ID: 1174202006

View in Genome Browser
Species Human (GRCh38)
Location 20:48813115-48813137
Sequence CTGGGATACAGCAGGATGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 247
Summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 221}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174202006_1174202017 28 Left 1174202006 20:48813115-48813137 CCCTGCATCCTGCTGTATCCCAG 0: 1
1: 0
2: 0
3: 25
4: 221
Right 1174202017 20:48813166-48813188 TAACACAATGTGTTGGAACAAGG 0: 1
1: 0
2: 1
3: 11
4: 145
1174202006_1174202016 21 Left 1174202006 20:48813115-48813137 CCCTGCATCCTGCTGTATCCCAG 0: 1
1: 0
2: 0
3: 25
4: 221
Right 1174202016 20:48813159-48813181 AGGTGCTTAACACAATGTGTTGG 0: 1
1: 0
2: 2
3: 10
4: 162
1174202006_1174202014 1 Left 1174202006 20:48813115-48813137 CCCTGCATCCTGCTGTATCCCAG 0: 1
1: 0
2: 0
3: 25
4: 221
Right 1174202014 20:48813139-48813161 ATCTGGGCCAGGCACACAGTAGG 0: 1
1: 2
2: 10
3: 104
4: 696
1174202006_1174202018 29 Left 1174202006 20:48813115-48813137 CCCTGCATCCTGCTGTATCCCAG 0: 1
1: 0
2: 0
3: 25
4: 221
Right 1174202018 20:48813167-48813189 AACACAATGTGTTGGAACAAGGG 0: 1
1: 0
2: 3
3: 30
4: 292
1174202006_1174202011 -10 Left 1174202006 20:48813115-48813137 CCCTGCATCCTGCTGTATCCCAG 0: 1
1: 0
2: 0
3: 25
4: 221
Right 1174202011 20:48813128-48813150 TGTATCCCAGCATCTGGGCCAGG 0: 1
1: 0
2: 0
3: 24
4: 239

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174202006 Original CRISPR CTGGGATACAGCAGGATGCA GGG (reversed) Intronic
900537625 1:3186746-3186768 CTGGGATCCGGCGGGAAGCACGG - Intronic
903213023 1:21829174-21829196 CTGGAATACAGAAGGCTGTAGGG - Intronic
903269115 1:22176786-22176808 CTGGGAGGCAGCAGGGTGCAGGG + Intergenic
907778153 1:57538930-57538952 TTGGGATACAGCAGGGAACAAGG + Intronic
910353522 1:86327796-86327818 CTGGGATAAAAAAGGATCCAGGG + Intergenic
910537441 1:88314498-88314520 CTGGGTTACAGCAGAGTGAAGGG - Intergenic
910551647 1:88482111-88482133 GTGGGAAAAAGCAGGATGAATGG - Intergenic
913055706 1:115157287-115157309 CAGGGCTAGAGCAGGATGGAAGG + Intergenic
915682506 1:157595324-157595346 CTGGGAAGCACCTGGATGCAGGG + Intronic
920210069 1:204321501-204321523 CTGAGATGCAGGAGGAAGCATGG - Intronic
922668249 1:227490787-227490809 ATGGGAGACAGCATGAAGCAGGG - Intergenic
923102219 1:230825882-230825904 CTGGGATGCAGGCTGATGCAAGG + Intergenic
1063168317 10:3483977-3483999 CTGGGAAAGAACTGGATGCAGGG - Intergenic
1063215954 10:3925599-3925621 CTGGGATTCACCGGGAGGCATGG + Intergenic
1063422426 10:5923943-5923965 CAGGCAGACAGAAGGATGCAGGG - Intronic
1065827442 10:29584863-29584885 CTGGGATACATCATGCTGCTTGG + Intronic
1065950413 10:30646294-30646316 CTGGGATACATCATGCTGCTTGG - Intergenic
