ID: 1174197682

View in Genome Browser
Species Human (GRCh38)
Location 20:48785279-48785301
Sequence TGTCAGAGGAGACCCCAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 351
Summary {0: 1, 1: 0, 2: 2, 3: 39, 4: 309}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174197682_1174197692 30 Left 1174197682 20:48785279-48785301 CCTGCCTGGGGTCTCCTCTGACA 0: 1
1: 0
2: 2
3: 39
4: 309
Right 1174197692 20:48785332-48785354 CCCCGCTCCCACACCTGTGATGG 0: 1
1: 0
2: 0
3: 23
4: 250
1174197682_1174197685 -10 Left 1174197682 20:48785279-48785301 CCTGCCTGGGGTCTCCTCTGACA 0: 1
1: 0
2: 2
3: 39
4: 309
Right 1174197685 20:48785292-48785314 TCCTCTGACAAGCCCACAGGAGG 0: 1
1: 0
2: 1
3: 22
4: 148
1174197682_1174197689 4 Left 1174197682 20:48785279-48785301 CCTGCCTGGGGTCTCCTCTGACA 0: 1
1: 0
2: 2
3: 39
4: 309
Right 1174197689 20:48785306-48785328 CACAGGAGGTTTACCAGCAGTGG 0: 1
1: 1
2: 1
3: 13
4: 152

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174197682 Original CRISPR TGTCAGAGGAGACCCCAGGC AGG (reversed) Intronic
900231863 1:1563101-1563123 TGGCAGAGGAGACAGCAGGGAGG + Intronic
900789034 1:4667139-4667161 TCCCAGAGGACTCCCCAGGCGGG + Intronic
901871367 1:12140867-12140889 TGAGAGAGGAGACCCCAGGAGGG - Intronic
901872282 1:12145116-12145138 AGTCAGAGGAGGCCTCAGGCTGG - Intergenic
901878099 1:12178586-12178608 TGTCACAGGAGCCCCTAGGAGGG + Intronic
903031575 1:20467572-20467594 AGTCCGAGGAGACCCAGGGCTGG - Intergenic
903266922 1:22163255-22163277 TGTCAGAGCAGCCCCCGGGGTGG + Intergenic
904351018 1:29906793-29906815 GGGCCGAGGAGACCTCAGGCTGG - Intergenic
904883113 1:33715389-33715411 TGTCACTAGAGGCCCCAGGCAGG - Intronic
906193545 1:43914640-43914662 TGTGTGAGGAGGCTCCAGGCTGG - Intronic
906215200 1:44034437-44034459 TCTGAGAGCAGAGCCCAGGCAGG - Intergenic
906876587 1:49545396-49545418 TTTCAGATGAGATCCCAGCCTGG + Intronic
907321919 1:53608255-53608277 TTTAAGAAGAGACACCAGGCTGG - Intronic
908037229 1:60069139-60069161 TGTTACAGGAGCCCCCAGGTGGG + Intronic
909064228 1:70914562-70914584 TGTCACAGGACTCCCAAGGCTGG + Intronic
909081492 1:71117933-71117955 TCTCAGAGGATAGCCAAGGCAGG - Intergenic
914258195 1:145977426-145977448 ATTCACTGGAGACCCCAGGCAGG + Intronic
915283416 1:154837968-154837990 TGGAAGAGGAGAAGCCAGGCAGG + Intronic
918757576 1:188357247-188357269 TGTTGGAGGAGGCCCCTGGCAGG - Intergenic
918954365 1:191186529-191186551 AGTAATTGGAGACCCCAGGCTGG - Intergenic
919981059 1:202643256-202643278 GGTAAGAGGGAACCCCAGGCGGG - Exonic
922619169 1:226980000-226980022 GGACAGTGGTGACCCCAGGCTGG + Intronic
922721457 1:227902104-227902126 TGGGAGAGGAGACTCCAGGTGGG + Intergenic
922752642 1:228077826-228077848 TGGCCAAGGAGATCCCAGGCAGG + Intergenic
923029387 1:230235381-230235403 TGGAAGAGGAGAGCTCAGGCAGG + Intronic
924433959 1:244022162-244022184 TGTCAAAGAAGACCACAGTCAGG - Intergenic
1062992842 10:1836470-1836492 TGGCAGTGGAGACCCGAGCCTGG + Intergenic
1064858621 10:19799412-19799434 TGTCAGAGGAGGGCCCTGGTGGG - Intergenic
1065870889 10:29955631-29955653 CCTCAGATGAGACCCCAGCCTGG + Intergenic
1066312154 10:34207514-34207536 TGTCAGAGGTCACTGCAGGCTGG + Intronic
1067558514 10:47288466-47288488 AGTCAGAGGGGCTCCCAGGCAGG + Intergenic
