ID: 1174198726

View in Genome Browser
Species Human (GRCh38)
Location 20:48791994-48792016
Sequence CAGAAGGCACAGATTGGGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 476
Summary {0: 1, 1: 0, 2: 2, 3: 33, 4: 440}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174198718_1174198726 23 Left 1174198718 20:48791948-48791970 CCTGGGGCTGAGAGGTGGCTGCT 0: 1
1: 1
2: 5
3: 39
4: 471
Right 1174198726 20:48791994-48792016 CAGAAGGCACAGATTGGGGTTGG 0: 1
1: 0
2: 2
3: 33
4: 440

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174198726 Original CRISPR CAGAAGGCACAGATTGGGGT TGG Intronic
900186725 1:1336392-1336414 CACACGGCACCGAGTGGGGTGGG - Exonic
901138720 1:7014170-7014192 CAGAAGCCACAGCCTGGGTTTGG + Intronic
901659379 1:10789053-10789075 GAGAAGGCCCAGGTGGGGGTAGG - Intronic
901877126 1:12173266-12173288 CAAAGGCCACAGATTGGGGGTGG + Intronic
902089858 1:13894323-13894345 CAGAAGGGAAAGATTGGCATGGG + Intergenic
902111434 1:14082068-14082090 TAGAAGGAACAGAGTGGGCTGGG - Intergenic
903200369 1:21732203-21732225 CAGAAGGCGGAGATTGTGGTGGG + Intronic
903437249 1:23359847-23359869 CAGCAGGAACTGGTTGGGGTGGG + Exonic
903482788 1:23666577-23666599 CAGGAGGCAGAGGTTGTGGTGGG - Intergenic
903762271 1:25706997-25707019 CAGAAGAGACAGAATGGGGAGGG + Intronic
904012970 1:27400472-27400494 CTGAAGGCAGGCATTGGGGTTGG - Intergenic
904500904 1:30912364-30912386 GAGAAGGCTCTGACTGGGGTGGG - Intergenic
904910638 1:33931709-33931731 CAGACTGGAAAGATTGGGGTGGG + Intronic
905257641 1:36695189-36695211 AAGAAGGAACAGATTAGAGTAGG + Intergenic
906460721 1:46033724-46033746 CAGAAGGGAAGGATTGGGGGAGG + Intronic
906627453 1:47336594-47336616 CAGGAGGCAGAGGTTGGAGTGGG - Intronic
907306250 1:53514651-53514673 CAGAGGGGACAGATGGTGGTGGG + Exonic
907412782 1:54294350-54294372 CAGAAGGAACAGTTTGTGGCAGG - Intronic
907441077 1:54478819-54478841 AAAAAGGCTCAGATTGGGGCTGG - Intergenic
910100414 1:83569434-83569456 GAGAAGGCAAAAAGTGGGGTAGG - Intergenic
910865473 1:91784521-91784543 GGGAAGGCACAGGTTGTGGTAGG + Intronic
911672376 1:100621389-100621411 CAGAAGGCAGAGGTTGCAGTGGG + Intergenic
911943340 1:104074247-104074269 AAGAAGGAACAGATGTGGGTGGG - Intergenic
912332267 1:108830577-108830599 CAGAAGGCACAGCTCGGACTGGG + Exonic
912567372 1:110597940-110597962 CAGCAGGGACAGATGGAGGTAGG - Intronic
912863188 1:113233120-113233142 CAGCAAGTACAGATTGGAGTTGG + Intergenic
915430403 1:155861690-155861712 CAGGAGGCAGAGGTTGTGGTGGG - Intronic
915464748 1:156090388-156090410 CAAAAGGCAGAGAGAGGGGTGGG + Intronic
915490198 1:156246433-156246455 CCGAAGAGCCAGATTGGGGTGGG + Intronic
915554798 1:156655433-156655455 CAGAAGGCCCAAAGTGGAGTTGG + Intronic
918305156 1:183239507-183239529 CAGAGGGCAAAGAATGGGGCCGG + Exonic
918623021 1:186626487-186626509 CAGGAGTCACAGATTTGGGAAGG + Intergenic
919519180 1:198566280-198566302 CAGGAGGCAGAGGTTGTGGTGGG - Intergenic
919871695 1:201826866-201826888 CAGAGGGCCCAGATTGGGGGTGG - Exonic
919902530 1:202054858-202054880 CAGAAGGCAGAGGTTGCAGTGGG + Intergenic
920183087 1:204144527-204144549 CATAAGGGACAGATTGGTGGGGG - Intronic
920363757 1:205437155-205437177 CAGAAGGCAAGGAATGAGGTGGG + Intronic
920896404 1:210054947-210054969 TAGAGGACACAGTTTGGGGTGGG + Intronic
920919394 1:210285833-210285855 TAGGAGGCACAGTCTGGGGTCGG + Intergenic
921055310 1:211538513-211538535 CAGAAGGGGCAGATGGGGGAGGG + Intergenic
921499310 1:215881212-215881234 CAGAAGGCAGAGGTTGCAGTGGG - Intronic
922638365 1:227200355-227200377 CAGGAGGCACAGGTTGCAGTGGG + Intronic
922713592 1:227852787-227852809 CAGAAGGCACAGCTTGGGTAGGG - Intergenic
923387510 1:233479756-233479778 CAGAAGGCAGAGGGTAGGGTGGG + Intergenic
924718852 1:246604740-246604762 CAGAAGGCAGAGGTTGCAGTGGG - Intronic
1062860029 10:803696-803718 CAGAGGGCACAGAGTGAGCTGGG - Intergenic
1062936603 10:1395196-1395218 CAGAAAGAACAGATTAGGCTTGG - Intronic
1063774558 10:9246360-9246382 CAGGAGGCAGAGGTTGGTGTGGG + Intergenic
1064198292 10:13263397-13263419 CAAAAGGGAGAGAATGGGGTGGG - Intergenic
1065366178 10:24939052-24939074 CAGAAGTCACACAGTGAGGTGGG + Intronic
1067280882 10:44871760-44871782 CAGTAGGCACTGACTGGGGAGGG - Intergenic
1068951055 10:62777811-62777833 GAGAAGGAACAGATTGGGAGAGG + Intergenic
1069619535 10:69828273-69828295 CAGGAGGAAGAGATGGGGGTGGG - Intronic