1069891203 10:71653433-71653455 CTTGGATTCAGCAGCATGGAGGG - Intronic
1070948942 10:80415428-80415450 CTGGGAGACAGCAGGCTGACTGG - Intronic
1071431014 10:85607037-85607059 CTGGAATTCAGCCGGATTCACGG - Intronic
1072453402 10:95557020-95557042 ATGGGAGACAGCAAGATTCAGGG + Intronic
1072664407 10:97383477-97383499 CTGGGTGACAGCAGGCTGCCTGG + Intronic
1074199557 10:111222738-111222760 CTTGGATGCAGCAGGATAAAGGG + Intergenic
1074350071 10:112728033-112728055 CTGTGACACAGCAGGCTGCTGGG + Intronic
1074358811 10:112808739-112808761 CAGGCACACAGCAGGAAGCAGGG + Intronic
1074756996 10:116631397-116631419 CGGGGAGAAAGCAGAATGCATGG + Intronic
1075087756 10:119424743-119424765 CTGGGATATAGCTGGGAGCAAGG - Intronic
1075635125 10:124025513-124025535 CTGTGACACAGCAGGATGCCAGG - Intronic
1075700466 10:124466240-124466262 CAAGCACACAGCAGGATGCACGG + Intronic
1076225152 10:128768744-128768766 CTGAGATACAGGAGGCTCCAGGG + Intergenic
1076573674 10:131449637-131449659 TTGAGAAACAGCAGGATGTATGG - Intergenic
1077611044 11:3643141-3643163 CTGGGAGATAGCAGGATTCTAGG - Intergenic
1077781640 11:5336450-5336472 CTGGGAAACAGGAGGATTGATGG - Intronic
1078425250 11:11244438-11244460 CCAGCATACAGCTGGATGCAGGG + Intergenic
1078539372 11:12200867-12200889 CTGGTGGACAGAAGGATGCAGGG + Intronic
1078976454 11:16483988-16484010 CTGGGATCCTCCAGGAGGCAAGG + Intronic
1079159979 11:17983147-17983169 TTGGGATACTGCATGATTCAGGG + Intronic
1080195967 11:29609286-29609308 GTGGGATAATGCAGGGTGCAAGG + Intergenic
1080290579 11:30666541-30666563 CAGAGATACAACAGGAGGCATGG + Intergenic
1080758771 11:35227505-35227527 ATGGAGTCCAGCAGGATGCATGG - Intronic
1081365823 11:42233813-42233835 CTGGGACCCAGCTGGATGAAAGG + Intergenic
1081741468 11:45443993-45444015 CTGGGAAGGAGCAGGATACATGG - Intergenic
1084873437 11:72113017-72113039 CTGGGATGCAGCAGGACGAATGG - Intergenic
1085206701 11:74737885-74737907 CTGGGATACATCAAGCTGCCTGG + Intergenic
1085750656 11:79158108-79158130 GTGGGACACACAAGGATGCAGGG - Intronic
1087041902 11:93809283-93809305 ATGGGAGACAGCAGGATGGCAGG - Intronic
1088797901 11:113279596-113279618 CTGGGATACGGCAGTGAGCAAGG + Intergenic
1090364814 11:126197005-126197027 CTGGGGGACAGCAAGATGAAGGG + Intergenic
1093244537 12:16720350-16720372 CAGGGATACTGCAGGTAGCATGG - Intergenic
1097178888 12:57159707-57159729 CTGGGCTACAGAGGGGTGCAGGG - Intronic
1100297847 12:93279150-93279172 CTGGCATACAGCAGGTGGCCAGG - Intergenic
1102429789 12:112874246-112874268 CTGGGAAACAACAGCATGTAAGG + Intronic
1102499025 12:113338541-113338563 CTGGGGTAGAGCAGGAAGCAAGG + Intronic
1102783247 12:115583786-115583808 CTGGGCTTAAACAGGATGCAGGG - Intergenic
1104743697 12:131196672-131196694 CTGTGATACAGCAGGATAATCGG + Intergenic