1067569566 10:47361434-47361456 GGCCAGAGTAGCCCCCAGGCCGG - Intergenic
1067838190 10:49654502-49654524 GGACAGAGGAGTCCCCTGGCTGG + Intronic
1069698522 10:70405116-70405138 GGTGAGGGGAGTCCCCAGGCCGG + Intronic
1069848820 10:71391735-71391757 TGACAGAGGGGACCCCGAGCAGG - Intergenic
1069879327 10:71581809-71581831 TGTCTGTTGAGACCACAGGCTGG - Intronic
1069886583 10:71627654-71627676 TGTTAGACGGGACTCCAGGCTGG - Intronic
1069915875 10:71786412-71786434 AGCCAGAGGAGACGTCAGGCTGG + Intronic
1070382228 10:75891393-75891415 TTTCAGAGGAGACCTGAGGGAGG + Intronic
1070811533 10:79300566-79300588 TGGGAGAGGAGAACTCAGGCTGG + Intronic
1072119116 10:92390721-92390743 TTACAAAAGAGACCCCAGGCCGG + Intergenic
1073104943 10:101027220-101027242 GGGCAGAGGAAAGCCCAGGCAGG - Intronic
1075214348 10:120519169-120519191 TGTCAGGGGAGGCCCTGGGCTGG - Intronic
1075625757 10:123963450-123963472 TCTCAGAGCAGTCCCCAGGCAGG - Intergenic
1076720581 10:132390856-132390878 TGTGAAGGGAGACCCCAGCCTGG + Intergenic
1077170149 11:1162473-1162495 AGTGAGGAGAGACCCCAGGCAGG - Intronic
1077231097 11:1458527-1458549 TGTCTGAGGAGGCCCCCTGCTGG - Intronic
1077713106 11:4555185-4555207 GGTCAGAGGAGACACTAAGCGGG + Intergenic
1078141118 11:8693701-8693723 TGGCAGCGGGGACCTCAGGCAGG + Exonic
1078210488 11:9265741-9265763 TGTCAGCCTAGACCCCAGACAGG + Intergenic
1078614929 11:12856067-12856089 TTCCACAGGAGACCCCATGCCGG - Intronic
1084871709 11:72103029-72103051 TTACAGAGGAGACGCCAAGCCGG - Intronic
1084899740 11:72300679-72300701 TGTCATAGGAGGCCACAGGGAGG - Intronic
1085294393 11:75422802-75422824 GGACAGAGGAAGCCCCAGGCTGG - Intronic
1085323328 11:75588210-75588232 TGTGAGAGTAGAGCTCAGGCAGG + Intronic
1085527284 11:77171873-77171895 TCTCAGAGGGGACCCCAGTAGGG + Intronic
1086089709 11:82993222-82993244 TGGCAGAGGAGACCCCAGAAAGG + Intronic
1090400133 11:126443650-126443672 TGGCTGAGGAGACACCAAGCTGG + Intronic
1091576400 12:1740448-1740470 TGTAAGAAGAGACACCAGGGAGG - Intronic
1094488249 12:30941784-30941806 TGGAAGAGGTGCCCCCAGGCGGG - Intronic
1095522279 12:43081902-43081924 TATAAGAGGATACCACAGGCTGG + Intergenic
1095600724 12:44010185-44010207 TGTCAGAGGTGGCCCCAGGTGGG - Intronic
1095710562 12:45283847-45283869 TGTGATAGGAAAACCCAGGCTGG - Intronic
1096252023 12:50039625-50039647 TGCCACAGGAGCCCCCATGCAGG - Intergenic
1096498996 12:52054300-52054322 AGAGAGAGGAGACCCCAGGGAGG - Intronic
1096732569 12:53626182-53626204 TGGGAGGGGAGACCCCAGCCTGG + Intronic
1097238148 12:57553746-57553768 TGGAAGAGGAGACACCAGGGAGG + Intronic
1097267851 12:57755938-57755960 TGTCAGCGGAGACCGCGAGCAGG + Intronic
1097354972 12:58591075-58591097 TGTTAGAAGAAACCCCAGGTTGG + Intronic
1098737882 12:74130117-74130139 TGTCAGAAGAGACTACAGGGAGG + Intergenic
1099460035 12:82910697-82910719 AATCAGAGGAGAGCCCAGGCTGG - Intronic
1101441670 12:104708673-104708695 TGTCAGAGGGGAGCCCAGCCTGG - Intronic
1102173037 12:110856491-110856513 GGGCAGAAGAGTCCCCAGGCTGG + Intronic
1102387683 12:112523897-112523919 TGTCAGAGGAGGGGCCTGGCAGG + Intergenic
1103059498 12:117847420-117847442 AGCCAGAGGAGGGCCCAGGCAGG + Intronic
1103693105 12:122791788-122791810 TGTCACAGGAGAGGCAAGGCTGG + Intronic
1104970733 12:132529533-132529555 TGGCAGAGAAGAGCCCAGGATGG - Intronic
