ID: 1174197811

View in Genome Browser
Species Human (GRCh38)
Location 20:48785932-48785954
Sequence GCCACAGGGCAGAAAGAGCC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 569
Summary {0: 1, 1: 0, 2: 8, 3: 66, 4: 494}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174197806_1174197811 17 Left 1174197806 20:48785892-48785914 CCTCTAGCAAAGGGAGACAGACA 0: 1
1: 0
2: 1
3: 23
4: 349
Right 1174197811 20:48785932-48785954 GCCACAGGGCAGAAAGAGCCGGG 0: 1
1: 0
2: 8
3: 66
4: 494

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174197811 Original CRISPR GCCACAGGGCAGAAAGAGCC GGG Intronic
900397718 1:2460079-2460101 ACCGGAGGGCAGAAAGGGCCTGG - Intronic
900847287 1:5114076-5114098 GCCACATGGCAGAAAGTGAAAGG + Intergenic
901032203 1:6313728-6313750 GCCACAGGGCAGCAGAAGCCTGG + Intronic
901215950 1:7555519-7555541 TCCCCAGGGCAGACAGAGCCAGG + Intronic
901263826 1:7893989-7894011 ACCACTGGGCAGAGAGAGCTTGG - Intergenic
901457677 1:9372681-9372703 GACACAGAGCAGAGAGAGCTGGG - Intergenic
902279912 1:15366889-15366911 GCCAAAGGGCATAAACAGGCAGG + Intronic
903949076 1:26983813-26983835 CCCACAGGGCAGCATGTGCCTGG - Intergenic
904365172 1:30006204-30006226 ACAACAGGGAAGAGAGAGCCAGG - Intergenic
904477998 1:30776909-30776931 TCCTCAGGGAGGAAAGAGCCTGG + Intergenic
904901662 1:33862541-33862563 GCCCCTTGGGAGAAAGAGCCAGG + Intronic
904924879 1:34039636-34039658 GTGACAAGGCAGAAGGAGCCTGG + Intronic
905822805 1:41006934-41006956 GGAACAGGGCACAGAGAGCCTGG + Intronic
906185623 1:43860005-43860027 GCCACAGGGCAGGAAGAGAAGGG - Intronic
906684013 1:47751259-47751281 GGCAGAGGGCACAAAGAGACAGG - Intergenic
906945986 1:50294698-50294720 GCCACAGTATATAAAGAGCCTGG + Intergenic
907291793 1:53418748-53418770 GCCAAAGGCCTGAAAGAGCCCGG + Intergenic
907372342 1:54011551-54011573 CCCACAGGAGAGAGAGAGCCTGG - Intronic
907395918 1:54189781-54189803 GTCACAGGCCAGAAGGAGCTGGG + Intronic
907718749 1:56952032-56952054 GCCACAGGTAAGAGACAGCCAGG - Exonic
908334418 1:63106113-63106135 GCCACAAGGTAAAAGGAGCCTGG + Intergenic
908960881 1:69695675-69695697 GGCACAGGGCAGCAAGGGCCTGG - Intronic
911889752 1:103353331-103353353 GTCACATGGCAGATAGAGCAAGG - Intergenic
912382252 1:109253970-109253992 CCCTCCAGGCAGAAAGAGCCTGG + Intronic
912638663 1:111322562-111322584 GGCACAGGGAAGAAATAGGCAGG + Intergenic
912950001 1:114113992-114114014 GTCATGGGGCAGGAAGAGCCTGG - Intronic
913190874 1:116411982-116412004 GCCACAAGACAGAAGGAGCCTGG + Intergenic
913497126 1:119438694-119438716 GCCACAGTGCACAAAGCTCCAGG + Intergenic
913500298 1:119466915-119466937 GCCACAGAGCATAAAGCTCCAGG + Intergenic
916177390 1:162053905-162053927 GCCACAGGATAGAAGGAGCCTGG + Intergenic
916455986 1:164971429-164971451 GCTGCAGGGCAGAAGGAGCTGGG + Intergenic
917629035 1:176875112-176875134 TCCTCAGGGCAGAAAGGGCCAGG - Intronic
917973738 1:180225397-180225419 CCCTCAGTGGAGAAAGAGCCTGG + Intergenic
918878449 1:190082221-190082243 GCCTCAAGACAGAAGGAGCCTGG + Intergenic
919493456 1:198234794-198234816 GCCACAAGGCAGCTAGAACCTGG - Intronic
919774575 1:201185696-201185718 GCCACTGTGCGGAGAGAGCCAGG + Intergenic
919901397 1:202046554-202046576 GGCCCAAGGCAGCAAGAGCCTGG - Intergenic
920211254 1:204330356-204330378 GTCAGAGGGCAGAAAGGACCAGG + Intronic
920507652 1:206527749-206527771 GCCCAAGGCCAGAAAGAGCCTGG - Intronic
921163896 1:212492161-212492183 GCAAAAGGGTAGAAGGAGCCTGG + Intergenic
921298592 1:213728009-213728031 GTCACAGGGGAGAAGAAGCCAGG + Intergenic
922360729 1:224819050-224819072 GGCACAGTGCAGACTGAGCCAGG + Intergenic
922702324 1:227769142-227769164 GCCCCAGGGGAGACACAGCCTGG - Intronic
923180100 1:231509196-231509218 GCCTCAGGGCAGAGAGCCCCAGG - Intergenic
923664999 1:235991870-235991892 GCCACAGGGATGGGAGAGCCTGG + Intronic
923873242 1:238019167-238019189 GCCACAGAATAGCAAGAGCCAGG - Intergenic
923946977 1:238899076-238899098 GCCAAAGGCCAGAAAGCCCCAGG + Intergenic
924105459 1:240644852-240644874 GCCACAGGACTGATTGAGCCAGG + Intergenic
1063808772 10:9679764-9679786 GCAAGAGGGCAGAAAAAGCAAGG - Intergenic
1063942805 10:11147964-11147986 GCCACAGGGCAGAATGAGGAAGG + Intronic
1064105331 10:12496384-12496406 GCAACAAGACAGAAACAGCCCGG - Intronic
1064307984 10:14185888-14185910 GCAACAGGGCAGAGAGAGACTGG + Intronic
1064451020 10:15442223-15442245 GCCGGAGGCCAGAAAGAGCGTGG - Intergenic
1064673207 10:17736474-17736496 GCCACAGGGGAGAATGAATCAGG + Intergenic
1067088711 10:43255853-43255875 GCCAGTGGGCAGACAGCGCCAGG - Intronic
1067414440 10:46092714-46092736 ACCACAGGGCAGGAGCAGCCAGG - Intergenic
1067434505 10:46267260-46267282 ACCACAGGGCAGGAGCAGCCAGG - Intergenic
1067439201 10:46299085-46299107 ACCACAGGGCAGGAGCAGCCAGG + Intronic
1067465919 10:46498712-46498734 CCCACAGTGCAGAAAGGGACTGG - Intergenic
1067621268 10:47885894-47885916 CCCACAGTGCAGAAAGGGACTGG + Intergenic
1069775358 10:70924014-70924036 CCCAGAGGGCAGAAAGAACTTGG + Intergenic
1070592885 10:77812906-77812928 GCCCCAGGGCAGCAAGTGCATGG - Intronic
1070593204 10:77815059-77815081 CCCACAGGGCACGGAGAGCCAGG - Intronic
1070914176 10:80142278-80142300 GCCACAGGGCAGGATCGGCCCGG - Intronic