1106565794 13:30883540-30883562 CAGGGAGGCAGCAGGATACAAGG + Intergenic
1108756726 13:53511890-53511912 CTGGACTAAAGCAGGATCCAAGG - Intergenic
1111417226 13:87964844-87964866 CTGGGCTACAGAATGATGTAAGG - Intergenic
1113343342 13:109447881-109447903 ATGGGATACATCATCATGCAAGG + Intergenic
1116101297 14:40440612-40440634 CTGGAATACAGAAGAATTCAGGG - Intergenic
1116934812 14:50728949-50728971 ATGGGATGCAGCAGGCTGCACGG + Intronic
1118473317 14:66094513-66094535 CCGAGATGCAGCAGGAAGCAGGG + Intergenic
1119087631 14:71752220-71752242 CTCGGATACTACAGGATGCCTGG - Intergenic
1119406360 14:74402032-74402054 CTGGGAAGCAGCAGGGTGCAGGG + Intergenic
1119976546 14:79030396-79030418 CTGGGGGTCAGCAGGATGCTCGG - Intronic
1121665108 14:95666226-95666248 CTTGGAGCCAGGAGGATGCAGGG + Intergenic
1123937984 15:25203180-25203202 TTCGGATACTGCTGGATGCATGG + Intergenic
1125021553 15:34991489-34991511 ATGGGAGACAGTAGGAGGCAGGG + Intergenic
1126110860 15:45173942-45173964 GTGGCAAGCAGCAGGATGCAGGG + Intronic
1127218427 15:56849875-56849897 ATGGGATACAGCAAAAAGCAGGG + Intronic
1127422091 15:58816207-58816229 CTGGGATTCAGGAGAATGGAAGG + Intronic
1127671570 15:61199902-61199924 CTGGGATACACCTGGGTGAAGGG + Intronic
1130545727 15:84856815-84856837 CAGGAAGACAGAAGGATGCAGGG + Exonic
1130881614 15:88060472-88060494 CAGGGAAACAGGAGGCTGCATGG + Intronic
1131812338 15:96185564-96185586 CTGGGAGACAGGAGAAAGCATGG - Intergenic
1132593256 16:735716-735738 CTGGGACACAGCTGGATGACAGG + Intronic
1133114357 16:3567811-3567833 CTGGGATTCAGCAGGCTCCCTGG + Intronic
1135049949 16:19184843-19184865 CTGGAAAACAGGATGATGCATGG + Intronic
1136599462 16:31275135-31275157 CTTGGATACAGGAAGAGGCAAGG + Intronic
1137937127 16:52645488-52645510 CTGGGATACAGAAGAGGGCAAGG - Intergenic
1138335184 16:56247225-56247247 CAGGGAGACAGCAGGGTACAGGG - Intronic
1141446412 16:84061526-84061548 CTGGGATGCAGCAGGAGCCATGG - Intronic
1141595488 16:85094730-85094752 CTGGGAAGGAGCAGGACGCAGGG + Intergenic
1141699444 16:85635747-85635769 CTGGATGAAAGCAGGATGCAAGG - Intronic
1142195177 16:88736281-88736303 ATCCCATACAGCAGGATGCAGGG + Exonic
1144825422 17:18103109-18103131 CTGGGACACAGCAGGAGGAGAGG - Intronic
1144890358 17:18490817-18490839 CTGGGCTAATGGAGGATGCAGGG + Intronic
1145141858 17:20453501-20453523 CTGGGCTAATGGAGGATGCAGGG - Intronic
1146514998 17:33482262-33482284 CTGGTCTACTGCAGGATGCATGG + Intronic
1146831226 17:36070870-36070892 CTGGGACAGAGAAGGACGCAGGG + Intronic
1148204161 17:45769167-45769189 CTGGGAGACAGGGGGAAGCATGG + Intergenic
1148243162 17:46013134-46013156 CTGGGAGACAGCTGGCTTCATGG - Intronic
1149205212 17:54236265-54236287 CTGGGATGCAGAAGCATGCATGG - Intergenic