1104970743 12:132529573-132529595 TGGCAGAGAAGAGCCCAGGGTGG - Intronic
1104970753 12:132529608-132529630 TGGCAGAGAAGAGCCCAGGGTGG - Intronic
1104970778 12:132529698-132529720 TGGCAGAGAAGAGCCCAGGGGGG - Intronic
1104970790 12:132529733-132529755 TGGCAGAGAAGAGCCCAGGGTGG - Intronic
1105254897 13:18737849-18737871 TGTCCTAGAAGACCCCAGGTGGG - Intergenic
1105488598 13:20863024-20863046 TCTCAGAAGACACCTCAGGCAGG + Intronic
1106775632 13:33006265-33006287 TCTCAGAGGAGACACCAGGCAGG + Intergenic
1107691432 13:42957436-42957458 TATCAGAGGAGACCACGGGATGG + Intronic
1107816723 13:44251037-44251059 TGTCAGAGGACACCCCATGTAGG - Intergenic
1111489432 13:88952010-88952032 TGTAAGAGAAGACTCGAGGCTGG - Intergenic
1112436093 13:99392308-99392330 TGTCAGAGGCTCCCCCAGACGGG - Intergenic
1113061804 13:106330335-106330357 TGTCAGTGGAGAGCCCTGGCAGG - Intergenic
1113639831 13:111949404-111949426 TGCCAGAGAAGCCCTCAGGCCGG - Intergenic
1114877103 14:26733499-26733521 TGTCAAGGGAGACACCAGGTGGG - Intergenic
1115500256 14:34043309-34043331 TGACGGAGGAGTCCCCAGGCTGG + Intronic
1116605611 14:46989763-46989785 TGGCAGAGGAGACAGCTGGCAGG + Intronic
1117483895 14:56174512-56174534 TGTCAGAGGAGGGGCCTGGCAGG + Intronic
1117733104 14:58743713-58743735 TGGGAGAGCAGTCCCCAGGCTGG - Intergenic
1117965489 14:61203209-61203231 TGTCAGGGGAAAACCCAGACAGG + Intronic
1118596106 14:67436753-67436775 TGGCAGAGAAGACACCAGGCAGG + Intergenic
1119687407 14:76643686-76643708 TCCCAGAGAAGACCCAAGGCAGG - Intergenic
1120850203 14:89162887-89162909 GGTCAGCGGAGACCCCAAGGAGG - Exonic
1120863703 14:89277334-89277356 TTTCAGAGGGGACCCAGGGCAGG - Intronic
1120979797 14:90279752-90279774 TGTCAGCGGAGGTCCCAGGCTGG - Intronic
1121001538 14:90454858-90454880 TGGCAGACCAGACCCCTGGCCGG - Intergenic
1121490633 14:94356627-94356649 TGGCATTGGAGACCCAAGGCGGG - Intergenic
1121860784 14:97316023-97316045 TGTCAGAGGAGGGGCCTGGCGGG - Intergenic
1122539609 14:102490620-102490642 TTTCAGAGCAGACGCCAGGCCGG - Intronic
1122873171 14:104650711-104650733 AGCCAGAGGAGCCCCGAGGCTGG - Intergenic
1123111308 14:105868231-105868253 AGCCAGAGGCGACCCCTGGCAGG + Intergenic
1123113340 14:105882949-105882971 GGCCAGAGCAGATCCCAGGCAGG - Intergenic
1123153657 14:106204941-106204963 TGGCCCAGGAGACCTCAGGCTGG - Intergenic
1123402674 15:20003381-20003403 GGCCAGAGCAGATCCCAGGCAGG - Intergenic
1123512013 15:21010035-21010057 GGCCAGAGCAGATCCCAGGCAGG - Intergenic
1124061663 15:26298598-26298620 TGTGAGAGGTGACCGCATGCTGG - Intergenic
1124496759 15:30191998-30192020 GGTAAGAGGGAACCCCAGGCGGG - Intergenic
1124705873 15:31963677-31963699 TGTCAGTGGAGGCCCCATGGAGG - Intergenic
1124746817 15:32346649-32346671 GGTAAGAGGGAACCCCAGGCGGG + Intergenic
1124946051 15:34267550-34267572 TGTCAGAGATGTCTCCAGGCTGG + Intronic
1125605049 15:40935371-40935393 GGTCAGAGGCCACCCCAGCCAGG - Intronic
1126382683 15:48065277-48065299 CTTTAGAGGAGACCCCAGGCTGG - Intergenic
1129360322 15:75020268-75020290 GGTCAGAGGAGAAGGCAGGCAGG + Exonic
1130944420 15:88540254-88540276 TGACCCAGGAGACCTCAGGCTGG + Intronic
1131453122 15:92562720-92562742 TGGCAGAGCAGCCCCAAGGCTGG + Intergenic
1131622536 15:94082812-94082834 GGGCAGAGGAGACCCGAGCCCGG + Intergenic