1071416443 10:85446061-85446083 GTCACAGGCCAGGAAGAGTCTGG + Intergenic
1072590819 10:96827092-96827114 ACTACAGGTCTGAAAGAGCCAGG + Intergenic
1072712611 10:97726659-97726681 GCCACGGGGTGGAAGGAGCCTGG - Intergenic
1072804371 10:98415289-98415311 GCCCCAGGGCAGCAGGAGGCTGG - Intergenic
1073244638 10:102081059-102081081 GACACAGGGCAGCAACATCCAGG - Intergenic
1073262792 10:102203271-102203293 CCCACAGGACAGAAAGAGATTGG - Intergenic
1074283583 10:112076882-112076904 GCCAAAGGCCCGAAAGACCCTGG - Intergenic
1074429858 10:113385300-113385322 GCCACTGAGCACACAGAGCCTGG + Intergenic
1074517325 10:114182210-114182232 GTCACAGGGCAGCAACAGCTGGG + Intronic
1075078558 10:119367967-119367989 GGGCCAGGGCAGGAAGAGCCAGG + Intronic
1075551034 10:123392423-123392445 GCTATAGGGCAGAAAGAGCCAGG + Intergenic
1075800472 10:125150538-125150560 GCCACAGAGAAGCCAGAGCCAGG + Intronic
1075923844 10:126235166-126235188 GCCACAGAGCAGCAGGTGCCTGG - Intronic
1075976621 10:126701680-126701702 GCCACAGTGTAGAAAGAGGAGGG - Intergenic
1076187993 10:128463839-128463861 GCCACCGGGGAGAATGAGGCTGG - Intergenic
1076324200 10:129608774-129608796 GCCCCTGGGCAGAAAGTTCCTGG - Intronic
1076468277 10:130700796-130700818 GCCACAAGACAGACAGAGCTGGG + Intergenic
1076521665 10:131085104-131085126 CCCACAGGGCAGAGGGAGCGAGG - Intergenic
1076902659 10:133347591-133347613 GCCACAGAGGAGGTAGAGCCTGG - Intronic
1077009581 11:374268-374290 GCCACAAAGCGGAGAGAGCCTGG + Intronic
1077337399 11:2011559-2011581 GCCACAAGGCTGCAGGAGCCTGG + Intergenic
1078145874 11:8721563-8721585 CACACAGGACAGAAAGGGCCAGG + Intronic
1078479134 11:11660820-11660842 CACACATGGCAGACAGAGCCTGG + Intergenic
1079505283 11:21146411-21146433 GCCAGAGGCCAGAGAGAGCCGGG + Intronic
1079601507 11:22316646-22316668 GGCACAGGGGAGAGAGAGGCGGG - Intergenic
1080131953 11:28806297-28806319 CCCACAGGGCAGTAACAGGCAGG - Intergenic
1080308887 11:30866937-30866959 CCCACAGGGCAGAAAGTGGAAGG - Intronic
1080650698 11:34220623-34220645 AGCAAAAGGCAGAAAGAGCCTGG + Intronic
1080830950 11:35892814-35892836 TCCACATGGCAGAAAGAGGGAGG - Intergenic
1081930624 11:46868407-46868429 GCCAGAGGGCAGACAAACCCAGG + Intronic
1083088448 11:60175043-60175065 GAAACAGAGCAGAAAGACCCAGG - Intronic
1083670077 11:64294883-64294905 ACCACAGGGCAGAGAGAGGGAGG + Intronic
1083775143 11:64890975-64890997 GCCACAGGGCAGGCAGGGCAGGG + Intergenic
1084432023 11:69116452-69116474 GCACCAGGGCAGACAGAGGCCGG - Intergenic
1084561279 11:69906672-69906694 GTCACAGGGCAGTAAGTGACAGG - Intergenic
1084747007 11:71178411-71178433 ACCAGAGGCCAGAAAGAGACGGG + Intronic
1085336706 11:75702152-75702174 GCCCAAGGGCAGAAAGATCAGGG + Intergenic
1085474724 11:76782758-76782780 CCCACAGAGAAGAGAGAGCCCGG - Intronic
1085760090 11:79234182-79234204 GTCAAAGGGAAGAAAGTGCCAGG - Intronic
1087665980 11:101048118-101048140 GCCACTGGCTAGAAGGAGCCTGG + Intronic
1088107009 11:106218728-106218750 ACTACAGGAAAGAAAGAGCCAGG - Intergenic
1088288117 11:108207836-108207858 TCCACAGGGCAGCAGGAGCTGGG - Intronic
1088805411 11:113347866-113347888 GCCACAGGGCAGAGAAGGGCAGG - Intronic
1088937156 11:114414134-114414156 GGGACAGGGCAGGCAGAGCCTGG - Intronic
1089329618 11:117680420-117680442 GCCACAGAGCAGAAAGTGTAGGG + Intronic
1090474966 11:127011862-127011884 GCCTCAGAGCAGAAAGAAACAGG + Intergenic
1090490352 11:127155291-127155313 GCCTCAGGGAAGACTGAGCCAGG - Intergenic
1090921912 11:131214358-131214380 GTCACAGGGCAAGAAGAGCAGGG + Intergenic
1090987004 11:131776782-131776804 GTCACAGGACAGAAGGAACCTGG - Intronic
1202820383 11_KI270721v1_random:66741-66763 GCCACAAGGCTGCAGGAGCCTGG + Intergenic
1091585164 12:1811723-1811745 GCTACAGGGCAGAAAGAGAGAGG + Exonic
1091889927 12:4045257-4045279 GACAAAGGACAGAGAGAGCCCGG - Intergenic
1092015115 12:5152172-5152194 TCCACAGGGAGGAAAGACCCTGG - Intergenic
1094041722 12:26126150-26126172 ATCACAGGCCAGCAAGAGCCGGG + Intronic
1094208160 12:27862437-27862459 GCCGCATGGCAGAAAGGCCCAGG - Intergenic
1096316199 12:50568458-50568480 CTCAGAGGGCTGAAAGAGCCAGG - Intronic
1096469249 12:51865856-51865878 GCCCCAGGGCAGAATGCGTCTGG + Intergenic
1098338888 12:69431592-69431614 GCCACAGGCCAGAGAATGCCTGG + Intergenic
1098514162 12:71354389-71354411 GCCACAGTGCAGAAAGGGCAGGG + Intronic
1099574689 12:84363569-84363591 GCCACAGGGCAGGCAGCTCCAGG - Intergenic
1100359168 12:93860516-93860538 AGCAAAGGGCAGGAAGAGCCAGG + Intronic
1100418237 12:94401593-94401615 GCCACAAAGCAGAAAGATACAGG + Intronic
1103146501 12:118599620-118599642 TCCAAAGGACAGAAAGAGCCAGG - Intergenic
1103179502 12:118897681-118897703 GCCACAGGGGAGAAAGATAGAGG - Intergenic
1103484354 12:121273144-121273166 GCCATGGGGCAGAGAGAGGCTGG + Intronic
1103636723 12:122313242-122313264 ATCCCAGGGCAGAAAGAGCCTGG - Intronic
1103967133 12:124646966-124646988 GCCCCAGGGGACACAGAGCCAGG - Intergenic
1104148378 12:126056971-126056993 GCCGCATGGAAGAAAGAGCACGG - Intergenic
1104771783 12:131368473-131368495 GTCACAGAGCAGCAAAAGCCTGG + Intergenic
1104970967 12:132530539-132530561 GGCTCAGGGCAGAGAGACCCAGG - Intronic
1106594204 13:31122951-31122973 TCCACAGTGCAGAAAGAAGCTGG + Intergenic