1149423840 17:56535838-56535860 CTGGCATACAGCAAGATTCAAGG - Intergenic
1149637834 17:58184732-58184754 CTGGCATACAGCAAGAGGCGAGG + Intergenic
1152420208 17:80188696-80188718 CTGGGGAACAGCAGGAAGGAAGG - Intronic
1152482236 17:80562168-80562190 CTTGGGTGCAGGAGGATGCAGGG + Intronic
1152608690 17:81305299-81305321 GTGGGAAACAGCAGGAGGCCGGG + Intergenic
1153332043 18:3883412-3883434 CTGGGAGACAGGAGGAAGAAAGG - Intronic
1153893062 18:9535980-9536002 CCGGGTTACAGTAAGATGCACGG - Exonic
1157763634 18:50282171-50282193 GTGGGAGACAGGAGCATGCATGG + Intergenic
1157908715 18:51595047-51595069 CTGGGATACTGCAGGAACCCAGG + Intergenic
1158122374 18:54062727-54062749 CTTGGATCCAGCACAATGCAAGG - Intergenic
1159019517 18:63131823-63131845 CTGGGAAACCGGAGGATGCAGGG + Intronic
1160387122 18:78503499-78503521 CTGGGAGCCAGCAGGAGGCGGGG - Intergenic
1161624831 19:5320212-5320234 TTGTGACACAGCAGGAAGCAGGG + Intronic
1163393744 19:17046430-17046452 CTGGGAACCAGCTGGATGCCAGG - Intergenic
1163850841 19:19662622-19662644 CGGGGATACAACAGCAAGCAAGG - Intronic
1165863420 19:38921450-38921472 CAGGGAGACAGCAGGAGTCACGG + Intronic
1167118040 19:47499485-47499507 CTGGGCCACAGCAGGCTGCGTGG - Intronic
1167462859 19:49635571-49635593 CTGGGCTACAGGAGGACGCAGGG + Exonic
1167590737 19:50403030-50403052 CTGCGAGGCAGGAGGATGCAGGG - Intronic
1168647953 19:58073190-58073212 CTGTGAAAGACCAGGATGCAAGG - Intronic
925389784 2:3486967-3486989 CAGGGAGACCCCAGGATGCAGGG + Intergenic
925511060 2:4625945-4625967 CTGGGAAACAGGAGGATGGCTGG + Intergenic
925559299 2:5171912-5171934 GTGGGATACAGCAGCATGTCTGG + Intergenic
926711238 2:15882982-15883004 CTTGGTTACCCCAGGATGCATGG - Intergenic
927037704 2:19197027-19197049 GTGGGATGCAGCAGAAAGCAGGG + Intergenic
927207952 2:20621823-20621845 TTGGGACACAGGAGGCTGCAAGG + Intronic
928897788 2:36284728-36284750 CTGGGATAGATCAGGAGGCTTGG - Intergenic
930649361 2:53949173-53949195 CTGGAAATCAGCATGATGCAGGG - Exonic
932054925 2:68433682-68433704 CTGGGATGCAGCAGGGAGCAAGG + Intergenic
933242700 2:79940965-79940987 TTGGGATAAAGCAGTATGCATGG - Intronic
933713134 2:85342375-85342397 CTGGGCTGAAGCAGGCTGCAGGG - Exonic
933763984 2:85694893-85694915 CTGGGAGAGAGCAGGGTGCAGGG - Intronic
933771544 2:85747783-85747805 CTGGGATATAGCAGTAAACAAGG + Intergenic
935171786 2:100615843-100615865 CTGGAATAAAGCAGGGTGCGGGG + Intergenic
936096338 2:109532973-109532995 CTGGGATACAGCAGTGAACAAGG + Intergenic
936290866 2:111223039-111223061 CTGGGTTCAAGCAGGATCCATGG + Intergenic
936662186 2:114554806-114554828 CTTGGATACAACAGCATGCACGG + Intronic
938291705 2:130154185-130154207 CTGTGATCCAGCAGGAAGGAGGG - Intronic
940591471 2:155733691-155733713 CTGGGTGACAGCAGCATGGATGG + Intergenic