1132275326 15:100558877-100558899 TGTGGGAGGAGACCCCCGGCTGG - Intergenic
1132637945 16:962460-962482 TGTCAGAGGGCACACCTGGCAGG + Intronic
1132638294 16:964772-964794 CGTCAGATGACACCCGAGGCAGG - Intronic
1132677020 16:1125065-1125087 TGTCAGAGGCGGCCCCACCCGGG - Intergenic
1132888185 16:2191617-2191639 TGCCAGAAGAAACCCCTGGCTGG - Intronic
1133239361 16:4405266-4405288 TGTCAGATGAGAGCCCACGCTGG - Intronic
1133625993 16:7571308-7571330 AGACAGAGGAAACCCCAGGAGGG + Intronic
1133882428 16:9795442-9795464 AGACAGAGCAGACCCAAGGCTGG - Intronic
1135158804 16:20075292-20075314 TGTTAGAGGTTACCCCAGGCAGG + Intergenic
1135476005 16:22775696-22775718 AGGCAGATGAGACCCCAGGAAGG + Intergenic
1137484764 16:48881949-48881971 TAGCAGGGGAGACCCCAGGGAGG + Intergenic
1137915166 16:52422162-52422184 CATCAGAGGAGACACCAGGAAGG + Intergenic
1139006604 16:62578946-62578968 TGTCAGAGGAGAGGCCTGGTGGG - Intergenic
1139359221 16:66387139-66387161 TGTGAGAGGTGCCCCCAGGCTGG - Intronic
1139390520 16:66604560-66604582 AGTCTGCGGAGGCCCCAGGCCGG + Intronic
1139937150 16:70579745-70579767 AGTCAGAGCAGTCCCCTGGCGGG + Intergenic
1140130169 16:72153463-72153485 TGCCAGGGGAAACCCCAGGATGG + Intronic
1141339210 16:83187545-83187567 TGGCAGGGGAAATCCCAGGCAGG + Intronic
1141373503 16:83508487-83508509 GGTCAGAGGAAAGTCCAGGCAGG - Intronic
1141606116 16:85154295-85154317 TCTCAGAGGAGACCCCAAGTGGG + Intergenic
1142133647 16:88442078-88442100 GGTCAGAGTAGACCCCTGACTGG + Intergenic
1143308933 17:5972284-5972306 TGTCAGAAGAGGCCCCAGGGAGG - Intronic
1144388151 17:14769327-14769349 TGTCACAGGAGACTCCATGAGGG - Intergenic
1146452314 17:32984378-32984400 GGTCAGAAGAGTCCTCAGGCTGG - Intronic
1146652754 17:34616620-34616642 TGCCAGAGGAGAACCCAGGCTGG + Intronic
1147597220 17:41724941-41724963 TGTCAGAGGAGACCGAGGGCTGG - Exonic
1149000253 17:51749793-51749815 TGACAGAGGAGACCACACACTGG + Intronic
1149991947 17:61388269-61388291 TGCCAGATGGGACCCCATGCAGG - Intronic
1152134727 17:78497215-78497237 TTCCAGAGGAGACCTCAAGCAGG - Intronic
1152342502 17:79733089-79733111 CATCAGACGAGATCCCAGGCAGG - Intronic
1152795790 17:82305512-82305534 TGCCAGAGGAGACGGCAGTCTGG - Intergenic
1154436132 18:14342755-14342777 TGTCCTAGAAGACCCCAGGCGGG + Intergenic
1157297900 18:46459229-46459251 TGTCAGTGAAGAGCCCAGACTGG - Exonic
1157404773 18:47413691-47413713 GGGCTGAGGAGACCTCAGGCAGG - Intergenic
1157499047 18:48177348-48177370 TGTCACAGGAGTCACCAGGAGGG - Intronic
1159359507 18:67381889-67381911 TGCCAGCCGAGAGCCCAGGCAGG + Intergenic
1161404351 19:4083299-4083321 TGTCAGGGGAGACAGCAGGATGG + Intergenic
1161663705 19:5562321-5562343 GGTCAGAGGTGAGCCCTGGCAGG - Intergenic
1161666724 19:5581638-5581660 GGTCAGAGGAGACCTCTTGCAGG + Intergenic
1163004355 19:14388405-14388427 GGTCAGAGGGGATCCCAGGGTGG - Intronic
1163063108 19:14774329-14774351 GGTCAGAGGGGATCCCAGGGTGG + Intronic
1163594053 19:18210736-18210758 GGTCAGAGTGGACCCCAGCCAGG + Exonic
1164030312 19:21397492-21397514 TGCCAGAGAGGACTCCAGGCAGG - Intronic
1165758383 19:38307220-38307242 TGGAAGAGGAGACACCAGCCAGG - Intronic
1166204152 19:41258056-41258078 TCTCAGAGGAGACCTGAGTCTGG - Intronic
1166213851 19:41323496-41323518 GGAGGGAGGAGACCCCAGGCAGG + Exonic