1069832809 10:71291445-71291467 CAGGAGGCACAGAGGGGTGTAGG - Exonic
1071582436 10:86785377-86785399 CAGGAGGCGCAGATTGCGGTGGG - Intronic
1072124367 10:92432322-92432344 CAAAATGCACAGTTTGGGTTTGG - Intergenic
1072829611 10:98644067-98644089 CATGGGCCACAGATTGGGGTAGG - Intronic
1073319469 10:102605795-102605817 CAGAAGCCAGAGGTTGGGCTGGG + Intronic
1073743126 10:106434650-106434672 CAGAAACCAAAGGTTGGGGTAGG - Intergenic
1074037395 10:109754168-109754190 CAGAAGGAAAAGATTAGGGTTGG + Intergenic
1074173976 10:110977323-110977345 CAGAAGGCAGAGACTGCGGTGGG - Intronic
1074510718 10:114109572-114109594 AAGATGGCACTGATAGGGGTGGG - Intergenic
1074979864 10:118610777-118610799 CAGAAGCCACAGAGTGCTGTGGG - Intergenic
1075438554 10:122462026-122462048 CAGCTGGCACAGGTTGGCGTAGG - Exonic
1076082475 10:127595522-127595544 CAGAGGGCACAGTCTGGGGTTGG + Intergenic
1076638501 10:131899058-131899080 CAGAAGGCACAGCTGGGTGGGGG - Intergenic
1078051432 11:7968228-7968250 AAGAGGGGACAGACTGGGGTTGG - Intergenic
1078840441 11:15072494-15072516 CAGAAGGCAGAGCGTGTGGTGGG + Intronic
1079120470 11:17680485-17680507 CTGAAGGCACAGACTGAGATTGG - Intergenic
1080282587 11:30575569-30575591 CAAAAGGCACAGCTTGGGCTGGG - Intronic
1080908500 11:36571686-36571708 CAGGAGGCAGAGATTGCAGTGGG - Intronic
1081531532 11:43963320-43963342 CCCAAGGCACAGAGTTGGGTGGG - Intergenic
1081770223 11:45645778-45645800 GAAAAGGCACAGAGTGGGGAAGG - Intergenic
1081902634 11:46642377-46642399 CAGAAGGCAGAGGTTGCAGTGGG - Intronic
1082244562 11:49906307-49906329 CAGGAGGCAGAGGTTGTGGTGGG - Intergenic
1082565712 11:54675753-54675775 CAGGAGGCAGAGGTTGTGGTGGG + Intergenic
1083097433 11:60266187-60266209 CAGAGTGCAGAGAATGGGGTGGG - Intergenic
1083635487 11:64118416-64118438 CAGAAAGCAAAGTTTGGGGAGGG + Exonic
1083718080 11:64590661-64590683 CAGGAGGCATAGATTTGGGGAGG + Intronic
1083962084 11:66020300-66020322 CAGGAGGTACCGAGTGGGGTGGG - Exonic
1085460013 11:76687920-76687942 CTGAAGGGACAGACTGGGGCAGG + Intergenic
1086303072 11:85450667-85450689 TAAAAGCCCCAGATTGGGGTTGG - Intronic
1086564841 11:88213389-88213411 CAGAAGGAAGAGAGTTGGGTAGG + Intergenic
1087180129 11:95133817-95133839 CTGAAGGTACAGATGAGGGTTGG + Intergenic
1088659948 11:112035560-112035582 CAGGAGGCAGAGGTTGTGGTGGG - Intronic
1089353661 11:117836056-117836078 CAGAAGGCAGAGGTTGCAGTGGG + Intronic
1089404031 11:118182667-118182689 CAGCATGCACAGATTGCGGCTGG - Intergenic
1089577824 11:119459371-119459393 CAGTAGGCAGAGAGAGGGGTTGG + Intergenic
1090981287 11:131724802-131724824 GAGCAGGCACAGCCTGGGGTGGG + Intronic
1091426598 12:395818-395840 CAGAAGGCAGAGGTTGCAGTGGG + Intronic
1092199647 12:6572350-6572372 CAGGAGGCAGAGGTTGTGGTGGG + Intronic
1092808873 12:12253188-12253210 CAGAAGGCAGAGGTTGTGGTGGG + Intronic
1093785328 12:23185809-23185831 CAGTAGGGTCAGATTGTGGTGGG - Intergenic
1094078929 12:26511331-26511353 CAGAGGGCACAAACTGGGCTAGG - Intronic
1094688170 12:32741357-32741379 CAGAAGGCAGAGGTTGAAGTGGG - Intronic
1095245286 12:39912556-39912578 CAGTAGCCACAGATTAGGGATGG + Intronic
1095837890 12:46658250-46658272 GAGTAGCCACAGATTGGGGGTGG - Intergenic
1099481116 12:83167939-83167961 TACAAGCCTCAGATTGGGGTTGG + Intergenic
1101473535 12:105021762-105021784 CAGAAGGCCCATACTGGAGTTGG + Exonic
1104207371 12:126652429-126652451 GAGAAGCAAGAGATTGGGGTAGG + Intergenic
1104644390 12:130486584-130486606 GAGATGGCACAGCTTGGGGAGGG - Intronic
1104779653 12:131411817-131411839 TCAAAGGCACAGAGTGGGGTGGG - Intergenic
1104980603 12:132571690-132571712 CTCATGGCACAGCTTGGGGTGGG - Intronic
1105505505 13:21006061-21006083 CGGAAGGCAGAGGTTGCGGTGGG + Intronic
1105870836 13:24505090-24505112 CGGAAGGCAGAGATTGCAGTGGG - Intronic
1106354817 13:28971105-28971127 CAGAAAGTAGAGATTGGTGTTGG + Intronic
1106632045 13:31484696-31484718 CACAAAGAACAGAGTGGGGTGGG - Intergenic
1108278229 13:48833459-48833481 CTGAAGGCTCAGATTGTTGTTGG + Intergenic
1109003123 13:56833196-56833218 CAGAATGCAAAGATTATGGTTGG - Intergenic
1109873794 13:68371250-68371272 CAGGAGGCAGAGGTTGAGGTGGG - Intergenic
1110282794 13:73714705-73714727 CAGAAGGCAGAGGATGGGGTGGG + Intronic
1110789846 13:79575663-79575685 CAGCATGGACAGATTGGGGCAGG + Intergenic