942209741 2:173658540-173658562 CTGTGAAACAGCAGACTGCATGG + Intergenic
942266415 2:174230959-174230981 CTGGGCAAAAGAAGGATGCAAGG + Intronic
943552939 2:189363873-189363895 GTGGGTTATAGCAGGATTCATGG - Intergenic
946195646 2:218031963-218031985 CTGGGATACAGCAGAGAGCAAGG + Intergenic
946388415 2:219400359-219400381 CTGGGACACAGCAGGGAACAAGG - Intergenic
946765677 2:223037829-223037851 CTGCTATAAAGCAAGATGCAAGG - Intergenic
948602590 2:239115860-239115882 CTGGGATTCAGCAGGAAGGGAGG - Intronic
948794966 2:240397778-240397800 GTGGGACACAGCAGGAGTCAGGG + Intergenic
948870274 2:240794358-240794380 ATGGGAGACAGCAGGGTGCGGGG - Intronic
1172903932 20:38355210-38355232 CTGGGACACAGCAGGGCGCCGGG + Intronic
1173530643 20:43766832-43766854 CTGAGAGGCAGCACGATGCAGGG - Intergenic
1174202006 20:48813115-48813137 CTGGGATACAGCAGGATGCAGGG - Intronic
1174213172 20:48896026-48896048 CTGGGATAGAGCCACATGCAGGG - Intergenic
1174366753 20:50061161-50061183 TCGGGAGGCAGCAGGATGCAGGG + Intergenic
1175183070 20:57162050-57162072 CCGGGATTCTGCAGAATGCAAGG - Intergenic
1178336211 21:31745732-31745754 CTGAGATTCAGCAAGATACATGG - Intergenic
1178564246 21:33668549-33668571 CTGGGGTAAAGTGGGATGCAGGG + Intronic
1179944932 21:44666775-44666797 CAGGCACACAGCAGGATGCCTGG + Exonic
1181051304 22:20239432-20239454 GTTGGACTCAGCAGGATGCATGG - Intergenic
1181081621 22:20419441-20419463 CAGGGGTACAGTAGGAAGCAGGG - Intergenic
1181278005 22:21698877-21698899 CAGGGATAAAGCAGCTTGCAGGG + Exonic
1181344834 22:22211483-22211505 CAGGGATAGAACAGGCTGCACGG - Intergenic
1181482026 22:23206126-23206148 CTGGGAAGCAGCAGGAAACAGGG - Intronic
1184022661 22:41831505-41831527 TTGCAATACAGCAGTATGCAAGG + Intergenic
949617298 3:5767965-5767987 CAGGGATAGATAAGGATGCAGGG + Intergenic
949895305 3:8763925-8763947 CTGGGATAAAGCAGGCAGTAGGG - Intronic
950442642 3:13018994-13019016 TTGGCATCCAGCAGGGTGCATGG - Intronic
953469800 3:43156960-43156982 CTGAGATACAGCAGGAATCCAGG + Intergenic
954487138 3:50863135-50863157 CTGGGAAGCTGCAGGATGCCTGG - Intronic
956710190 3:72032392-72032414 CTAGGATACAGCAGAAAGGAGGG - Intergenic
958028043 3:88072361-88072383 CTGAGATACAGAAGTATGGAAGG - Intronic
959180690 3:102976005-102976027 CTGGGATGGTGCAGGATGGAGGG - Intergenic
961079485 3:124013853-124013875 ATGGGATACATCAGAATCCAAGG - Intergenic
961867041 3:129961119-129961141 CAGGGATTCAGCATGAAGCAGGG - Intergenic
962865516 3:139445415-139445437 CTGGCATACCGCAGGGTACAAGG + Intergenic
963030596 3:140970972-140970994 CTCGGTTACAGCTTGATGCAAGG + Exonic
964885273 3:161474885-161474907 CTGAGATGCAGTAGCATGCAGGG + Intergenic
966960851 3:184937127-184937149 CTGGAATACAGCTATATGCATGG + Intronic