1166331403 19:42079961-42079983 TGTCTGAGGAGACCTCAGCAGGG + Exonic
1166782785 19:45351128-45351150 TGTCAGAAGAGACCCAGGACAGG + Exonic
1167649826 19:50723228-50723250 TGTGCGAGGAGACCCAAGGCGGG + Intergenic
927400380 2:22703952-22703974 TGGCAGAGGAGGTGCCAGGCTGG - Intergenic
930751589 2:54939663-54939685 AGACAGAGCAGAACCCAGGCAGG - Intronic
932439046 2:71720233-71720255 TGTCAGAGGGTACCCCAAGGAGG - Intergenic
932457365 2:71858138-71858160 TGCCAGAGGAGACCTGAGGTGGG - Intergenic
932569999 2:72933637-72933659 GGTCAGAGGGGACCCCGGCCTGG + Intronic
933253908 2:80059223-80059245 TGTGATAGGAGAACCCAGCCGGG - Intronic
935363031 2:102263787-102263809 AGCCAGTGTAGACCCCAGGCAGG - Intergenic
936934523 2:117826452-117826474 TGTCAGAGGAGTCTCGAGTCTGG + Intronic
938548146 2:132353339-132353361 TGGCAGAGGAGGACCCGGGCGGG + Intergenic
940013830 2:149082767-149082789 TGGCAGTGGAGGGCCCAGGCTGG + Intronic
942422363 2:175821185-175821207 TGTGAGCAGAGGCCCCAGGCAGG - Intergenic
943318920 2:186423109-186423131 CCTCAGATGAGACCCCAGCCTGG - Intergenic
943575271 2:189624722-189624744 TCTCAGAGGTGACCACAGGTTGG + Intergenic
946074284 2:217061274-217061296 TGCCAGATAAGACCCCGGGCTGG + Intergenic
946547128 2:220756456-220756478 GGTCAGAGCACACCCCATGCGGG + Intergenic
947558785 2:231126323-231126345 GGTCAGGGGAGACCTGAGGCAGG + Intronic
1171877017 20:30586111-30586133 TGGCAGAGGAGGACCCGGGCGGG + Intergenic
1171879727 20:30609844-30609866 TGTCTTAGGAGACCACAGGTGGG - Intergenic
1173038851 20:39440966-39440988 TGTCAGAGGAGAGGCCTGGTGGG + Intergenic
1173098248 20:40059249-40059271 TGTCAGAGGAGAGACCTGGTGGG + Intergenic
1173922552 20:46757288-46757310 TCTCGGTGGAGACCGCAGGCAGG + Intergenic
1174197682 20:48785279-48785301 TGTCAGAGGAGACCCCAGGCAGG - Intronic
1174277472 20:49414394-49414416 TGCCAGAGCAGAACCAAGGCTGG + Intronic
1174829676 20:53801142-53801164 TTACAGAGGAGACCCTAGGCAGG - Intergenic
1175844376 20:62050933-62050955 AATCAGTGGAGACCCCAGGCAGG + Intronic
1175993341 20:62800868-62800890 TGTGAGATGAGACCGCTGGCTGG + Exonic
1176130345 20:63494173-63494195 AGCCAGAGGAGACCCCAGAATGG - Intronic
1176300805 21:5098111-5098133 TGGCACCGGAGACACCAGGCTGG - Intergenic
1176840906 21:13842881-13842903 TGTTCTAGAAGACCCCAGGCGGG - Intergenic
1178966734 21:37127149-37127171 TATAAGAAGAGACCCCAGGCTGG - Intronic
1179856230 21:44163842-44163864 TGGCACCGGAGACACCAGGCTGG + Intergenic
1181622480 22:24100561-24100583 TCTCACAGTAGACCCAAGGCTGG - Intronic
1181639339 22:24188570-24188592 TGTCATCTCAGACCCCAGGCAGG + Exonic
1181725891 22:24810670-24810692 AGGCAGATGAGACCCCAGGAAGG + Intronic
1182845062 22:33423648-33423670 TCTCACAGCAGAGCCCAGGCTGG - Intronic
1182845201 22:33424965-33424987 TGTAAGAAGAGACACAAGGCTGG + Intronic
1183420185 22:37707346-37707368 TGGCAGAGGAGTGCACAGGCAGG - Intronic
1184743764 22:46444219-46444241 TTTTAGAGGAAATCCCAGGCTGG - Intronic
1185040137 22:48499701-48499723 TGGCAGAGGTCGCCCCAGGCAGG - Intronic
949561627 3:5208002-5208024 GGGCAGAGGAGAGCCCAGGCAGG + Intronic
949740362 3:7226274-7226296 TCTCAGATGAGATCCCAGCCAGG - Intronic
951523592 3:23631897-23631919 TGTCAGAGGGAAGCCCAGGCTGG - Intergenic
952016195 3:28959579-28959601 GCTCAGAGGAGACCCAAGGTGGG - Intergenic