1110802934 13:79721320-79721342 CAGAAGGGTCAGTGTGGGGTTGG + Intergenic
1111831488 13:93335709-93335731 CAGCAGGTACAAATTGGGCTGGG - Intronic
1113529059 13:111006686-111006708 CAGAAGTCACAGAATTGGGAAGG + Intergenic
1114337676 14:21709001-21709023 AAGAAGGAGCAAATTGGGGTTGG - Intergenic
1114537456 14:23432062-23432084 CAGAAGGCACTGGTTTGGGCAGG + Intronic
1114543609 14:23482505-23482527 CTGAAAGGACAGAGTGGGGTTGG + Intronic
1114562674 14:23604560-23604582 CAGAAGGCAGAGGTTGCAGTGGG - Intergenic
1117130613 14:52682910-52682932 AAAAAGACACAGATTGGGCTGGG + Intronic
1117564154 14:56976696-56976718 CAGCAGGCAGAGGTTGCGGTGGG - Intergenic
1117644275 14:57834953-57834975 CAGAAGGCAGAGATTGCAGTGGG + Intronic
1119445550 14:74660501-74660523 GAGAATGCACTGTTTGGGGTGGG + Intronic
1119788012 14:77327171-77327193 CAGAGGGCCCAGTATGGGGTGGG - Intronic
1119863409 14:77953626-77953648 CAGTAGGCACACATTTGAGTTGG - Intergenic
1120212209 14:81644365-81644387 TAGGAGGCCCAGGTTGGGGTCGG + Intergenic
1120420332 14:84277190-84277212 AAGAAGTCACAGACTGGGCTGGG - Intergenic
1120526699 14:85584898-85584920 CAAAAGGCATAGAGTGGGGGTGG + Intronic
1120974929 14:90240162-90240184 CAGAAGGCAGAGGTTGCAGTGGG - Intergenic
1121187967 14:91993400-91993422 CGGAAGGCAGAGGTTGCGGTGGG + Intronic
1121307272 14:92914822-92914844 CAGAAGGCAGAGGTTGCAGTGGG + Intergenic
1121469965 14:94144984-94145006 GAGATGGCACAGAGTGGGGTTGG + Intergenic
1122145755 14:99688018-99688040 CAGAGGGCACAGAGAGGGGTGGG - Intronic
1124306040 15:28579955-28579977 CAGGAGGCACAGCTTGCAGTGGG - Intergenic
1124614917 15:31234446-31234468 CAGGAGGCAGAGATGTGGGTGGG + Intergenic
1124984367 15:34591831-34591853 CAGGAGGCAGAGGTTGTGGTGGG - Intergenic
1125667451 15:41442810-41442832 CAGAAGGCAGAGGTTGCAGTGGG + Intronic
1126776492 15:52104822-52104844 GAGAAGGCACAGCGTGTGGTGGG + Intergenic
1127277782 15:57462295-57462317 CAAAAGGAACAGACTAGGGTGGG - Intronic
1127948169 15:63776314-63776336 CAGGAGGGACAGGTTTGGGTGGG - Intronic
1127964934 15:63916379-63916401 GAGATGGCACAGATGGGGGTTGG - Intronic
1128033668 15:64503935-64503957 TAGAAGGCACAAATTAGGGCAGG - Intronic
1128157579 15:65401569-65401591 CAGAAGGAACAGGATGGGGACGG + Intronic
1128483038 15:68055425-68055447 CATCAGGTAAAGATTGGGGTGGG - Intronic
1129041808 15:72693956-72693978 CAGAAGGCAGAGGTTGCAGTGGG - Intronic
1129222916 15:74143927-74143949 CAGGAGGCAGAGATTGCAGTGGG - Intergenic
1129224030 15:74155682-74155704 CAAAGGGCACAAATGGGGGTGGG - Intergenic
1130234499 15:82121631-82121653 AAGAAGCCACAGGTTGGGGAGGG + Intergenic
1130558807 15:84943110-84943132 CAGGAGGCACAGGTTGCAGTGGG + Intronic
1132414460 15:101610529-101610551 CAGAGGGGACACCTTGGGGTCGG + Intergenic
1132476613 16:142382-142404 GAGATGGGACAGATGGGGGTGGG + Intergenic
1132598350 16:763201-763223 CAGAGGGGACAGCTTGGGGGAGG - Intronic
1133747620 16:8699216-8699238 CAGAGGGAAGAGATTGGGGAGGG + Intronic
1134128561 16:11632874-11632896 TAGGAGGCTCAGAGTGGGGTGGG - Intronic
1136268109 16:29132529-29132551 CAGAAGGCACAGGCTGGGACAGG - Intergenic
1136924089 16:34355285-34355307 CAGGAGGCAGAGGTTGTGGTGGG + Intergenic
1136980484 16:35056521-35056543 CAGGAGGCAGAGGTTGTGGTGGG - Intergenic
1137293585 16:47069187-47069209 CAGAAGGCAGAGGTTGCAGTGGG - Intergenic
1138303088 16:55948935-55948957 CAGAAGGAGCGGATTTGGGTGGG + Intronic
1138389442 16:56659332-56659354 CAGAAATCAGAGACTGGGGTGGG + Intronic
1139704564 16:68732334-68732356 CATAGGGTTCAGATTGGGGTGGG - Intergenic
1141251381 16:82362084-82362106 CAGAAGGCAGAGATGGGGCCAGG - Intergenic
1141319118 16:82990139-82990161 TAGACGCAACAGATTGGGGTTGG - Intronic
1142071418 16:88092867-88092889 CAGAAGGCACAGGCTGGGGCAGG - Intronic
1142825650 17:2508411-2508433 GAGAAGGACCAGTTTGGGGTGGG - Intronic
1143585658 17:7848985-7849007 CAGGGGGCAGAGATAGGGGTGGG - Exonic
1143625703 17:8109260-8109282 CGGAAGGCAGAAATTGGTGTAGG + Exonic
1144580221 17:16454615-16454637 CAGGAGGCAGAGGTTGAGGTGGG + Intronic
1144743708 17:17598954-17598976 CAGGAGGCAGAGATTGCAGTAGG + Intergenic
1144816349 17:18038372-18038394 CAGATGGCAGAGGTTGTGGTAGG + Intronic
1146023140 17:29296029-29296051 CAGGAGGCAGAGGTTGCGGTGGG - Intergenic
1146616153 17:34358905-34358927 GGGGAGGCATAGATTGGGGTGGG - Intergenic
1147533379 17:41301009-41301031 CAGGAGGCAGAGGTTGCGGTGGG + Intergenic