1106754140 13:32804815-32804837 GCCATAGGGGAGAGAGAGCATGG - Intergenic
1107535211 13:41322632-41322654 GACACAGGACAGACACAGCCAGG - Intronic
1107668848 13:42722094-42722116 GCAACAAGGCAGAAGGAGCCTGG - Intergenic
1109223538 13:59664946-59664968 GCCACGGGGGAGAAGAAGCCCGG - Intergenic
1111143807 13:84155796-84155818 GCCACAGGGCACCAAGTCCCTGG - Intergenic
1112101877 13:96198191-96198213 GACACAGGGCACCAAGTGCCTGG + Intronic
1112308144 13:98293799-98293821 CCCACTGGGAAGAAAGGGCCAGG + Intronic
1113709081 13:112452400-112452422 GCCACAGGGCAGGAAGTGCAGGG + Intergenic
1114070997 14:19106883-19106905 TCTACAGTCCAGAAAGAGCCTGG - Intergenic
1114091267 14:19293122-19293144 TCTACAGTCCAGAAAGAGCCTGG + Intergenic
1118703736 14:68460673-68460695 GCCACAGAACAGAAAGTGCTGGG - Intronic
1119099861 14:71869896-71869918 ATCACAGGGCAGAAAGAGAGAGG - Intergenic
1120500352 14:85289408-85289430 TTCACATGGCAGAAAGGGCCAGG + Intergenic
1120700996 14:87698652-87698674 GCAGCTGGGCAGAAGGAGCCTGG - Intergenic
1121078562 14:91089328-91089350 GCCACAGGGCAGAAAGAAGCAGG + Intronic
1121329944 14:93043636-93043658 GCCACAGATAAGAATGAGCCAGG - Intronic
1121799634 14:96763874-96763896 TCCAGAAGGCAGAAGGAGCCTGG + Intergenic
1123754308 15:23385006-23385028 GACCCAGGGCAGAAAGATTCCGG + Intergenic
1123843149 15:24269494-24269516 ACGAGAGGGCAGACAGAGCCTGG - Intergenic
1123998217 15:25733602-25733624 GCCACAGGGCTGTCAGGGCCTGG - Intronic
1124480212 15:30072994-30073016 GGCACAGAGCAGCAAGACCCAGG - Intergenic
1125591087 15:40854790-40854812 GCCTGTGGGCACAAAGAGCCAGG + Intronic
1125931025 15:43600258-43600280 GCAGCAGTGCTGAAAGAGCCAGG + Exonic
1125944189 15:43700074-43700096 GCAGCAGTGCTGAAAGAGCCAGG + Intergenic
1126671130 15:51115935-51115957 GCCACAAGATGGAAAGAGCCTGG - Intergenic
1127104458 15:55598090-55598112 GCCAGAGAGCATAAAGAGCAAGG - Intergenic
1127117536 15:55742997-55743019 GCCGCAGAGCAGAGAGCGCCCGG - Intronic
1128058381 15:64717852-64717874 CTCACAGGGCAGGAAGCGCCTGG + Intergenic
1128695895 15:69762602-69762624 GCCAGCTGGCAGAAAGAGCAGGG - Intergenic
1128943649 15:71807655-71807677 GCTACAGAGGAGAAAGAGCCAGG - Intronic
1129239025 15:74240902-74240924 GCCTCAGGGCAAAAAGACCTAGG - Intronic
1129773603 15:78218490-78218512 GACACAGAGCAGAAGGAGCCTGG + Intronic
1130727328 15:86452774-86452796 GCCAGTGGGCAGAAATAGCAAGG - Intronic
1130923018 15:88364984-88365006 GCCACAGGGCAAGCAGAGGCTGG - Intergenic
1131069542 15:89457176-89457198 GCAACAAGACAGAAAGAGTCTGG - Intergenic
1131391054 15:92049183-92049205 GCCACTGTGCAGAAAGATGCAGG - Intronic
1131509944 15:93044389-93044411 GCCACAGGCCAGAAGGCACCAGG + Intronic
1132394251 15:101460280-101460302 GCCAGAGGGCAGGAAAAGGCTGG - Intronic
1132540968 16:509607-509629 CCCACAGGGCAGGGAGACCCTGG - Intronic
1132870087 16:2112096-2112118 GCAGCAGAGCAGCAAGAGCCAGG + Intronic
1133002030 16:2856614-2856636 GCCAGAGGAGAGAGAGAGCCAGG - Intronic
1133002052 16:2856719-2856741 GGCACAGGTCAGAAAGGGGCTGG - Intronic
1133129359 16:3667038-3667060 GCCACAGGGCAGAATGGGACAGG + Intronic
1133270383 16:4608462-4608484 GGCAGAGGGCAGACAGAGCCAGG - Intergenic
1133893325 16:9902412-9902434 GCCACAGGGTAGAAGGAGCCTGG + Intronic
1134166007 16:11930073-11930095 TTCACAGGGCAGAAACAGCTGGG + Intronic
1134462054 16:14438004-14438026 GACCCAGGGCAGAAAGAGTCCGG - Intronic
1134494712 16:14723654-14723676 TTCACAGGGCAGAAACAGCTGGG - Intronic
1134500095 16:14762774-14762796 TTCACAGGGCAGAAACAGCTGGG - Intronic
1134522452 16:14924854-14924876 GCAGCAGAGCAGCAAGAGCCAGG - Intronic
1134526636 16:14949390-14949412 TTCACAGGGCAGAAACAGCTGGG - Intronic
1134537997 16:15041891-15041913 GCCTCAGGCCCGAAGGAGCCTGG + Intronic
1134545766 16:15106955-15106977 TTCACAGGGCAGAAACAGCTGGG + Intronic
1134580485 16:15366276-15366298 TTCACAGGGCAGAAACAGCTGGG + Intronic
1134710122 16:16323505-16323527 GCAGCAGAGCAGCAAGAGCCAGG - Intergenic
1134714214 16:16347863-16347885 TTCACAGGGCAGAAACAGCTGGG - Intergenic
1134717336 16:16363505-16363527 GCAGCAGAGCAGCAAGAGCCAGG - Intergenic
1134722088 16:16391227-16391249 TTCACAGGGCAGAAACAGCTGGG - Intronic
1134945339 16:18320642-18320664 TTCACAGGGCAGAAACAGCTGGG + Intronic
1134949481 16:18345140-18345162 GCAGCAGAGCAGCAAGAGCCAGG + Intergenic
1134952603 16:18360795-18360817 TTCACAGGGCAGAAACAGCTGGG + Intergenic
1134957416 16:18388654-18388676 GCAGCAGAGCAGCAAGAGCCAGG + Intergenic
1135027597 16:19010524-19010546 GCCACAAGATGGAAAGAGCCTGG - Intronic
1135311398 16:21407494-21407516 TTCACAGGGCAGAAACAGCTGGG + Intronic
1135364350 16:21839945-21839967 TTCACAGGGCAGAAACAGCTGGG + Intronic
1135447493 16:22531403-22531425 TTCACAGGGCAGAAACAGCTGGG - Intronic
1136019727 16:27432415-27432437 GCCACAGGGCAGAGAGCCCCAGG - Intronic
1136150555 16:28345394-28345416 TTCACAGGGCAGAAACAGCTGGG + Intronic
1136166792 16:28459232-28459254 TTCACAGGGCAGAAACAGCTGGG + Intronic
1136196183 16:28655800-28655822 TTCACAGGGCAGAAACAGCTGGG - Intronic
1136212524 16:28769925-28769947 TTCACAGGGCAGAAACAGCTGGG - Intronic
1136257245 16:29049833-29049855 TTCACAGGGCAGAAACAGCTGGG - Intronic
