777310-48777332 CCCCGGCCACACACCACCATTCT 0: 1
1: 0
2: 3
3: 75
4: 682
Right 1174196703 20:48777336-48777358 GAGGGTATGAAGGCTTTCGCTGG 0: 1
1: 0
2: 0
3: 5
4: 64
1174196695_1174196703 2 Left 1174196695 20:48777311-48777333 CCCGGCCACACACCACCATTCTC 0: 1
1: 0
2: 3
3: 30
4: 288
Right 1174196703 20:48777336-48777358 GAGGGTATGAAGGCTTTCGCTGG 0: 1
1: 0
2: 0
3: 5
4: 64
1174196691_1174196703 12 Left 1174196691 20:48777301-48777323 CCCAGGAGCCCCCGGCCACACAC 0: 1
1: 0
2: 1
3: 23
4: 247
Right 1174196703 20:48777336-48777358 GAGGGTATGAAGGCTTTCGCTGG 0: 1
1: 0
2: 0
3: 5
4: 64
1174196688_1174196703 26 Left 1174196688 20:48777287-48777309 CCTCCAGCATGAGGCCCAGGAGC 0: 1
1: 0
2: 3
3: 25
4: 323
Right 1174196703 20:48777336-48777358 GAGGGTATGAAGGCTTTCGCTGG 0: 1
1: 0
2: 0
3: 5
4: 64
1174196697_1174196703 -3 Left 1174196697 20:48777316-48777338 CCACACACCACCATTCTCTTGAG 0: 1
1: 2
2: 4
3: 17
4: 205
Right 1174196703 20:48777336-48777358 GAGGGTATGAAGGCTTTCGCTGG 0: 1
1: 0
2: 0
3: 5
4: 64
1174196686_1174196703 30 Left 1174196686 20:48777283-48777305 CCAGCCTCCAGCATGAGGCCCAG 0: 1
1: 0
2: 4
3: 56
4: 473
Right 1174196703 20:48777336-48777358 GAGGGTATGAAGGCTTTCGCTGG 0: 1
1: 0
2: 0
3: 5
4: 64

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174196703 Original CRISPR GAGGGTATGAAGGCTTTCGC TGG Intronic
901610767 1:10496172-10496194 GTGTGTACGAAGGCTTTCCCAGG + Intronic
904262619 1:29298581-29298603 GAGGATCTGAGGGTTTTCGCAGG - Intronic
905463959 1:38139070-38139092 GAGGGTAAGAAGTCTTCCGAGGG + Intergenic
905617709 1:39413092-39413114 GAGGGTATGTCAGCTGTCGCAGG + Exonic
907873153 1:58461468-58461490 GAAGAGATGAAGGCTTTGGCGGG + Intronic
908155731 1:61350660-61350682 GAGGTTATGAAGGATCTGGCAGG - Intronic
913692718 1:121294429-121294451 GAGGGTAGGAAGCCTTTCTAGGG + Intronic
914144838 1:144985661-144985683 GAGGGTAGGAAGCCTTTCTAGGG - Intronic
918368982 1:183839752-183839774 GAGGGAAGGAATGCTTTGGCTGG - Intronic
919220043 1:194616612-194616634 GTGGGTATGAAGGCACTGGCTGG - Intergenic
920480039 1:206312790-206312812 GAGGGTAGGAAGCCTTTCTAGGG + Intronic
921516512 1:216098859-216098881 GAGAATATGAAGGATTTGGCGGG + Intronic
1073058369 10:100716267-100716289 GAGGTTCTGAAGGCTTCCTCAGG - Intergenic
1073102779 10:101015618-101015640 GATGGGATGAAGGCTTACCCGGG + Intronic
1077125529 11:933945-933967 GGGGGTATCAAGGCTTCAGCAGG + Intronic
1082892381 11:58153887-58153909 GAGGGAAGGAAGGCTTTCTCTGG + Intronic
1089744616 11:120607987-120608009 GAGGGTGGAAAAGCTTTCGCTGG + Intronic
1101838236 12:108310075-108310097 GAGGGTATGAAGCCTTTGCCAGG + Intronic
1106065307 13:26342339-26342361 GAGAGTATGCAGGCTTTCCTTGG - Intronic
1106290336 13:28355612-28355634 GAGGATAAGAAGGATTTGGCTGG + Intronic
1116421386 14:44736786-44736808 GAGAGGATGAAGGATTTCACAGG + Intergenic
1128893623 15:71353007-71353029 GAGGCTATAAAGGCTTTCCAAGG + Intronic
1130960502 15:88655726-88655748 GAGGGAATGAAGTCTTATGCTGG + Exonic
1132426200 15:101719510-101719532 CATGGTATGAATGCTTTAGCTGG + Intronic
1132971743 16:2692668-2692690 GAGGGCATGAAGGCTGGGGCCGG - Intronic