1148093705 17:45038148-45038170 CAGGAGGCAGAGATTGCAGTGGG - Intronic
1148847759 17:50539161-50539183 CAGAAGGCACAGAAAGAGTTAGG - Intronic
1149992466 17:61390596-61390618 CAGCAGCCACAGAGTGGAGTGGG - Intronic
1150479178 17:65496576-65496598 GAGAAGGCAAAAAGTGGGGTGGG + Intergenic
1151298278 17:73201959-73201981 CTGAAGGAACTGATTGAGGTTGG - Intronic
1151488071 17:74414388-74414410 CAGGAGGCAGAGGTTGCGGTGGG + Intergenic
1151685512 17:75643889-75643911 CAGAGGGCACAGCTTGGGGTGGG - Intronic
1151764498 17:76125165-76125187 CAGAAGGCAGGGATTGGGACAGG + Intergenic
1152862950 17:82706283-82706305 CAGGAGGCAGAGGTTGCGGTGGG - Intergenic
1152863079 17:82707082-82707104 CAGAAGGCAGAGGTTGCAGTGGG + Intergenic
1153618507 18:6954928-6954950 CAGAAGGTGCAGAGAGGGGTGGG + Intronic
1154349726 18:13572890-13572912 CAGAGGGCACAGAGTGGCGCAGG + Intronic
1154425291 18:14267434-14267456 CAGAAGGAACATATAGGGTTGGG + Intergenic
1154432987 18:14322673-14322695 CAGAAGGAACATATAGGGTTGGG + Intergenic
1156102655 18:33616689-33616711 CAGAAAGCCCAGATTAAGGTTGG + Intronic
1156871959 18:41955458-41955480 CTCAAGGCCCAGATTGGGGGCGG + Intronic
1158401160 18:57122581-57122603 GAGAAGGCACAGGATGGGGTTGG - Intergenic
1159990524 18:74901555-74901577 CAGAAGACACAGAGTGGGAGTGG + Intronic
1160414276 18:78697231-78697253 CAGACGGCCAAGGTTGGGGTGGG - Intergenic
1163730128 19:18944188-18944210 AAGAGGGCCCAGACTGGGGTGGG - Intergenic
1164511866 19:28904128-28904150 CAGATGGCACAGGTAGGGGATGG - Intergenic
1166288819 19:41848763-41848785 CAGAGGGCACAGGCTGGAGTTGG - Intronic
1167849171 19:52189066-52189088 CAGAACGCACAGCTTGGGCAAGG + Intergenic
925146195 2:1584828-1584850 CGGAAGGCACAGTCTGGGGTGGG - Intergenic
926252471 2:11163286-11163308 CAGAATACACAGAATGAGGTGGG + Intronic
926914638 2:17879678-17879700 GAGAAGGGACAGAGCGGGGTTGG - Intronic
927242156 2:20928633-20928655 CAGAAGACAAAAATTGAGGTTGG - Intergenic
928964289 2:36961903-36961925 CAGAAGGAACAGCTGGGGGAAGG - Intronic
929214599 2:39398490-39398512 GAGAAGGGACAGATGGGGATGGG + Intronic
929783687 2:44974055-44974077 CAGAAGCCCCAGATTAGGGAAGG + Intergenic
929922147 2:46180242-46180264 CAGAAGGCAGGGATAGGGGAGGG + Intronic
930186238 2:48415072-48415094 TAGAGGACACAGATTGGGATAGG + Intergenic
931640717 2:64378857-64378879 GAGATGGCAGAGAATGGGGTAGG - Intergenic
933527905 2:83467058-83467080 CAGAAGGTCCAGGTTGCGGTGGG + Intergenic
933782604 2:85812613-85812635 CTGAAGGCACTGGTTGGGGGTGG - Intergenic
934124050 2:88869202-88869224 CAGAGGGCAGTGATTGAGGTGGG - Intergenic
934144159 2:89075306-89075328 CAGAAGTCAAGAATTGGGGTTGG + Intergenic
934225087 2:90125246-90125268 CAGAAGTCAAGAATTGGGGTTGG - Intergenic
934561938 2:95317996-95318018 CAGAAGGGACAGCTTTGGGCCGG + Intronic
934604449 2:95683219-95683241 CACAAGCAACAGATTGGGGGTGG + Intergenic
935665736 2:105510432-105510454 CGGGAGGCAGAGATTGCGGTGGG + Intergenic
936537849 2:113325450-113325472 CACAAGCAACAGATTGGGGGTGG + Intergenic
936904414 2:117520472-117520494 CAGAAGGCATAGACTGGAGCTGG - Intergenic
936946475 2:117935517-117935539 CAGATGGAACAGATTGTGGAAGG - Exonic
938220619 2:129563608-129563630 CACAAGCCACAGAGTGGGGAAGG - Intergenic
938394031 2:130928827-130928849 CAGAAAGCAGACTTTGGGGTGGG - Intronic
938855064 2:135301257-135301279 CAGGAGGCAGAGGTTGCGGTGGG - Intronic
939999414 2:148951835-148951857 GAGAAAGGACAGATGGGGGTGGG + Intronic
940264852 2:151826046-151826068 CAGGAGGCACAGGTTGCAGTGGG + Intronic
941857148 2:170242724-170242746 AAGAAGGCACAGATAGCGCTGGG - Intronic
941980761 2:171454356-171454378 CAGGAGGCAGAGATTGCAGTGGG - Intronic
944808570 2:203306379-203306401 TAGAAGGAACAGGATGGGGTCGG - Intergenic
947253502 2:228135198-228135220 CAGGAGGCAGAGGTTGTGGTGGG + Intronic
947442812 2:230138009-230138031 CAGAAGACACAGAGGGAGGTAGG - Intergenic
947811343 2:233005888-233005910 CAGGAGGCAGAGGTTGCGGTGGG - Intronic
947903941 2:233745923-233745945 CAGAAGGGACAGCTGGGGGTTGG + Intronic
947905344 2:233757278-233757300 CAGAAGGGACAGCTGGGGGTTGG + Intronic
948046385 2:234948816-234948838 GAGCAGGGAAAGATTGGGGTAGG - Intergenic
948501632 2:238398315-238398337 CAGCAGGAACAGGTTGGGGTGGG + Intronic
1168837259 20:885457-885479 CTGTAGGCACAGATTGAGGAGGG + Intronic
1169390831 20:5189646-5189668 CAGAAGCCTGACATTGGGGTGGG + Intronic