1136308103 16:29386490-29386512 TTCACAGGGCAGAAACAGCTGGG + Intronic
1136321519 16:29488028-29488050 TTCACAGGGCAGAAACAGCTGGG + Intronic
1136436199 16:30227998-30228020 TTCACAGGGCAGAAACAGCTGGG + Intronic
1137236444 16:46622253-46622275 TCCACAGGGGACCAAGAGCCTGG + Intergenic
1137624774 16:49900683-49900705 GCCACACAGCAGAAGGAGCAGGG - Intergenic
1137766643 16:50982535-50982557 GCCACAGGGTAGCAAGGCCCCGG + Intergenic
1138032246 16:53568894-53568916 GCCTCAGGGGAGAATGAGACTGG + Intergenic
1138349597 16:56339458-56339480 GCCTCAGGGAGGCAAGAGCCAGG + Intronic
1138395180 16:56698497-56698519 GTCACAGAGCAGAAAGAGAAGGG + Intronic
1139015583 16:62684959-62684981 GTCACAGGGCAGACAGCTCCAGG - Intergenic
1139551411 16:67675113-67675135 GCCACAGGGCAGAGGGACCAGGG - Exonic
1139616042 16:68092903-68092925 GCCACAGGGCAGAGAGAAGGGGG - Intronic
1139855796 16:69978907-69978929 TTCACAGGGCAGAAACAGCTGGG + Intergenic
1140366935 16:74389168-74389190 TTCACAGGGCAGAAAGAGCTGGG - Intronic
1140786679 16:78348962-78348984 GCCACATTGCAGATAGAGGCCGG + Intronic
1140871348 16:79109441-79109463 GGCATAGGGAAGAGAGAGCCGGG + Intronic
1141282308 16:82639801-82639823 GCCACAGAGCAGCGAGAGCATGG + Intronic
1142027528 16:87822570-87822592 GCCAGGGGCCAGAAGGAGCCTGG - Intergenic
1142753050 17:1999830-1999852 GCCGGAGGGCAGGAAAAGCCGGG - Intronic
1142967468 17:3590494-3590516 GGAACTGGGCAGAAAGTGCCTGG + Intronic
1144033633 17:11343691-11343713 GCTGCAGGGCAGAAAGCACCAGG + Intronic
1144330859 17:14222880-14222902 TCCAGATGGCAGGAAGAGCCTGG - Intergenic
1144486535 17:15670227-15670249 GCCACAGGGCAGAAGCAACAAGG + Intronic
1144769538 17:17752107-17752129 CCCACAGGGCTGCAAGACCCTGG - Intronic
1144784814 17:17825562-17825584 GCCCCAGGGGAGAGTGAGCCAGG - Intronic
1144914484 17:18712063-18712085 GCCACAGGGCAGAAGCAACAAGG - Intronic
1145734197 17:27215053-27215075 GCTACAAGATAGAAAGAGCCTGG + Intergenic
1147134290 17:38426194-38426216 GCTACAGGGCAGAAAGAGACAGG + Intergenic
1147161417 17:38571503-38571525 GGCAGAGGGCAGGAAGGGCCAGG + Intronic
1147423232 17:40332703-40332725 GCCCCAGGGCATAAAGGGCGGGG - Intronic
1147501780 17:40972497-40972519 GGAACAGGGCAGGAAGAGCTTGG - Intergenic
1148213357 17:45821162-45821184 GCCAATGGGCAGAAAGAGGCAGG + Intronic
1148857767 17:50588331-50588353 GTCACAGGGCAGGAAGAGCTGGG - Intronic
1149031347 17:52086343-52086365 GCCACAGGACAGAAGAAACCTGG - Intronic
1149050462 17:52298300-52298322 GCCACAAAACAGAAAGAGCTGGG - Intergenic
1149187407 17:54015882-54015904 GCCAAAGGCCAGAGAGAACCTGG + Intergenic
1150089062 17:62304908-62304930 GTCCCAGGGCAGAGAGACCCAGG + Intergenic
1150229630 17:63543130-63543152 GCACCAGGGAAGAAATAGCCCGG - Intronic
1150440070 17:65183830-65183852 GGCACAGGGCAGAAGGGGTCAGG - Intronic
1150463513 17:65372349-65372371 GCCACACGGCAGTCAGACCCAGG - Intergenic
1151125574 17:71841219-71841241 GCCACAGGACAGAAGGAAGCTGG - Intergenic
1151767103 17:76138290-76138312 GCCACAGGGCACTGGGAGCCCGG + Intronic
1152190093 17:78883078-78883100 GCTGCAGGGCGGGAAGAGCCTGG - Intronic
1152320726 17:79607772-79607794 GCAACAGGGCTGAACCAGCCAGG + Intergenic
1152566037 17:81100854-81100876 GGCACAGGTCACCAAGAGCCTGG - Intronic
1152604453 17:81282125-81282147 GCCACAGGAAAGAATGGGCCAGG + Intronic
1152737684 17:82005335-82005357 ACCGCAGGGCAGCAAGAGCCGGG - Intronic
1152881563 17:82819265-82819287 GACTAAGGGCAGAAAGACCCAGG - Intronic
1152907703 17:82977956-82977978 GCCCCAGGGCAGGAGGAGCTTGG - Intronic
1152923456 17:83077238-83077260 GCCCCAGGGTGGAAAGGGCCAGG + Intergenic
1153823234 18:8850573-8850595 GCTACAAGGTAGAAGGAGCCTGG - Intergenic
1154117269 18:11622116-11622138 TTCACAGGGCAGAAACAGCTGGG + Intergenic
1155194264 18:23458448-23458470 GCAACAGGAAAGAAAGAACCAGG + Intronic
1155429269 18:25738392-25738414 GCTACAGAGCAGCCAGAGCCCGG + Intergenic
1155618266 18:27746246-27746268 GCCAAAGGCCAGAAAGCCCCTGG - Intergenic
1156520383 18:37717295-37717317 GCCTCAGGGCACCAAGAACCAGG - Intergenic
1157605194 18:48922062-48922084 GTCAAAGGGCTGTAAGAGCCTGG - Intronic
1157721011 18:49924494-49924516 GCCAGAAAGCTGAAAGAGCCTGG - Intronic
1159616159 18:70582339-70582361 CCCACAGGGCAGAAATCACCTGG + Intergenic
1160832186 19:1109217-1109239 GACACAGGGCCGCATGAGCCTGG + Intronic
1161016321 19:1985546-1985568 GTCACAGGGCAGAAACACGCGGG + Exonic
1161572355 19:5037511-5037533 GCCACAGTGCAAAAGGCGCCTGG - Intronic
1161721848 19:5907188-5907210 CTCACAGGGCAGAGAGAGCCAGG + Intronic
1162799863 19:13104448-13104470 GCCTCAGGGCAGGAAGCACCTGG + Intergenic
1164013768 19:21234050-21234072 TTCACAGGGTAGAAAGAGCAGGG - Intronic
1164712430 19:30366999-30367021 GCCCCAGGGCAGTGACAGCCTGG + Intronic
1165873677 19:38991028-38991050 ACCACGGGGCAGCCAGAGCCTGG + Intronic
1165909513 19:39216473-39216495 GCAACAAGACAGAAGGAGCCTGG - Intergenic
1166711782 19:44942301-44942323 GGCACAGGGCAGGCAGGGCCTGG - Exonic
1166750356 19:45161591-45161613 GCCCCAGGGCACACAGAGGCAGG + Intronic
1167783135 19:51613516-51613538 GGCACAGGGCAGACAGGGCTGGG + Intronic
1167930172 19:52857356-52857378 GCCCTATGGCAGAAAGACCCGGG + Intronic