952047364 3:29339085-29339107 TGTCAGGGGATACCACAGGTGGG - Intronic
953413384 3:42702376-42702398 TATCAGGAGAGGCCCCAGGCTGG - Intronic
954443262 3:50533347-50533369 TCTCAGAGGAGCCAGCAGGCAGG + Intergenic
954456250 3:50601283-50601305 ACTCAGAGGAGGCCGCAGGCGGG - Intergenic
954567337 3:51609601-51609623 TGTCACAGCAGACACCATGCTGG - Intronic
954579316 3:51694660-51694682 TGGCAGAGAGCACCCCAGGCAGG - Intronic
954697589 3:52435867-52435889 AGCCAGAGGAGCCCCCAGCCCGG - Exonic
955981471 3:64531819-64531841 TTTCTGAGGCAACCCCAGGCAGG + Intronic
956088245 3:65636559-65636581 TGTCAGAGGGGAAACCAGGATGG - Intronic
957348012 3:78986487-78986509 TGTCATTGAAGACTCCAGGCTGG - Intronic
960055952 3:113276468-113276490 AGGCTGAGGAGACCCCAGGCTGG - Intronic
961824155 3:129590036-129590058 GGTCAGAGCAGACACCCGGCAGG - Intronic
962313168 3:134340017-134340039 TGGCAGAGAAGACAACAGGCAGG - Intergenic
963046491 3:141106393-141106415 AGTCAGAGCAGATCCCAGGGAGG - Intronic
968516844 4:1019054-1019076 TCTCAGTGGTGACCACAGGCGGG + Intronic
969300263 4:6293301-6293323 TGGCGGAGGGGACCACAGGCTGG - Intronic
970705208 4:18793178-18793200 TATCAGAGGAGTCCTCAGGTGGG - Intergenic
970735340 4:19160543-19160565 TATCAAAGGGGACCCCAGGAAGG - Intergenic
972335624 4:38105103-38105125 TGGGAGAGGAGACCACAGTCAGG - Intronic
973387655 4:49524261-49524283 TGACAGAGGAGGAGCCAGGCCGG + Intergenic
976489353 4:85650739-85650761 TGTCAGAGAAGACTACAGGAAGG + Intronic
979431562 4:120638925-120638947 TGTCAGATGAGACTCCAGTTGGG + Intergenic
980671012 4:136008098-136008120 TGGCAGTGGCGGCCCCAGGCAGG - Intergenic
981005002 4:139865772-139865794 GGTCAGAGGAGGACCCAAGCAGG - Intronic
981502974 4:145472647-145472669 TGTCAGGGGAGAGACCAGGTAGG - Intergenic
982165202 4:152607882-152607904 TTTGAAAGAAGACCCCAGGCTGG + Intergenic
983391893 4:167142284-167142306 GGTGAGATGAGAACCCAGGCTGG + Intronic
987814408 5:22881918-22881940 TGTCATGGGAGACCCCTGGTAGG - Intergenic
987909530 5:24123552-24123574 TGTCAGAGGAGAGGCCTGGTGGG - Intronic
988447960 5:31309890-31309912 TGTCAGAGGAGGCACCTGGTGGG - Intronic
988558771 5:32261417-32261439 AGTCAGAGGACACCCGAGGGAGG - Intronic
989139404 5:38188527-38188549 GGTCAGAGTAGAACACAGGCTGG - Intergenic
989150969 5:38299475-38299497 TGTCAGAGGTGGGCCCTGGCAGG + Intronic
989197183 5:38727067-38727089 TGTCAGAGGAGAAGCCTGGTGGG - Intergenic
989267909 5:39499029-39499051 TGTAAGAGTAGAGCACAGGCAGG + Intergenic
991676585 5:69094399-69094421 TGTCAGCGGAGACCGGAGGGAGG - Intronic
992337558 5:75788471-75788493 TGTCAGAGGAGGGACCAGGTGGG + Intergenic
993242134 5:85403737-85403759 TGTCAAAGGAGAGACCAGGTTGG + Intergenic
996197062 5:120621588-120621610 TGTCAGGGGAGAGACCAGGTGGG + Intronic
997565974 5:134886685-134886707 TGTCAGAGGCCACCTCAGGAAGG + Intronic
999868273 5:155725771-155725793 TGTCAGAGGAGAGACCAGGTGGG + Intergenic
1000631325 5:163594101-163594123 TGGCAGCAGAGACCCAAGGCTGG - Intergenic
1001910539 5:175513867-175513889 TGGCAGAGGGAACCACAGGCAGG + Intronic
1002279489 5:178122197-178122219 TGGCAGAGGAGCACCTAGGCAGG + Exonic
1002469871 5:179428839-179428861 TGACAGAGGGCAGCCCAGGCAGG + Intergenic
1003248202 6:4401907-4401929 TGTCAGACATAACCCCAGGCGGG - Intergenic