1170570192 20:17628245-17628267 CAGATGGCAGAGCCTGGGGTTGG - Intronic
1171090938 20:22285352-22285374 CAGAATGCACAGGGAGGGGTTGG - Intergenic
1172237474 20:33387992-33388014 CAGGAGGCAGAGGTTGCGGTGGG + Intronic
1172321176 20:33995963-33995985 CATAAGGCACAGAAAGGGGTGGG - Intronic
1172643384 20:36455221-36455243 CAGAAGGCAAAGATGGTGGGGGG - Intronic
1174048024 20:47747733-47747755 CAGGAGGAACAGATTGGGAGAGG - Intronic
1174198726 20:48791994-48792016 CAGAAGGCACAGATTGGGGTTGG + Intronic
1174274386 20:49393122-49393144 CAGCAGGCAGAGATGGGAGTAGG + Intronic
1174932643 20:54832584-54832606 CACAAAACAGAGATTGGGGTGGG + Intergenic
1175220794 20:57415276-57415298 CATAGGGCACAGCCTGGGGTGGG + Intergenic
1175349348 20:58307879-58307901 CAGAAGGCGCAGTTTCGGCTGGG - Intergenic
1175540603 20:59745373-59745395 CACACGGCACAGCTTGGAGTAGG - Intronic
1175843458 20:62046080-62046102 CAGACGGCAGACATTGGGATTGG + Intronic
1176848145 21:13892256-13892278 CAGAAGGAACATATAGGGTTGGG - Intergenic
1177310765 21:19389357-19389379 CACAAAGCACAGATTGGAATAGG + Intergenic
1177376155 21:20273267-20273289 CAGACTGCAAAGATTGGGGAAGG + Intergenic
1177648584 21:23931861-23931883 CAGGAGGCAGAGATTGCAGTGGG + Intergenic
1177951856 21:27548103-27548125 AAGAAGGCAGAGGTGGGGGTGGG + Intergenic
1179478797 21:41665023-41665045 GAGAAGGAGCAGATTGGGCTGGG - Intergenic
1180790571 22:18573500-18573522 AAGAAGGCAGGGATTGGGTTTGG - Intergenic
1180978098 22:19862177-19862199 CAGAAGGCAGAGGTTGCAGTGGG - Intergenic
1181231167 22:21421815-21421837 AAGAAGGCAGGGATTGGGTTTGG + Intronic
1181247484 22:21513053-21513075 AAGAAGGCAGGGATTGGGTTTGG - Intergenic
1182673615 22:32018888-32018910 TGAAAGTCACAGATTGGGGTGGG - Intergenic
1182725106 22:32439028-32439050 CAGAAAGCACAGATTGGGCTGGG + Intronic
1182898578 22:33879044-33879066 CAGGAGGCAGAGGTTGCGGTAGG - Intronic
1183458643 22:37936381-37936403 CAGGAGGGACAGAGTGGGGCAGG - Intronic
1183631927 22:39038725-39038747 CAGAAGGCAGAGGTTGCAGTGGG - Intergenic
1183895975 22:40969236-40969258 CAGGAGGCGGAGATTGTGGTGGG + Intronic
949635243 3:5975108-5975130 CAGAAGGAAGAGGTTGGGGGAGG - Intergenic
949782726 3:7708392-7708414 CAGAAAGCACAGAGTGCTGTAGG + Intronic
950099278 3:10347197-10347219 CCGTAAGCACAGATTGGGGGTGG - Intronic
950224429 3:11222217-11222239 CAGGAGGCACAGGACGGGGTGGG + Intronic
951447630 3:22801358-22801380 CAGAAGCCACAAATTGGGATAGG + Intergenic
951800542 3:26590814-26590836 CAGAAGGCAGAGATTACTGTGGG - Intergenic
951913647 3:27776990-27777012 CAGAAGCCATAGAGTGGGGAGGG + Intergenic
953739990 3:45529473-45529495 CAGGAGGCAGAGGTTGCGGTGGG + Intronic
954027734 3:47796282-47796304 CAGGAGGCAGAGGTTGTGGTGGG + Intergenic
955513045 3:59700384-59700406 CAGAAGGGACAGAATGGGACAGG + Intergenic
955620298 3:60856240-60856262 CAAAAGGCACAGATCTGGGGGGG + Intronic
958938693 3:100286569-100286591 CAGGAGGCAGAGATTGCAGTGGG - Intronic
961448076 3:126990414-126990436 CAGAAGGCACAGCTGGGGTGGGG + Intronic
961532323 3:127547318-127547340 CAGGAGGGAAGGATTGGGGTTGG + Intergenic
961642063 3:128370942-128370964 CAGAAGGAACAGAGTGTGCTAGG + Intronic
961738286 3:129015783-129015805 CAGGAAGAACAGCTTGGGGTAGG - Intronic
963134261 3:141886296-141886318 CAGAACGAAGAGATTGGGGAAGG - Intronic
963277960 3:143351607-143351629 TAGAAGCCAAAGATTGAGGTGGG + Intronic
965045683 3:163573761-163573783 CAGAAGCCAGAGCTTGGAGTTGG - Intergenic
965837598 3:172868520-172868542 TAGAAAGCTCAGTTTGGGGTTGG - Intergenic
967027975 3:185581097-185581119 CAGGAGGCAGAGATTGCAGTGGG + Intergenic
967246985 3:187497833-187497855 CAGAGGGAACAGAAAGGGGTAGG - Intergenic
968251398 3:197219055-197219077 CAGGAGGCAGAGGTTGCGGTGGG + Intronic
968385425 4:132061-132083 CAGGAGGCAGAGGTTGCGGTCGG + Intronic
968495001 4:910552-910574 CTGAAGGGACAGGTAGGGGTGGG - Intronic
969875585 4:10133561-10133583 CAGAGGGCATGGATGGGGGTGGG - Intergenic
972150142 4:36079098-36079120 CAGGAGGCAGAGATTGCAGTGGG + Intronic
972364303 4:38359976-38359998 CAATAGGCACAGAGTGGGGATGG - Intergenic
972399075 4:38683483-38683505 CTGAAGGCACAGACTTGGGGAGG - Intronic
974339436 4:60596016-60596038 CTGAAGGAAAAGATTGGGGAAGG - Intergenic
974472681 4:62338492-62338514 GAGAAAGCACACTTTGGGGTAGG - Intergenic
975983513 4:80183970-80183992 CGGCAGGCTCCGATTGGGGTGGG + Intronic