969465228 4:7352463-7352485 TTGAGAGACAGCAAGATGCAGGG - Intronic
970399742 4:15705728-15705750 CTGTGACATTGCAGGATGCAGGG - Intronic
970614915 4:17760027-17760049 AGGGGACACAGCATGATGCAGGG - Intronic
970861190 4:20704586-20704608 CTGTGCTACAGATGGATGCAGGG + Intronic
972111495 4:35566319-35566341 CTGGGACACAGAAGGACACAAGG - Intergenic
972240127 4:37181711-37181733 CTGGCTTACAGCAGGTTGCCTGG + Intergenic
972338348 4:38128614-38128636 CTGGGACACAGCTGGATCCTGGG + Intronic
975118556 4:70705126-70705148 CCGGGGTACAGCAGGAAGAAGGG - Intronic
975769813 4:77708818-77708840 CTGGCACCCAGCAGTATGCATGG - Intergenic
978126108 4:105136879-105136901 TTGGGATGCAGCAGTTTGCAGGG - Intergenic
980242985 4:130201783-130201805 CAGGGACCCAGCAGGAGGCAGGG + Intergenic
980449962 4:132958489-132958511 CCAGGATGCAGCAGGAAGCAAGG - Intergenic
980467463 4:133204117-133204139 CTGGGAGTCAGGAGGATGCATGG + Intronic
981205930 4:142040257-142040279 AGGGGATGCTGCAGGATGCATGG + Intronic
985351725 4:189070692-189070714 TTGGGACACAGCAAGACGCATGG - Intergenic
985854706 5:2415910-2415932 CTGAGTGACAGCAGGATGCCCGG - Intergenic
986969507 5:13315635-13315657 CTGGGATGCAGCAGGGTGAGAGG - Intergenic
988942503 5:36160406-36160428 ATGGGCTACAGCAGGATTCAGGG - Intronic
992683088 5:79172404-79172426 CTGGGAGACAGGAGTCTGCAGGG + Intronic
992842539 5:80710562-80710584 CTGGTATCCAGCAGAAAGCATGG + Intronic
995154789 5:108898115-108898137 CTGGGAGACAGCAGGAAGGTAGG + Intronic
996215327 5:120858986-120859008 CTGAGCTACAACAGGATCCATGG - Intergenic
996316232 5:122163718-122163740 CTGGGATCCAGCTGGGAGCAGGG + Intronic
998582177 5:143388485-143388507 CTGGCATACAGGAGTAAGCAAGG + Intronic
998754231 5:145358428-145358450 CTGGGAAACACCTGGATGGAAGG - Intergenic
999101412 5:149028772-149028794 CTGGGGTACACCTGGAGGCATGG - Intronic
1000019565 5:157307277-157307299 CTGGGATACAGCAAGGAGCTAGG + Intronic
1000274905 5:159725524-159725546 CTGGCCTGCAGCAGGTTGCAGGG + Intergenic
1001841028 5:174876979-174877001 CTGGGATGTATCAGGCTGCAGGG + Intergenic
1003867681 6:10378324-10378346 CTGAGATCCCACAGGATGCAGGG + Intergenic
1013403208 6:109818785-109818807 ATGGAAAGCAGCAGGATGCAGGG - Intronic
1015984965 6:138875546-138875568 CTGGGGTACTGCAGGCAGCAGGG + Intronic
1016997907 6:149973916-149973938 TTGGGAGAGAGGAGGATGCAGGG + Intergenic
1017264281 6:152424090-152424112 CGAGGATACAGCAGTAAGCAAGG - Intronic
1018633695 6:165842464-165842486 CTGGGCTGCTGCAGCATGCAAGG - Intronic
1022191535 7:28021013-28021035 CTGGGATTCTGCAAGATGGAGGG - Intronic
1022977177 7:35569527-35569549 CTGGGATATAACGGGCTGCAGGG - Intergenic
1023842110 7:44103841-44103863 CTGGGATGCAGCAGGGCCCATGG + Intergenic
1027223273 7:76227542-76227564 CTGGGAGGGAGCAGGAGGCAGGG - Intronic