1005249231 6:23925813-23925835 TATCAGAGGAAGTCCCAGGCTGG - Intergenic
1006611645 6:35297820-35297842 TGTCAGAGCCGCCCCCAGCCGGG + Intergenic
1007268041 6:40612003-40612025 GGTCAGAGGAGAAGCCAGGGAGG + Intergenic
1008082382 6:47208204-47208226 ATTCAGAGGTGACTCCAGGCAGG - Intergenic
1011640822 6:89414275-89414297 CGTCAAAGGAAACCCCAGGGAGG + Intergenic
1012525893 6:100177483-100177505 GGTGAGAGGAGACCCCAGCCTGG + Intergenic
1013301014 6:108804961-108804983 CCTCAGATGAGACCCCAGCCCGG - Intergenic
1013983223 6:116158717-116158739 TGTCAGTGGTGATCCCAGGAGGG + Intronic
1014338557 6:120172879-120172901 TTTCAGAGGTGACACCAGCCTGG - Intergenic
1016114561 6:140263893-140263915 TGTAAGAGGAGACCACAGTTAGG - Intergenic
1017702701 6:157090963-157090985 TGGAAGAGGCTACCCCAGGCGGG - Intronic
1018195979 6:161356409-161356431 TGTCAGTGGGGACCCCCGGGGGG + Intronic
1018198633 6:161376278-161376300 CCTCAGAGGAGAATCCAGGCTGG - Intronic
1018206520 6:161441809-161441831 TGGCCGAGGAGCCCCCAGGCAGG - Intronic
1018638471 6:165885454-165885476 TGTCAGGGGAGGCACCTGGCGGG - Intronic
1018690072 6:166337503-166337525 CGGCAGAGGAGACCCCAAGCAGG - Intronic
1018947274 6:168356630-168356652 TGGCAGGGGCGGCCCCAGGCAGG + Intergenic
1018947339 6:168356850-168356872 TGGCAGGGGCGGCCCCAGGCAGG + Intergenic
1018947372 6:168356960-168356982 TGGCAGGGGCGGCCCCAGGCAGG + Intergenic
1018947471 6:168357290-168357312 TGGCAGGGGCGGCCCCAGGCAGG + Intergenic
1018947504 6:168357400-168357422 TGGCAGGGGCGGCCCCAGGCAGG + Intergenic
1018947604 6:168357729-168357751 TGGCAGGGGCGGCCCCAGGCAGG + Intergenic
1018947636 6:168357839-168357861 TGGCAGGGGCGGCCCCAGGCAGG + Intergenic
1018947794 6:168358333-168358355 TGGCAGGGGCGGCCCCAGGCAGG + Intergenic
1018947827 6:168358443-168358465 TGGCAGGGGCGGCCCCAGGCAGG + Intergenic
1019478451 7:1255237-1255259 CCTCAGAGCAGGCCCCAGGCCGG - Intergenic
1019514622 7:1434288-1434310 AGGCAGGCGAGACCCCAGGCAGG + Intronic
1019801129 7:3089233-3089255 TGTCAGAAGACACCGCACGCTGG + Intergenic
1021613885 7:22482759-22482781 TGTCAGAGCTGACCCCAGAGAGG - Intronic
1023880814 7:44320316-44320338 GGTCAGAGTAGACCACAAGCTGG + Intronic
1024996940 7:55279356-55279378 TCTCAGAGCAGGGCCCAGGCTGG + Intergenic
1024996954 7:55279428-55279450 TCTCAGAGCAGGACCCAGGCTGG + Intergenic
1024996961 7:55279464-55279486 TCTCAGAGAAGAACCCAGGCTGG + Intergenic
1024996997 7:55279620-55279642 TCTCAGAGCAGGGCCCAGGCTGG + Intergenic
1025635133 7:63314953-63314975 TAACAGAGGAGGACCCAGGCTGG + Intergenic
1025647562 7:63433217-63433239 TAACAGAGGAGGACCCAGGCTGG - Intergenic
1027002087 7:74660486-74660508 TATAAGAGAAGACCACAGGCCGG - Intronic
1027486925 7:78773138-78773160 TTTCTGAGAAGACCACAGGCAGG + Intronic
1027487051 7:78774685-78774707 TTTCTGAGAAGACCACAGGCAGG + Intronic
1029109770 7:98207057-98207079 TGTCAGAGCAGAACTCAGGGAGG - Exonic
1030313300 7:108089389-108089411 ATTCAGAGGAGAACCAAGGCAGG - Intronic
1030678320 7:112407973-112407995 TTTCAAAGGAGCTCCCAGGCTGG + Intergenic
1032277218 7:130468821-130468843 TGTCAGGGGAAATCCCAGGATGG - Intergenic
1032532067 7:132630144-132630166 TATAAGAAGAGACACCAGGCCGG - Intronic
1032718389 7:134530404-134530426 TGGCAAAGGAGACCCCAGTGAGG + Intronic