978464376 4:108993182-108993204 CAGATGGCAGGGTTTGGGGTGGG - Intronic
978609487 4:110521950-110521972 CAGGAGGCACAGGTTGCAGTGGG - Intronic
979289593 4:118965285-118965307 GAGAAGGCCCTGGTTGGGGTGGG - Intronic
979429468 4:120611119-120611141 AAGAAGGTAATGATTGGGGTAGG + Intergenic
979718170 4:123866683-123866705 CAGAAGGCACAGCAGGGGGCCGG - Intergenic
980123684 4:128752728-128752750 CAGGAGGCAGAGATTGCAGTGGG + Intergenic
981336141 4:143570652-143570674 CATAGGGCAGAGCTTGGGGTTGG + Intergenic
982082621 4:151805638-151805660 ATGAAGGCAGAGATTGGAGTTGG + Intergenic
982704050 4:158687964-158687986 CAGAAGGCAGAGGTTGCAGTGGG + Intronic
983621510 4:169766158-169766180 CAGAAGAAACAGATTTGGGAAGG + Intergenic
984308383 4:178024156-178024178 CAAAAGGCATAGATTTTGGTAGG + Intergenic
987385185 5:17322238-17322260 CAGGAGGCAGAGATTGCAGTGGG - Intergenic
988077607 5:26372984-26373006 CAGAAGGCAGAGGTTGCAGTGGG - Intergenic
988600268 5:32633113-32633135 CAGGAGGGACAGAATGGGATTGG + Intergenic
988999533 5:36745573-36745595 CAGGTGGCCCAGCTTGGGGTGGG + Intergenic
989202065 5:38773549-38773571 CAGAAGGAACAGATGGAGGAAGG + Intergenic
991126976 5:63080574-63080596 TGGAAAGCACAGATTTGGGTTGG - Intergenic
991383016 5:66051904-66051926 AAAAAGAGACAGATTGGGGTTGG + Intronic
992191533 5:74296715-74296737 CAGATTGAACAGTTTGGGGTGGG - Intergenic
992484084 5:77179324-77179346 CAGCAGGAACAGATTGTTGTTGG + Intergenic
992542702 5:77780215-77780237 CAGGAGGCAGAGGTTGTGGTGGG + Intronic
992636718 5:78731612-78731634 CAGGAGGCAGAGATTGCAGTGGG - Intronic
994253881 5:97570093-97570115 CAGAAGGGAAATATTGGGTTGGG - Intergenic
994559425 5:101347942-101347964 CAAAAGGCAGAGATTGGGGAGGG + Intergenic
994907792 5:105863232-105863254 TAAAAGGCACAGAGTGGGCTGGG + Intergenic
994967501 5:106693462-106693484 CAGGAGGCAGAGATTGCAGTGGG + Intergenic
995212057 5:109551620-109551642 CAGAAGCCAAGAATTGGGGTTGG + Intergenic
996572202 5:124944426-124944448 CAGAAGGCAGAGGTTGCAGTGGG + Intergenic
996873818 5:128219545-128219567 GAGAAGGACCAGATTTGGGTGGG - Intergenic
998186315 5:139982440-139982462 GAAAAGGCAGAGATTGGTGTGGG - Intronic
999812919 5:155144907-155144929 CAGTAGGTTCAGATTGGGGCTGG + Intergenic
999991920 5:157057828-157057850 TAGAAGCCAGAGAATGGGGTAGG - Intronic
1000572777 5:162935715-162935737 CAGAATGCTCAGGTTGGGGTGGG + Intergenic
1000783995 5:165520826-165520848 CAGGAGGCAGAGTTTGCGGTGGG - Intergenic
1001989626 5:176105556-176105578 CAGGTGGCACAGGTTGTGGTGGG + Intronic
1002227244 5:177732582-177732604 CAGGTGGCACAGGTTGTGGTGGG - Intronic
1002266898 5:178041188-178041210 CAGGTGGCACAGGTTGTGGTGGG + Intronic
1002425345 5:179171636-179171658 CAGGAGGCAGTGATGGGGGTAGG - Intronic
1002951493 6:1816843-1816865 CATAAGGCACAGGTGGGGATAGG + Intronic
1005066520 6:21823233-21823255 CAGGAGGCAGAGGTTGCGGTGGG + Intergenic
1005101118 6:22173420-22173442 CAGAAGTCAAGAATTGGGGTTGG + Intergenic
1005457703 6:26037057-26037079 CAAAAGGCAGATATTGGGGAGGG + Intergenic
1005833590 6:29690532-29690554 CAGGAGGCAGAGGTTGTGGTGGG - Intergenic
1006078592 6:31550761-31550783 CAGGAGGCAGAGGTTGAGGTGGG - Intronic
1006189479 6:32198817-32198839 CAGAAGTCAAAGATAGGGGAAGG - Intronic
1006489293 6:34372728-34372750 CAGGAGGCAGAGGTTGTGGTGGG + Intronic
1006760153 6:36453586-36453608 CAGGAGGCAGAGGTTGCGGTGGG - Intronic
1007336215 6:41156994-41157016 GAGAAGGCGCAGTTTGGGCTCGG + Intergenic
1008015660 6:46516607-46516629 AGGAAGGGACAGATTGGGATTGG - Intergenic
1009715250 6:67384710-67384732 CAGAATGCACTAGTTGGGGTAGG + Intergenic
1010559752 6:77334187-77334209 CAGGAGCCACAGGTTGGAGTTGG + Intergenic
1010792735 6:80083442-80083464 CAGAAGGCGGAGATTGCAGTGGG + Intergenic
1010794429 6:80103105-80103127 CAGAAGGCAGAGGTTGCAGTGGG - Intergenic
1010897481 6:81382277-81382299 AAGAGGGCACAGGTTGGGGGAGG + Intergenic
1011861821 6:91767564-91767586 CTGAAAACACAGATTGGGGCAGG + Intergenic
1012470853 6:99570848-99570870 CAGGAGGCAGAGGTTGCGGTGGG + Intergenic
1012983962 6:105855483-105855505 CAGGGGGCACAGAATGGTGTAGG + Intergenic
1014255614 6:119157945-119157967 CAAAGGGTAGAGATTGGGGTAGG - Intergenic
1014938999 6:127416232-127416254 CAGGAGGCAGAGGTTGCGGTGGG + Intergenic
1015932350 6:138374519-138374541 GAGAAGGGAAAGATTGGGGTGGG - Intergenic