1168353610 19:55689527-55689549 ACCACAAGTCAGACAGAGCCTGG + Intronic
1168357778 19:55713073-55713095 GCCACAGAGAAAAGAGAGCCAGG - Intronic
925134913 2:1520114-1520136 GCTCCAGGGCAGAAACATCCTGG + Intronic
925309327 2:2871179-2871201 GTCGCAGGGCAGAGAGAGCATGG - Intergenic
925384601 2:3453371-3453393 GCCGAGGGGCAGAAAGGGCCGGG - Intronic
925464595 2:4095757-4095779 GGCAAAGGGCATAACGAGCCAGG + Intergenic
927421030 2:22931080-22931102 GTCACAGGGCAGAGAGAGGGAGG - Intergenic
927494405 2:23542877-23542899 GCCCAAGGTCACAAAGAGCCTGG - Intronic
928465147 2:31516459-31516481 GCCACAGGGCAGAGAGGGGCTGG - Intergenic
929027249 2:37616431-37616453 TCTACTGGGCAGAAGGAGCCAGG + Intergenic
929682102 2:44002137-44002159 CCCACAGGGCAGATAGTGTCTGG + Intergenic
929948522 2:46388753-46388775 ACCTCAGGGAAGGAAGAGCCGGG - Intergenic
930027143 2:47035905-47035927 GACACAGGGCAGAGAGACCAAGG + Intronic
930692988 2:54383475-54383497 GCCAAAGGACAGAAGGAGCCAGG + Intronic
931234641 2:60402992-60403014 GCCTCATGACAGAAGGAGCCTGG - Intergenic
932125741 2:69144236-69144258 GCCACTGGGCAGAGGGAGGCTGG - Intronic
932357484 2:71078334-71078356 GACCCAGGGCAGAGAGATCCAGG + Exonic
933789206 2:85870398-85870420 GCCACAGGACAGAAGAAGACAGG - Intronic
933862917 2:86487890-86487912 GCCACAGTGCAAAACGAGCAAGG - Intronic
933969466 2:87458508-87458530 CCCACAGGGCAGAGGGACCCGGG - Intergenic
934117994 2:88813863-88813885 GCCACAGGGTGGAGAGAGCAGGG - Intergenic
934565764 2:95339902-95339924 GCCACAGGGTAGAAAGGGCCTGG - Intronic
935903885 2:107822518-107822540 CCCGAAGTGCAGAAAGAGCCTGG - Intergenic
936008235 2:108908618-108908640 GCCACAGGGCGGCATGAACCTGG - Intronic
936324320 2:111491986-111492008 CCCACAGGGCAGAGGGACCCGGG + Intergenic
936637352 2:114273812-114273834 GCCACAGGGCACAGAGAGTGAGG + Intergenic
936936288 2:117841299-117841321 ACCACTGGGAAGAAAGAGGCTGG + Intergenic
937287669 2:120763410-120763432 GCCACTAGGCAGAGAAAGCCTGG + Intronic
938186246 2:129234550-129234572 ATCACAAGGCAGAGAGAGCCAGG - Intergenic
938300818 2:130210670-130210692 GCCACAAGACAGAAGGAACCTGG + Intergenic
938455905 2:131463804-131463826 GCCACAAGACAGAAGGAACCTGG - Intergenic
940036264 2:149315026-149315048 GCAACAGAGTAGAAAAAGCCTGG - Intergenic
940775008 2:157876085-157876107 GCCACCCGGGGGAAAGAGCCGGG + Intergenic
942383086 2:175413131-175413153 GCCACAATACAGAAGGAGCCTGG - Intergenic
942543013 2:177034377-177034399 GCAACAGGATAGAAAGAGGCTGG - Intergenic
943179476 2:184524767-184524789 GCCCCTCGGCAGAAACAGCCTGG - Intergenic
947716131 2:232339721-232339743 GCCACATGGACGAGAGAGCCGGG + Intronic
947741572 2:232487274-232487296 GCCACCGAGCAGAAGGAGCCAGG - Intronic
948273560 2:236691823-236691845 GCCACAGGGGAGAAAGATAAGGG - Intergenic
948318816 2:237052705-237052727 GCCAGAGGCCAGGAAGAGCCAGG - Intergenic
948458248 2:238117199-238117221 GCCACAGGGCAGCCAGTGCTAGG + Intronic
1168879813 20:1196787-1196809 GCAACAATGCAGAAGGAGCCCGG - Intergenic
1169278715 20:4249686-4249708 GCCAGAGAGCAGCAAGCGCCTGG + Intergenic
1169391899 20:5197444-5197466 GTCACAGAGGAGACAGAGCCAGG - Exonic
1169659605 20:7963748-7963770 GTGACAGGGCAGAAAGAGACAGG + Intergenic
1170040060 20:12030573-12030595 GCAACAGAGCAGAAAGAGCTAGG + Intergenic
1170145776 20:13172991-13173013 GCCACAGGCTGGAAATAGCCTGG - Intergenic
1173919178 20:46731183-46731205 GCAACAAGACAGAAGGAGCCTGG - Intronic
1174142009 20:48421698-48421720 GCCACAGGAGAGAAGGATCCTGG + Intergenic
1174178229 20:48658234-48658256 GGCCCAGGGCAGAAGGAACCCGG + Intronic
1174197811 20:48785932-48785954 GCCACAGGGCAGAAAGAGCCGGG + Intronic
1174623445 20:51894828-51894850 GCCACAGGGCAGGAAGGGAGTGG - Intergenic
1174677175 20:52369738-52369760 GCAACAAGGCAGAGGGAGCCTGG + Intergenic
1175840137 20:62021402-62021424 GCCACAGGGCAGTAAGCACCTGG + Intronic
1175922895 20:62458389-62458411 GCCACGGGGCAGCCAGGGCCGGG + Intergenic
1177745778 21:25211492-25211514 GCCAAAGTGGAGAAAGAGCTGGG - Intergenic
1178984686 21:37292500-37292522 GCAACAAGGTGGAAAGAGCCTGG + Intergenic
1179959409 21:44759638-44759660 GCCACAACCCAGAAAGAGCCTGG + Intergenic
1179993498 21:44960685-44960707 GCCACAGGCCTGAAAGGGTCTGG - Intronic
1180489463 22:15829349-15829371 TCTACAGTCCAGAAAGAGCCTGG - Intergenic
1180564933 22:16655220-16655242 GCCACAGGGCTAAAGGAGGCCGG - Intergenic
1180856112 22:19046717-19046739 GCCACAGGGCAGGCAGAGCAGGG + Intronic
1180974365 22:19839150-19839172 GCCAAAGGGCAGCAAAAGGCAGG + Intronic
1180997724 22:19973753-19973775 GCCACAGTGCGCAAAGAGCGCGG - Exonic
1181026693 22:20131346-20131368 GCCACTGGGCTGGAGGAGCCCGG - Intronic
1181397991 22:22634883-22634905 GCCACAGTGCAGAGGGAGGCGGG - Intergenic
1181500736 22:23314253-23314275 GCCACAGTGCAGAGAGAGGAGGG - Intronic
1181527695 22:23499502-23499524 GGCACAGAGAAGAAAGGGCCAGG + Intergenic
1181651414 22:24261175-24261197 GCCACAGTGCAGAGGGAGGCGGG + Intergenic
1181997543 22:26894502-26894524 TACACAGGGCAGAAGCAGCCAGG - Intergenic
1182519100 22:30875325-30875347 GCCACAAGGCAGAGGGAGGCTGG - Intronic
1182833830 22:33325483-33325505 GCCACAAGACAAAAGGAGCCTGG + Intronic
1183291759 22:37006711-37006733 GCCAGAGGGCAGAGAGTGGCAGG + Intronic