1033535736 7:142310183-142310205 TTTCAGAGGATACCCAGGGCAGG - Intergenic
1034199923 7:149278004-149278026 TGGCATAGGGGACCCAAGGCAGG - Intronic
1034980812 7:155475088-155475110 TTTCAGCGGAGAGCCAAGGCAGG + Intronic
1035560184 8:598439-598461 TCCCAGAGGAGACACCCGGCAGG + Intergenic
1036710307 8:11074283-11074305 AGACAGAGGAGACCCAAGGCCGG - Intronic
1036768534 8:11563877-11563899 CGGCAGAGGAGACCGCAAGCGGG - Intronic
1046573707 8:115998780-115998802 TTTCAGAGGAGACATCAGGGTGG + Intergenic
1048437387 8:134431258-134431280 TGCACCAGGAGACCCCAGGCTGG + Intergenic
1048983156 8:139714162-139714184 GGTCAGAGGAGGCCCCAGAGAGG + Intergenic
1049237854 8:141521462-141521484 GGTCAGAAACGACCCCAGGCTGG + Intergenic
1049355733 8:142187212-142187234 TGTCAGTGGGGAGCCCAGGTGGG - Intergenic
1049379220 8:142303685-142303707 TGGCAGAAGCCACCCCAGGCAGG + Intronic
1049391203 8:142372592-142372614 TGCCAGGGGTGCCCCCAGGCAGG - Intronic
1049575011 8:143385897-143385919 TTTCAGAGTGGTCCCCAGGCAGG + Intergenic
1049651577 8:143772167-143772189 TGTCGGAGGCGGCCGCAGGCGGG + Intergenic
1051339599 9:16099331-16099353 TGGCAGAGGAGCCTCCAGGCTGG + Intergenic
1052387428 9:27838276-27838298 TGACAGAGGTGACCCAGGGCAGG + Intergenic
1053217964 9:36288596-36288618 TGGCAGAGCAGAACCCGGGCAGG + Intronic
1053350453 9:37410497-37410519 GGGCAGAGGGGATCCCAGGCGGG + Intergenic
1053528098 9:38849533-38849555 TGTCTGAGGCTTCCCCAGGCTGG + Intergenic
1054638035 9:67514398-67514420 TGTCTGAGGCTTCCCCAGGCTGG - Intergenic
1056413387 9:86354203-86354225 TGACCGAGGAACCCCCAGGCCGG - Intronic
1057181457 9:93033005-93033027 TCTCAGTGGGGCCCCCAGGCTGG + Intronic
1057221420 9:93259711-93259733 TGAGAGGGGCGACCCCAGGCAGG - Intronic
1061113637 9:128593752-128593774 TCTCTGAAGAGCCCCCAGGCTGG - Intronic
1061130246 9:128704180-128704202 TGCCAAAGGTGACCTCAGGCCGG - Intronic
1061625530 9:131838830-131838852 CGTCAGTGAAGCCCCCAGGCAGG + Intergenic
1061801131 9:133113973-133113995 GGACAGAGGTGTCCCCAGGCAGG + Intronic
1062363161 9:136197134-136197156 TGTCAGAGGAGGGGCCAGGTGGG + Exonic
1062424061 9:136497996-136498018 GCACAGAGGAGACCCCAGGAAGG - Intronic
1062536779 9:137024513-137024535 GGTCAGAGTAGACCACAAGCTGG - Intronic
1185877578 X:3713176-3713198 TGGCGGAGGAGACCCCCGACGGG - Exonic
1185894136 X:3843429-3843451 TGGCAGAGGAGACCCCGGACTGG - Exonic
1185899255 X:3881853-3881875 TGGCAGAGGAGACCCCGGACTGG - Intergenic
1185904372 X:3920282-3920304 TGGCAGAGGAGACCCCGGACTGG - Intergenic
1186915222 X:14211960-14211982 TGTCAGAGAAGACTCCAGTAAGG + Intergenic
1187058363 X:15762334-15762356 TGTCAGAGTAAACCAGAGGCAGG + Intronic
1188111382 X:26198840-26198862 TGCCTGGGGAGACTCCAGGCAGG + Intergenic
1189171788 X:38916459-38916481 TTACAGAGGAGACCCTGGGCTGG + Intergenic
1189427331 X:40912905-40912927 TGTGAGCTGAGACCCCTGGCTGG + Intergenic
1189486971 X:41441988-41442010 TTTCAGAAGAGGCCCCAGGAAGG + Intergenic
1192439846 X:71166478-71166500 TATCAGTGGAGACCACAGACGGG + Intronic
1199347958 X:146763700-146763722 TGTCAGAGGAGAAGCCTGGTGGG + Intergenic
1200033082 X:153312051-153312073 TGTCAGAGGAGCCCTCGGGAGGG - Intergenic
1200138088 X:153884725-153884747 TGCCAGGGGAGAGGCCAGGCTGG + Intronic
1200291515 X:154879720-154879742 TGTCAGAGGAGAGGCCTGGTGGG + Intronic