1016967967 6:149736201-149736223 CAGGAGGCAGAGGTTGCGGTGGG + Intronic
1017203892 6:151784794-151784816 TAAAAGGCACAAGTTGGGGTGGG - Intronic
1018166682 6:161104338-161104360 CAGGAGGCAGAGGTTGCGGTGGG + Intronic
1018581220 6:165309716-165309738 CAGAAGGCACAGAAGAGGGGAGG - Intergenic
1018625297 6:165771927-165771949 CAGAAGGCTCTGGCTGGGGTGGG + Intronic
1019462996 7:1171217-1171239 CCGACGGCTCAGATTGGCGTGGG - Intergenic
1019654152 7:2179572-2179594 CAGAGGGAACAGAATGGGGCTGG + Intronic
1019702653 7:2481480-2481502 CAGGCAGCAGAGATTGGGGTGGG - Intergenic
1019730796 7:2628330-2628352 CAGAAGGCTGAGATTGAGGCGGG + Intergenic
1020205743 7:6113914-6113936 CAGAAGGCTGAGATTGGGTCGGG - Intronic
1020733588 7:11916501-11916523 AAAAATGCACAGATTGGGGCTGG + Intergenic
1021733873 7:23623520-23623542 CAGAAGGCAGAGGTTGTGGTGGG + Intronic
1021832836 7:24634302-24634324 CAGAAGGCAGAGCTTGCAGTGGG - Intronic
1022689838 7:32637963-32637985 CTGAAGGCACAGAGTGGGAGGGG - Intergenic
1022917418 7:34972196-34972218 CTGAAGGCACAGAGTGGGAGGGG - Intronic
1023797593 7:43806672-43806694 CAGAAGGCAGAGGTTGCAGTGGG + Intronic
1023822847 7:43989633-43989655 GAGCAGTCAGAGATTGGGGTTGG + Intergenic
1023867805 7:44247090-44247112 CACCTGGCACAGAGTGGGGTGGG + Intronic
1023877018 7:44292067-44292089 CAGAAGGCAGAGATTAGGGCTGG + Intronic
1025819397 7:64947914-64947936 CAGAAGGCACAGTCTCGGCTCGG - Intergenic
1026020372 7:66700695-66700717 CAGAGGGCACGGCTTAGGGTGGG - Intronic
1026362473 7:69615374-69615396 CAGAAGGCAGAGGTTGCAGTAGG - Intronic
1026842832 7:73680057-73680079 CAGAAGGTTCAGACTGGGGGTGG - Intergenic
1026908898 7:74081291-74081313 AAGAAAGCACAGATTGGGCCTGG - Intergenic
1027606360 7:80304603-80304625 CAGGAGGCAGAGGTTGCGGTGGG - Intergenic
1027914119 7:84292619-84292641 GAAAATGCACAAATTGGGGTTGG + Intronic
1028313824 7:89374750-89374772 CAGAAGGCAGAGGTTGCAGTGGG - Intergenic
1028737774 7:94236871-94236893 TAGAAGGCACAGAATGGGCAAGG + Intergenic
1029220159 7:98982355-98982377 CAGAAAGCACAGATTGTTCTAGG + Intronic
1029420278 7:100468390-100468412 CGGAGGGGACAGAATGGGGTCGG - Intronic
1029661155 7:101963004-101963026 CAGAAAGCTGAGATTGGGCTGGG - Intronic
1029751112 7:102543059-102543081 GAGCAGTCAGAGATTGGGGTTGG + Intronic
1029769064 7:102642164-102642186 GAGCAGTCAGAGATTGGGGTTGG + Intronic
1030412607 7:109200808-109200830 CAGGAGGCAGAGATTGCGGTGGG - Intergenic
1031787502 7:126052553-126052575 AAGGAGGCACAGAATGTGGTAGG + Intergenic
1032268499 7:130384353-130384375 CTGCAGGCACAGCTTGGGATGGG - Intronic
1033344073 7:140513748-140513770 CAGGAGGCTGAGATTGTGGTGGG - Intergenic
1033349313 7:140549150-140549172 CAGTAGGCAGAGGTTGTGGTGGG + Intronic
1034505220 7:151483640-151483662 CAGGAGGCACAGGTTGTAGTGGG + Intronic
1035046262 7:155969276-155969298 CAGAAGGCACGGATGCAGGTGGG + Intergenic
1035330600 7:158094601-158094623 TAGAAAGCACAGATGGGGGCCGG - Intronic
1035429225 7:158805169-158805191 CAGAAGGCACAAATTTGTGTTGG - Intronic
1035657729 8:1323473-1323495 CAGGAGCCACAGTGTGGGGTGGG - Intergenic
1035990469 8:4484411-4484433 CAGAAGACACAGAGAGGGATGGG + Intronic
1036160131 8:6380068-6380090 CAGTAAGAATAGATTGGGGTTGG + Intergenic
1036756616 8:11475410-11475432 GAGAAGGCCCAGCTGGGGGTGGG - Intergenic
1038885619 8:31659533-31659555 CAGGAGCAACAGATTGGGGTAGG + Intronic
1040846363 8:51846219-51846241 CAAAAGGCATGGAGTGGGGTGGG - Intronic
1040874931 8:52141495-52141517 CAGAGGGCACAAAGTGGGGACGG - Intronic
1041344666 8:56884243-56884265 CAGGAGGCAGAGGTTGTGGTAGG + Intergenic
1041347986 8:56921067-56921089 GACAAGGCACAGATGAGGGTCGG + Intergenic
1041731733 8:61069689-61069711 CAGAAGGAACAGATAAGGATGGG - Intronic
1041891238 8:62871327-62871349 CAGAAGGCAGAGGTTGCAGTTGG + Intronic
1042252113 8:66766923-66766945 CGGGAGGCAGAGATTGCGGTGGG - Intronic
1042558747 8:70056553-70056575 CAGGAGGCAGAGGTTGCGGTGGG - Intronic
1043128278 8:76428084-76428106 GTGCATGCACAGATTGGGGTAGG - Intergenic
1043457684 8:80428863-80428885 CAGGAGGCAGAGATTGCAGTGGG - Intergenic
1044328836 8:90892896-90892918 GGGAAGGCTCAGATTTGGGTGGG - Intronic
1044505288 8:93009533-93009555 CAGAAGGCAGAGGTTGCAGTGGG + Intronic
1045466704 8:102476841-102476863 CAGGAGGCAGAGGTTGCGGTGGG + Intergenic
1045516670 8:102865824-102865846 GAGAAGGCACAGAAGTGGGTGGG + Intronic