1183378148 22:37476997-37477019 GCCAAGGGGCAGAGTGAGCCTGG + Intronic
1183649053 22:39144034-39144056 GTTAAAAGGCAGAAAGAGCCTGG + Intronic
1184376627 22:44117475-44117497 GCCACCTCGCAGAGAGAGCCCGG + Intronic
1184426497 22:44412006-44412028 GCTTCAGTGCAGAAAGAGCCTGG + Intergenic
1184446304 22:44549178-44549200 GCCTCAAGGCAGTGAGAGCCCGG + Intergenic
1184525729 22:45021161-45021183 AGCACAGGGCAGAAAGTGCAGGG - Intergenic
1184782000 22:46654264-46654286 GCCCCAAGGCAGGAGGAGCCTGG - Intronic
1184805800 22:46794160-46794182 GCCACGGGGGAGCAAGCGCCTGG + Intronic
1185236514 22:49716662-49716684 GGCGCTGGGGAGAAAGAGCCGGG - Intergenic
1185376349 22:50484240-50484262 TCCACAGGGCAGGACCAGCCTGG - Exonic
949616178 3:5756149-5756171 GCTACAGGGCAGAGAAGGCCAGG + Intergenic
949935561 3:9113057-9113079 GCCAGAGGGCAGACAGGGACTGG + Intronic
950200981 3:11043838-11043860 GACACAGGGGAGAAAGGGCAGGG + Intergenic
950441133 3:13011216-13011238 GACACAGGGCTGAAAGACCCAGG + Intronic
950718108 3:14863929-14863951 GGCACTGGGCAGCAAGAGCCTGG + Intronic
950864662 3:16179526-16179548 GTCACAGGGCAGGAGGAGCTGGG + Intronic
951552319 3:23886388-23886410 GCCAAGAGGCAGAAAGAGCTCGG - Intronic
952407772 3:33019910-33019932 GCCCCAGATCTGAAAGAGCCAGG + Intronic
953686144 3:45079794-45079816 GTCACAGAGCAGCAAGAGGCAGG - Intergenic
953802018 3:46031605-46031627 GCTCCTGGGCAGAAAGGGCCAGG + Intergenic
954286047 3:49620062-49620084 GCCACAGAGAACAAAGAGGCAGG + Intronic
954304257 3:49717218-49717240 GCCCCAGGCCAGAGAGAGCAGGG + Exonic
955371485 3:58355817-58355839 TCCAAATTGCAGAAAGAGCCTGG + Intronic
955977469 3:64492175-64492197 GCCACAATGTAGACAGAGCCTGG - Intergenic
956127245 3:66022274-66022296 GCCATAGGGAAGAAAGGCCCTGG - Intronic
956255864 3:67282735-67282757 GCCAAAGGGCGGAGAGACCCTGG + Intergenic
956952009 3:74293768-74293790 GCAAGAGGGCAGAATAAGCCAGG - Intronic
957232312 3:77536216-77536238 GCCACAGGCCACAAAGAAGCAGG + Intronic
957417867 3:79929491-79929513 GCCCCTGGGCAGAAAAAGGCAGG + Intergenic
959392415 3:105792655-105792677 GCCAAAGGTCAGAAAGAGGGCGG + Intronic
960880694 3:122341883-122341905 GCCACAGGGAACAAGGAGGCTGG - Exonic
962197920 3:133379677-133379699 GCCACAGGTAAGAAAGGCCCAGG + Intronic
963055960 3:141186486-141186508 GTTAGAAGGCAGAAAGAGCCTGG + Intergenic
963085211 3:141429821-141429843 GCCACAGGGCCAGAAGAGACTGG + Intronic
963454149 3:145522400-145522422 GCCACAGGGCAGGCAGCTCCAGG + Intergenic
964193876 3:154039066-154039088 GGAACAGGGCAAAAAGAGCATGG - Intergenic
964291978 3:155191455-155191477 CCCATATGGCAGAAAGGGCCAGG - Intergenic
965150168 3:164962996-164963018 GCACCAGGGCAGAAAGGCCCTGG + Intergenic
966898956 3:184466647-184466669 TTCACAGGGCAGAAGCAGCCAGG - Intronic
967039068 3:185672784-185672806 GATACAGGGTAGGAAGAGCCTGG - Intronic
967220272 3:187242674-187242696 GCCACAAGGCAGGGAGAGGCGGG + Intronic
967932307 3:194699018-194699040 GCCACAATGTAGAAGGAGCCTGG - Intergenic
968222038 3:196946883-196946905 GCAACAGGGCAGGAACAGACAGG + Exonic
968724917 4:2242302-2242324 GGCGCAGGGCAGAGAGAGGCGGG + Intergenic
968981196 4:3850556-3850578 GCCAGAGGGCAGCAGGAGCTTGG - Intergenic
969141483 4:5077977-5077999 GCAGCAGGACAGAAAGAACCAGG - Intronic
969843002 4:9897315-9897337 GGCACAGAGAAGACAGAGCCAGG + Intronic
969914046 4:10472627-10472649 GCAACAAGGCAGAAGGAGCCTGG - Intergenic
970674968 4:18438535-18438557 GCAACAAGACAGAAGGAGCCTGG - Intergenic
970857158 4:20662153-20662175 GCCACAGGGTAGAAGGAGCCCGG - Intergenic
971343488 4:25791604-25791626 GCCCCAGAGAAGAAGGAGCCAGG + Intronic
971876732 4:32318206-32318228 GCAGCAGGGCAGACAGATCCAGG + Intergenic
973589801 4:52429557-52429579 GCAACAAGGGAGAAAGAGCCTGG - Intergenic
974497596 4:62652407-62652429 GTCACATGGTAGAAAAAGCCTGG + Intergenic
976116533 4:81734048-81734070 CTCAGAGGGCAGAAAGAGCATGG + Intronic
976312946 4:83630499-83630521 GCCACAAGACAGAAGGAGCCAGG + Intergenic
977318801 4:95484545-95484567 GCAGCAGGGAAGAAAGAGACCGG - Intronic
977454696 4:97243702-97243724 AGCACAGGGCAAAATGAGCCTGG + Intronic
979312632 4:119221685-119221707 GCAACAGGGCAGAGAGAGAAGGG + Intronic
980505674 4:133717292-133717314 GACACTGGGCATAAAAAGCCTGG + Intergenic
980703128 4:136457755-136457777 GCTTCAGGGCAGAAAGCGGCAGG + Intergenic
980741197 4:136951568-136951590 CCCACAGGGAATAAAGATCCTGG - Intergenic
981786375 4:148483781-148483803 GCCACAAGGTGGAAGGAGCCTGG - Intergenic
981854768 4:149275296-149275318 GTCACAGTGCAGAAAGACACTGG + Intergenic
982086548 4:151841810-151841832 GCCTCAGAGCATAAAGAGCCTGG + Intergenic
982198826 4:152939853-152939875 GCCCCTGGGCAGACAGAGACAGG - Intronic
984523138 4:180824441-180824463 GACACAGGATGGAAAGAGCCTGG - Intergenic
984567306 4:181346486-181346508 ACCACGGGGCAGAAAGGGGCAGG + Intergenic
984633227 4:182082250-182082272 CTCACATGGCAGAAAGAGCAAGG + Intergenic
985900237 5:2783044-2783066 TCCACAGGGCAGAAGCAGCAAGG + Intergenic
985948484 5:3204723-3204745 CCACCAGGGCAGAAAGAGGCTGG + Intergenic
985958427 5:3281727-3281749 GTCACAGGGCAGGAACACCCAGG + Intergenic
987309760 5:16670906-16670928 GTCGCAGGGCAGCAAGAACCTGG + Exonic