1028216676 7:88141199-88141221 GTGGGAAAGAGCAGGCTGCAAGG + Intronic
1028990486 7:97044154-97044176 CTGGGGTGCAGCAGGATGAAGGG + Intergenic
1031581086 7:123475831-123475853 CAGTGATGAAGCAGGATGCAAGG + Intronic
1032008120 7:128320759-128320781 CTGAATTACAGCAGAATGCAAGG - Intronic
1033764700 7:144475719-144475741 CAGAGATACAACAGGATGCATGG + Intronic
1034275345 7:149821512-149821534 CTGGGGGACAGCTGGCTGCAGGG + Intergenic
1034722710 7:153309392-153309414 CTGGGACCCAGAAGGAAGCAGGG + Intergenic
1036708324 8:11061087-11061109 CTGGGACACAGCACCATGAATGG + Intronic
1039071966 8:33657065-33657087 ATGGCAGACAGCAGCATGCAAGG - Intergenic
1041021595 8:53643715-53643737 ATGAGGTACAGCAGGATGGAGGG - Intergenic
1044602979 8:94024369-94024391 CTGGGAAAGTGCAGGATGGAGGG + Intergenic
1044747527 8:95385225-95385247 TTTTGATACAGCAGAATGCATGG + Intergenic
1044935817 8:97292553-97292575 CTGGGGTGCAGAAGGTTGCATGG + Intergenic
1046029196 8:108763127-108763149 TTGGGATTCAGCCAGATGCATGG - Intronic
1048239081 8:132723353-132723375 CTTGGATACTGAAGGATGAATGG + Intronic
1048470581 8:134700699-134700721 AGGGGATACAGCAGGGGGCAAGG - Intronic
1050321232 9:4454513-4454535 TTGGGAAACAGCAAGATGTAGGG - Intergenic
1051723565 9:20065260-20065282 CTGGGAGACTGCTGGAAGCAGGG - Intergenic
1056435966 9:86576462-86576484 CTGGAAAACAGAAGGGTGCAAGG + Intergenic
1056811947 9:89771825-89771847 CTGGGAGAATGCAGGATGCCAGG + Intergenic
1057291750 9:93811193-93811215 CTGGGAAACAGCAGCGTGCCTGG + Intergenic
1057606109 9:96498919-96498941 CTGGGAGGCAGCAGGCTGCAGGG - Intronic
1057845785 9:98521391-98521413 CTGGGCCACAGAAGGGTGCAGGG + Intronic
1059313938 9:113408437-113408459 CTGGAACACAGCAGGCAGCATGG + Exonic
1059439282 9:114295789-114295811 CTGGGATGCACCACGATGCCCGG + Intronic
1061180413 9:129022215-129022237 CAGGGATACAGTAGGAGGCCTGG - Intronic
1062109492 9:134774183-134774205 ATGGGATACAGCAGGGAGCAAGG + Intronic
1062357985 9:136174024-136174046 CTGGGAGACAGCAGGCTCAAAGG + Intergenic
1062375227 9:136259061-136259083 CAGGGATAGACCAGGATGGATGG + Intergenic
1186985105 X:15004136-15004158 GTGCCATACAGCAGGAGGCATGG + Intergenic
1189328070 X:40125161-40125183 CTGGCACATAGCAGGCTGCAGGG - Intronic
1190063571 X:47225757-47225779 CAGGGACACTGCAGGAAGCATGG - Exonic
1192151370 X:68714851-68714873 CTGGGCCACAGGGGGATGCAAGG + Intronic
1193796421 X:85880247-85880269 CTGGGATACTGTAGGATGTATGG + Intronic
1197262821 X:124334814-124334836 CTGGGGGACAGCAGGAGCCATGG + Intronic
1200283561 X:154799709-154799731 CTGGGATTCAGGAGGAGCCAGGG + Intronic
1201484922 Y:14483878-14483900 TTAGGATACAGGAGGATGCATGG - Intergenic
1201530783 Y:14987857-14987879 CCTGGATACAGCAAGATGCCAGG + Intergenic