1045760462 8:105600092-105600114 CAGTAGGCAAACATTGTGGTCGG - Intronic
1045801633 8:106108857-106108879 CAGAAGGCACAGCTGGGTCTGGG + Intergenic
1046685940 8:117226974-117226996 CAGAAGCCACAGGTTGGCGGGGG - Intergenic
1046747605 8:117892924-117892946 CAGAAGCAACATATTGGGGAGGG + Intronic
1047557684 8:125950338-125950360 CACAGGTCACAGATTGGGGAAGG + Intergenic
1047860277 8:128958257-128958279 CAGAGGGCAGGGATTGGGTTGGG + Intergenic
1048002837 8:130393680-130393702 CAGGAGGCAGAGATTGCAGTGGG + Intronic
1048176319 8:132155744-132155766 TAGAAGGCAGAGATTGAGCTAGG - Intronic
1048390260 8:133956604-133956626 GAGAAGGAAGAGATTAGGGTAGG - Intergenic
1049150956 8:141035200-141035222 CTGGAGGCAGAGATTGGAGTGGG + Intergenic
1049205621 8:141362170-141362192 GAGCAGGAACAGCTTGGGGTTGG - Intronic
1049258023 8:141624255-141624277 GGGAAGGCCCAGGTTGGGGTGGG + Intergenic
1051015848 9:12474956-12474978 CAGAAGTCAAAAATTGAGGTTGG + Intergenic
1051349441 9:16185105-16185127 GAGAAGGCAGAGAATAGGGTTGG - Intergenic
1052003729 9:23320809-23320831 CAAATGGCACAGATGGGTGTGGG - Intergenic
1052298431 9:26925527-26925549 GAGAAGGTAGAGATTGGTGTGGG - Intronic
1053354206 9:37432602-37432624 CAGGAGGCACAGGTTGCAGTAGG + Intronic
1055030100 9:71765629-71765651 GAGAAGGAACAGTTGGGGGTGGG - Intronic
1056255982 9:84800274-84800296 CAGGAGGCACAGGTTGCAGTGGG - Intronic
1056288101 9:85111885-85111907 AATCAGGCAGAGATTGGGGTGGG - Intergenic
1056407364 9:86287469-86287491 TAAAAGGCACAGATGGGGGTGGG - Intergenic
1056445318 9:86660344-86660366 CAAAAGGCACAGGATGTGGTGGG + Intergenic
1057001490 9:91513907-91513929 GGGAAGGGACAGATTGAGGTGGG + Intergenic
1057447722 9:95129639-95129661 GAGAAGGAACAGATTTTGGTAGG - Intronic
1057954866 9:99399564-99399586 TAGAAGGCACAGGATGGGGAAGG - Intergenic
1058967940 9:110054323-110054345 CAGGAGGCAGAGGTTGCGGTGGG + Intronic
1060491465 9:124088293-124088315 CAGAAGGCACAGATGAGGCCAGG - Intergenic
1061375421 9:130221095-130221117 CAGGAGGCAGAGATTGTAGTGGG - Intronic
1062014884 9:134286442-134286464 CAGACGGCACTGTTTGGGGGTGG - Intergenic
1062437270 9:136551867-136551889 CACCAGGCACAGGTCGGGGTGGG - Intergenic
1062631970 9:137467126-137467148 GAGAAGGCACAGATGCAGGTTGG - Intronic
1185598252 X:1321499-1321521 CAGGAGGCAGAGGTTGCGGTTGG + Intergenic
1186936098 X:14451333-14451355 TAAAAGGCACAGAGTGGGCTGGG + Intergenic
1187118073 X:16373926-16373948 TAGAAGGCACAGAATAAGGTTGG - Intergenic
1188145883 X:26612684-26612706 CATAAGGCAGAGAATGGGGTTGG + Intergenic
1188311273 X:28619531-28619553 CAGGAGGCAGAGATTGCAGTGGG + Intronic
1188340395 X:28993593-28993615 GAGAAGGCAAAGATTGAAGTAGG + Intronic
1188522488 X:31054278-31054300 CAGAAGAAACAGGATGGGGTAGG + Intergenic
1188660671 X:32754002-32754024 CAGATGGCACAAATCTGGGTGGG - Intronic
1189877985 X:45456632-45456654 CTGAAGGCACAAATGGGGATAGG - Intergenic
1189960257 X:46317657-46317679 CAGTAGGAACAGATCGGGGGAGG + Intergenic
1190059880 X:47203820-47203842 CAGGAGGCAGAGGTTGTGGTGGG - Intronic
1190274709 X:48892322-48892344 CAGAAGTCACAGCTTGGGGGCGG + Intergenic
1190949206 X:55125959-55125981 AAGAAAGCACAGAATGGGTTAGG + Intronic
1192887689 X:75353334-75353356 CAAAAGGCAGAGATAGGGCTGGG - Intergenic
1194049645 X:89053233-89053255 CAGAAGACACATATTGAGGCTGG - Intergenic
1194748240 X:97653892-97653914 CATGAGGTATAGATTGGGGTAGG + Intergenic
1195574938 X:106439023-106439045 CAGATTCCACAGATTGGGGAGGG - Intergenic
1195655631 X:107329058-107329080 AAGAAGGGACAGGCTGGGGTAGG - Intergenic
1195907601 X:109861052-109861074 CTGAAGGCTCAGCTTGGGGAAGG - Intergenic
1196647588 X:118134411-118134433 CAGGAGGCAGAGGTTGCGGTGGG - Intergenic
1196810753 X:119627370-119627392 CAGCAAGCAGAGACTGGGGTTGG + Intronic
1196850502 X:119933465-119933487 GAGAAGGCTCAGATTTGAGTTGG - Intronic
1197192963 X:123669391-123669413 CGGGAGGCAGAGATTGCGGTGGG - Intronic
1197293247 X:124685631-124685653 CAGGAGGCAGAGGTTGTGGTGGG - Intronic
1198372068 X:135999703-135999725 CAGAATGGAAAGGTTGGGGTAGG + Intronic
1200161520 X:154012281-154012303 CTGAAAGCACAGAGTGGGGCAGG + Intronic
1201055857 Y:9991031-9991053 CAGGAGGTAGAGATTGGAGTGGG - Intergenic
1201747769 Y:17398057-17398079 CAGGAGGCAGAGGTTGCGGTGGG - Intergenic
1201902414 Y:19057164-19057186 CAGGAGGCAGAGTTTGCGGTGGG + Intergenic