988114328 5:26865456-26865478 TCCTCAGGGCACAAAGAGCATGG + Intergenic
989172560 5:38487158-38487180 GCCACAGGGGAGAGAGAGCAGGG - Intronic
989659551 5:43785507-43785529 GCCACAGGGCTGGAAGGGCTGGG - Intergenic
989753781 5:44926216-44926238 CTCACATGGCAGAAAGGGCCAGG - Intergenic
989805619 5:45600241-45600263 GCAACAAGGCAGAAAGAGACAGG + Intronic
990197705 5:53337290-53337312 GCCATAGGGTAGAAAAAGCTAGG + Intergenic
991460179 5:66849656-66849678 CCCACAGGGTGGAAAGAGACAGG - Intronic
992838955 5:80668409-80668431 GCCCCATGGCACAAACAGCCTGG - Intronic
992846057 5:80749266-80749288 GCCAAAGGGCAGAGAGTCCCTGG + Intronic
993050988 5:82925739-82925761 GCCACATGGCAAAAAGAACAGGG - Intergenic
993394691 5:87370548-87370570 GCCACTGGGTAGAATGAGGCAGG + Intronic
993633107 5:90311565-90311587 GCCACAGGGACGAGAGAGGCAGG + Intergenic
994525789 5:100903371-100903393 GGCACAGAGCAGGCAGAGCCGGG - Intergenic
996038427 5:118783970-118783992 ACCAGAAGACAGAAAGAGCCTGG + Intergenic
996281789 5:121739076-121739098 GGCATAAGGCAGAAAGAGACTGG + Intergenic
996627180 5:125584417-125584439 GCCAGAGGAGAAAAAGAGCCAGG + Intergenic
997348189 5:133209303-133209325 GCAAGAGGGCAGAAAGACCAGGG - Intronic
997640844 5:135448012-135448034 GCCACAAGGCAGGGAGAGCAGGG - Exonic
999754467 5:154653929-154653951 ACCACACAGCAGACAGAGCCAGG + Intergenic
1002056149 5:176598888-176598910 TCCACAGGAAAGACAGAGCCGGG - Exonic
1002640678 5:180629221-180629243 CCCACAGGGCACAAGGACCCTGG + Intronic
1002974865 6:2064637-2064659 GCAACAGGGCTGCAAGAGCCTGG - Intronic
1003611031 6:7615154-7615176 GCCTGAGGGCAAAAAGAGGCAGG - Intergenic
1004148117 6:13089169-13089191 GGCCCAGGGCAGGAAGAGACGGG - Intronic
1004397312 6:15256722-15256744 GCCAACAGGGAGAAAGAGCCTGG - Intronic
1004657412 6:17677137-17677159 GCCACAGGGGAGACAGAGCTTGG + Intronic
1004794317 6:19064226-19064248 GCAACAAGGTAGAAGGAGCCTGG + Intergenic
1006194483 6:32230071-32230093 GCCTCAGGGTAGAAAGAACATGG - Intergenic
1006426023 6:33963485-33963507 GCAACAAGACAGAAAGAGCCTGG - Intergenic
1006935590 6:37715452-37715474 GCCAAAGGGAAGAAAGAGAAGGG - Intergenic
1007372822 6:41437959-41437981 GCCAGAGGGCAGAAACACACAGG - Intergenic
1007730562 6:43942903-43942925 GACACAGGTGAGAAAGAGCTGGG + Intergenic
1007827314 6:44610269-44610291 GCATCAGGGGAGAAGGAGCCTGG + Intergenic
1007944728 6:45815885-45815907 GCCACAGGGCAGCAGGCTCCTGG - Intergenic
1012233447 6:96786509-96786531 GTCACAGGGCAGAAAGAGAAGGG + Intergenic
1012252229 6:96991960-96991982 GCCTGAGGGCAGCAAGAGCGAGG + Intronic
1012828009 6:104169985-104170007 GCCAGAGGGTAGAAAGAGAGAGG + Intergenic
1012979010 6:105810609-105810631 GCCACAGAGCAGAAGGAGGTGGG + Intergenic
1013859988 6:114624165-114624187 GCCACAAGATGGAAAGAGCCTGG - Intergenic
1014835839 6:126159484-126159506 GCCACAAGACAGAAAGAACTTGG + Intergenic
1014969025 6:127791682-127791704 ACCACTTGGCACAAAGAGCCAGG - Intronic
1016030014 6:139327281-139327303 GCCAGAGGCAAGAAAGAGGCTGG - Intergenic
1016163188 6:140907439-140907461 GCCGCAGGGCAGACAGTTCCAGG + Intergenic
1016532162 6:145070979-145071001 GCTACAGGCCTTAAAGAGCCTGG - Intergenic
1016918848 6:149271409-149271431 GCCACAGGCTAGAAAGAACCTGG - Intronic
1017208887 6:151833477-151833499 CCCACACTGCAGCAAGAGCCAGG - Intronic
1017819148 6:158037259-158037281 GCCAGAGGCCACCAAGAGCCGGG - Intronic
1018788815 6:167130865-167130887 GCCACAGGGCAGGAAGTTCCCGG - Intronic
1019137285 6:169918213-169918235 ACCACAGGGCTCAGAGAGCCTGG - Intergenic
1019214991 6:170437815-170437837 GCCCCAGTGCAGACACAGCCAGG + Intergenic
1019308777 7:348809-348831 GCCAGAGGGAAGAAAGGCCCAGG + Intergenic
1020274866 7:6617712-6617734 GCCACAGGGGAGAAGAAGCCAGG - Intronic
1021658022 7:22891040-22891062 GCCACAGGGCAGACACAGCCAGG + Intergenic
1022955336 7:35375143-35375165 GCCCCAGGGCAGATACCGCCGGG + Intergenic
1023089918 7:36608110-36608132 GCAGCAGGACAGAAAGAGCGTGG - Intronic
1023228265 7:37995641-37995663 ACCACAAGACAGAAGGAGCCTGG - Intronic
1024250869 7:47504807-47504829 ACCACAGGGGAGAAAGCCCCTGG - Intronic
1024511386 7:50207446-50207468 GCCCCTGGGCAGAAACACCCTGG + Intergenic
1025761003 7:64391547-64391569 TTCACAGGGCAGAAAAAGCTGGG - Intergenic
1026297947 7:69072228-69072250 ACCACAAGACAGAAAGAGCCTGG - Intergenic
1027123135 7:75536623-75536645 TCCACAGGGCAGCGAGAGCCTGG + Exonic
1027775294 7:82457698-82457720 GCCAGAAGGAGGAAAGAGCCTGG - Intergenic
1028378920 7:90176578-90176600 GAGGCAGGGCAGAAAGAGGCAGG - Intronic
1028556144 7:92127237-92127259 CCCACAGGGCAGCAGGACCCAGG - Intronic
1029170727 7:98627557-98627579 ACCACAGGACAGCAAGGGCCAGG - Intronic
1029404705 7:100367512-100367534 GCCGCAAGGCAGAAGGAGGCTGG + Exonic
1030776632 7:113541688-113541710 GCCACATGGAAAAAAGAGTCTGG - Intergenic
1032074343 7:128829514-128829536 GCCACAGGGCAGATCCTGCCAGG - Intergenic
1032658350 7:133955633-133955655 GCTCCAGGGCAGACAGGGCCAGG - Intronic
1033001044 7:137505228-137505250 GCCACAGGACAGAAGGAAGCTGG + Intronic
1033142653 7:138841184-138841206 GCCACAAGCAAGAAAGAGCCAGG - Intronic
1033255442 7:139797343-139797365 GCCACAGGGGAGAAGTAACCCGG - Intronic