1142622533 17:1173971-1173993 GAGGGCATGATGGCTCTCGTGGG - Intronic
1143155775 17:4835115-4835137 GAGGGTCTGAAGGCTTTAGGAGG + Intronic
1143550630 17:7628147-7628169 GAGGGTCTTAAGGCTTACCCAGG - Intronic
1144735675 17:17553991-17554013 GAGGGTCTGGAGGCTTCTGCGGG + Intronic
1149151667 17:53572325-53572347 GAGGTTATGAAGTGTTTTGCAGG + Intergenic
1157840685 18:50955608-50955630 GACGCTATGAAGGCTCTTGCAGG + Intergenic
1159449603 18:68583534-68583556 CAGGGTATGAAGGCTTTTGGTGG - Intergenic
1160567547 18:79796749-79796771 GGGGGTCTGAAGGGTTTCTCAGG - Intergenic
1163767888 19:19173444-19173466 GAGGATAGGAAGGCTTTTGGAGG - Intronic
1167321656 19:48800269-48800291 GAGGGCATGAAGGCGTTCAAAGG - Exonic
933464234 2:82631085-82631107 GATGGTATGAAGCCTTTCTCAGG - Intergenic
935203137 2:100875788-100875810 GACGGCATGAAAGCTTTCCCAGG + Intronic
946255449 2:218438516-218438538 GAGGATATGAAGGCTGAGGCTGG - Intronic
948393186 2:237627172-237627194 GGGGGTAGGAAGGCTTTCAGAGG - Intergenic
1173269226 20:41516803-41516825 GAGGGAATGAAGCCTTTCAAGGG + Intronic
1174196703 20:48777336-48777358 GAGGGTATGAAGGCTTTCGCTGG + Intronic
1174669679 20:52294704-52294726 GAGGTTCTTAAGGCTTTTGCTGG - Intergenic
951599024 3:24352081-24352103 GAGGGTGTAAAGTCTTTCTCAGG + Intronic
951809482 3:26683593-26683615 GAGGTTAGGAAGGCTGTGGCTGG + Intronic
952075266 3:29688415-29688437 GAGTGTATGAAGTCTTTAGAAGG - Intronic
952782154 3:37111913-37111935 GAGGGTTGGAAGGCTTTGGTTGG - Intronic
958574492 3:95930024-95930046 GTGATTATGAAGGCTTTCTCTGG - Intergenic
958748876 3:98171188-98171210 GAGGAGATGAAGGCTTTTACAGG + Intronic
960536245 3:118817489-118817511 GAGGGTGTGAAGGCATTTTCTGG - Intergenic
962416136 3:135183706-135183728 GAGGTTGTGAAGGCTTTGGATGG + Intronic
969486664 4:7476037-7476059 CAGGGGCTGAAGGCTCTCGCTGG + Intronic
979827206 4:125253418-125253440 GAGGTTATCAAGGCTATCTCTGG - Intergenic
985538967 5:479036-479058 GAGGGTCTGCAGGGTTTGGCAGG + Intronic
1001693154 5:173647610-173647632 GAGGGCATCAAAGCTTTCCCTGG - Intergenic
1002296524 5:178234366-178234388 GAGGGTGAGAAGGCTGTAGCTGG + Intergenic
1003536790 6:6982307-6982329 GAGGGTATGCAGGCTGGGGCAGG + Intergenic
1003536891 6:6983094-6983116 GAGGGCATGAAGGATTTGACTGG + Intergenic
1012072019 6:94634061-94634083 GAGGGTATTATGGATTTCACTGG + Intergenic
1015983574 6:138863570-138863592 CAGGGTATGAACGCTGTTGCTGG + Intronic
1021693850 7:23256967-23256989 GACGTTATGATGGCTTTGGCCGG - Exonic
1022471240 7:30682902-30682924 GAGGCTATGGAGGCTTTTGGAGG - Intronic
1026202387 7:68225689-68225711 AAGGGTATGGAGGATTTCTCTGG + Intergenic
1028577224 7:92365710-92365732 GAGGATATGAAGGCTTAAGATGG + Intronic
1028737827 7:94237470-94237492 GTGAGTATGGAGGCTTTCTCGGG - Intergenic
1034496820 7:151428005-151428027 GTGGGAATGAAGGCCCTCGCTGG - Intergenic
1036477322 8:9104943-9104965 CAGAGTATGAAAGCTTTAGCAGG + Intronic
1037140971 8:15520376-15520398 GAGGAGATGAAGGCTTTCAGAGG - Intronic
1047219991 8:122911364-122911386 GAGGGTGTGAAGGCCTCTGCAGG - Intronic
1052792614 9:32889828-32889850 GGGGGTATGGAGGGTTTTGCTGG + Intergenic
1054426435 9:65075633-65075655 GAGGGCTTGAAGGATTTCGTTGG + Intergenic