1033329172 7:140403991-140404013 GCCTCAGGGTACAAAGCGCCAGG - Intronic
1034427345 7:151021069-151021091 GAAAGAGGGCAGAAAGAGCGAGG - Intronic
1035371799 7:158384329-158384351 AACACAGGGCAGAAGCAGCCGGG + Intronic
1035652149 8:1275304-1275326 CCCACAGAGCAGATAGAACCAGG + Intergenic
1035754832 8:2023333-2023355 GCCACTGCTCAGAAAGAGGCTGG + Intergenic
1036626861 8:10479482-10479504 GCCACAGTCCAGACAAAGCCGGG + Intergenic
1037319643 8:17630925-17630947 GCAGCATGGCTGAAAGAGCCTGG + Intronic
1037736107 8:21567581-21567603 GCCACAAGGCAGAAGGAGTCTGG - Intergenic
1037932633 8:22891345-22891367 GACAGAGGGCAGGAGGAGCCTGG - Intronic
1038358549 8:26854561-26854583 GTCTCAGGGCACAGAGAGCCTGG - Intronic
1039567120 8:38559661-38559683 ACCACAGGCCGGAGAGAGCCTGG - Intergenic
1039909202 8:41810766-41810788 ACCACAGGGCCGGGAGAGCCAGG + Intronic
1040365326 8:46709381-46709403 GCCACATGGCATCAAAAGCCTGG - Intergenic
1041956034 8:63558872-63558894 GCTACTGGGCAGAAAGGGGCAGG + Intergenic
1042439681 8:68811002-68811024 GCTCCAGGGCAGAAAGTGCTGGG - Intronic
1042458952 8:69039589-69039611 GCCACTGTACAGCAAGAGCCTGG - Intergenic
1042830322 8:73019686-73019708 TTCAAAGGGCAGGAAGAGCCAGG - Intronic
1043910994 8:85863966-85863988 GCCAGAGGGCAAAAAGACCTGGG - Intergenic
1043962124 8:86429056-86429078 GCAAAAGGGCAGAAAGAACCCGG - Intronic
1046747226 8:117889170-117889192 GCAACAAAGCAGAAGGAGCCTGG + Intronic
1047215817 8:122875265-122875287 CCCACAGGCCACACAGAGCCAGG - Intronic
1047229133 8:122980963-122980985 AGAACAGGGCAGAAAGAGCATGG + Intergenic
1047246709 8:123152424-123152446 GGCAGAGGGCAGAAGGAGCTGGG - Intergenic
1048859322 8:138712206-138712228 GCCACACAGCAGATAGAACCAGG + Intronic
1048949015 8:139477718-139477740 GCCTCAGGGCAGGAAGAGGATGG - Intergenic
1049269797 8:141688676-141688698 CCAACAGGGCAAAAGGAGCCTGG - Intergenic
1049297202 8:141848468-141848490 GCCACAACAGAGAAAGAGCCTGG - Intergenic
1049504706 8:142989917-142989939 GACACAGTGCACCAAGAGCCTGG + Intergenic
1049511006 8:143026680-143026702 GCCCCCGTGCAGACAGAGCCTGG + Intergenic
1049840352 8:144767057-144767079 TCCACAGGGAGGAAAGAGGCTGG + Intergenic
1051664331 9:19454468-19454490 GCCCCAAGGGATAAAGAGCCAGG - Intergenic
1052069708 9:24067251-24067273 GTGCAAGGGCAGAAAGAGCCAGG + Intergenic
1053199570 9:36143299-36143321 GCAACAGCACAGAAAGAGCCAGG - Intronic
1054798607 9:69325331-69325353 GCCACGGGGCAGCAGGAGCCCGG - Intronic
1055959167 9:81803705-81803727 ACCACATGGCAGAAGGGGCCAGG + Intergenic
1056065054 9:82925116-82925138 GCCACAGGGCAAAAAGAAAATGG - Intergenic
1056802417 9:89701717-89701739 GCCACAGGGCATCAGCAGCCAGG - Intergenic
1057026780 9:91740133-91740155 CCCACAGGACAGAGAGAGCAAGG + Intronic
1058160100 9:101560867-101560889 GGCACAGGGGAGAAAGAGCTGGG + Exonic
1059257662 9:112945730-112945752 GGCGCAGTTCAGAAAGAGCCAGG - Intergenic
1059333094 9:113548784-113548806 GCCACTGTGCTGAAACAGCCAGG - Intronic
1059494365 9:114697294-114697316 GCCTTGGGGCTGAAAGAGCCCGG + Intergenic
1060024590 9:120160547-120160569 GCCACAAGACAGAAGGAGCCTGG - Intergenic
1060773294 9:126348241-126348263 GCCACAGGGAACAAAGGCCCAGG - Intronic
1060811056 9:126611746-126611768 AGCAGAGGGCAGAAAGTGCCTGG + Intergenic
1061237000 9:129349129-129349151 CCTGCAGGGAAGAAAGAGCCTGG + Intergenic
1061290877 9:129649705-129649727 TCCACTGGGCAGAATGAGCAAGG - Intergenic
1061429896 9:130524196-130524218 GCCTCAGGGGAGAAGGAGGCAGG + Intergenic
1061466696 9:130786105-130786127 TCCACAGGGCAGAAAGGAGCTGG + Intronic
1061726705 9:132586018-132586040 CCCACAGGGCAGGGAGAGCCTGG + Intronic
1061828070 9:133274364-133274386 GCCAAAGGCCAGGGAGAGCCGGG - Intronic
1062057042 9:134474156-134474178 GGCAGAGAGCAGAAAGGGCCGGG + Intergenic
1062171963 9:135139801-135139823 GCCAGTGGGCAGATAGAGCCTGG + Intergenic
1062543924 9:137053488-137053510 GGCACAGGGCAGAAGTGGCCCGG + Intronic
1062589582 9:137267367-137267389 GCCGCAGGGAAGACACAGCCAGG - Intronic
1186416135 X:9384590-9384612 GCCACCGAGTAGAAAGAGCCTGG + Intergenic
1186589569 X:10915733-10915755 GCCACAAGGCAGAAGGATCATGG + Intergenic
1186917014 X:14233836-14233858 ACCAGAGGGCAGCCAGAGCCAGG - Intergenic
1187131270 X:16505414-16505436 ACCACAGGGCACAAAAGGCCAGG + Intergenic
1187477049 X:19620612-19620634 ACCACAGGGGAGAAAGGGCACGG + Intronic
1187505244 X:19874184-19874206 CCCACAGGGCAGGAAGAGCCAGG - Intronic
1187577191 X:20569817-20569839 GCCACAAGACAGAAGGAGTCTGG + Intergenic
1187923940 X:24233435-24233457 GCAACATGGCAAAAAAAGCCGGG - Intergenic
1190157503 X:48005771-48005793 GCAACAGCACAGAAGGAGCCAGG + Intronic
1190173273 X:48128656-48128678 GCAACAGCACAGAAGGAGCCAGG + Intergenic
1195454755 X:105055221-105055243 CTCACATGGCAGAAAGAGCAAGG + Intronic
1196807634 X:119602920-119602942 GCCAGAGGGAAAAAAGAGCAAGG + Intronic
1199453246 X:147997117-147997139 GTCCCAGGGAAGAAAGAGCAGGG + Intronic
1199609891 X:149604289-149604311 GCCTCAGGCCAGAAAGGGCAAGG - Intronic
1200119980 X:153785610-153785632 ACCACAGGGCAGAGAGACGCTGG + Exonic
1200257752 X:154593736-154593758 TCCACAGGGCTGAAAGACACAGG + Intergenic
1201990103 Y:20014646-20014668 TGCACAGAGCAGAAAAAGCCTGG - Intergenic