ID: 1174203950

View in Genome Browser
Species Human (GRCh38)
Location 20:48826341-48826363
Sequence AAAAGTGGCCAGCGGGTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 192
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 175}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174203950_1174203959 5 Left 1174203950 20:48826341-48826363 CCCTCCACCCGCTGGCCACTTTT 0: 1
1: 0
2: 0
3: 16
4: 175
Right 1174203959 20:48826369-48826391 TTCCTAGGAGAGTAGGGAAGTGG 0: 1
1: 0
2: 2
3: 32
4: 260
1174203950_1174203955 -10 Left 1174203950 20:48826341-48826363 CCCTCCACCCGCTGGCCACTTTT 0: 1
1: 0
2: 0
3: 16
4: 175
Right 1174203955 20:48826354-48826376 GGCCACTTTTCTCACTTCCTAGG 0: 1
1: 0
2: 2
3: 32
4: 330
1174203950_1174203958 -1 Left 1174203950 20:48826341-48826363 CCCTCCACCCGCTGGCCACTTTT 0: 1
1: 0
2: 0
3: 16
4: 175
Right 1174203958 20:48826363-48826385 TCTCACTTCCTAGGAGAGTAGGG 0: 1
1: 0
2: 0
3: 12
4: 145
1174203950_1174203957 -2 Left 1174203950 20:48826341-48826363 CCCTCCACCCGCTGGCCACTTTT 0: 1
1: 0
2: 0
3: 16
4: 175
Right 1174203957 20:48826362-48826384 TTCTCACTTCCTAGGAGAGTAGG 0: 1
1: 0
2: 1
3: 24
4: 375

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174203950 Original CRISPR AAAAGTGGCCAGCGGGTGGA GGG (reversed) Intronic
901502279 1:9660231-9660253 AGAAGTGTCCATCGGGTGAATGG - Intronic
901758628 1:11456398-11456420 GAAATTGGCCAGCGAGAGGAGGG + Intergenic
902155098 1:14478745-14478767 AAGGGAGGCCAGCTGGTGGATGG - Intergenic
902659178 1:17889570-17889592 AGTAGTGGCCAGGGGGTGGATGG + Intergenic
904199691 1:28811951-28811973 CAAAGTGGCAAGGGGGTGGGAGG + Intergenic
907268049 1:53274763-53274785 AAGAGTGGCAAGCGCGTGGACGG - Intronic
907736757 1:57120911-57120933 AAAAGTGGCTGGTGTGTGGAAGG + Intronic
910207231 1:84759974-84759996 AAACCTGGCCAGCTGGTGGCAGG - Intergenic
910338045 1:86155821-86155843 AAGGGTCGCCAGCGGGGGGAAGG - Intronic
917950308 1:180025951-180025973 AAAAGTCTTCAGGGGGTGGAAGG + Intronic
918201096 1:182267642-182267664 AAATGTGGCCAGCGGCTTGTGGG - Intergenic
922160972 1:223078987-223079009 AGAAGAGGCCAGAGGGAGGAGGG + Intergenic
923494128 1:234509723-234509745 AAAAAAGGCCAGCAGGTAGATGG - Intergenic
924246929 1:242094282-242094304 ACAAGGGGGTAGCGGGTGGATGG - Intronic
924679547 1:246218470-246218492 AAAATTAGCCAGGGGGTGGCGGG + Intronic
1063887710 10:10596377-10596399 CAAAGTGGAGAGTGGGTGGATGG - Intergenic
1067800539 10:49355389-49355411 AAAGGTGGCCAGGGTGTGGTGGG - Intergenic
1068666725 10:59684259-59684281 AAAAGTCGCCTGACGGTGGATGG - Exonic
1069273154 10:66556084-66556106 AAAAGTGGCCACCAGGTGTATGG + Intronic
1070354586 10:75627303-75627325 CAAAGTGGGAAGCAGGTGGAAGG + Intronic
1072067422 10:91884506-91884528 AAATGTGGCCCCCGGGTAGAGGG + Intergenic
1072198588 10:93138443-93138465 AAAAGTTGCCAGGCTGTGGAAGG + Intergenic
1072608490 10:97001995-97002017 AGCAGTGCCCAGAGGGTGGAGGG + Intronic
1076379611 10:130015907-130015929 ACCAGTGGCCAGCGGAGGGATGG - Intergenic
1076542229 10:131221377-131221399 AAAAGTGCCCAGTGGGAGGTGGG + Intronic
1077884971 11:6380678-6380700 AAATGTGTCCAGCAGGTGAATGG + Intergenic
1077944925 11:6886733-6886755 AAAAGTGGCCAGTGGGAGGGAGG + Intergenic
1078846106 11:15119634-15119656 AAATGTGGCCTGTGGTTGGAGGG + Intronic
1085076783 11:73598359-73598381 AAAATTCGCCAGCGGATGGTTGG - Intergenic
1087001948 11:93430136-93430158 AACAGTAGCCAGAGGGTGGCAGG - Intronic
1089861692 11:121595789-121595811 AAACGTGCCCAGGGGGTGAAGGG - Intronic
1090250906 11:125251047-125251069 AGAAGCTGCCAGGGGGTGGAGGG - Intronic
1090772971 11:129938082-129938104 AGAAGTAGCCAGTGGGTGGGCGG - Intronic
1092148113 12:6228779-6228801 AAAAGTAGCCAGGGTGTGGCTGG - Intronic
1092190634 12:6517450-6517472 AAAACTGGCCAGCAGCTGGATGG - Exonic
1092857894 12:12692261-12692283 ATAAGTGGCCAGCTGGTCAAAGG - Intronic
1095981053 12:47975083-47975105 AGCAGTGCCCAGCTGGTGGATGG + Intronic
1096159960 12:49367733-49367755 CGAAGTGCCCAGAGGGTGGAAGG + Intronic
1096933027 12:55236922-55236944 AAAGGTGGACAGCTGGAGGAGGG + Intergenic
1098429567 12:70405005-70405027 AAGAGTGGCCAGAGGGTGAAAGG + Intronic
1098836592 12:75430570-75430592 AAAATTGGCCACTGGTTGGAGGG + Intronic
1099806437 12:87526498-87526520 AAAACTGGCCAGTGGCTGGGAGG - Intergenic
1102345746 12:112160034-112160056 AAAAGTGGGCAGGGGATGTAGGG + Intergenic
1103407560 12:120686835-120686857 AAAGGTGGCCTGGGGGGGGAAGG - Intergenic
1104053459 12:125211669-125211691 AACCGTGTGCAGCGGGTGGAAGG - Intronic
1108640728 13:52380324-52380346 AAGAGTGGGCAGTGGGAGGACGG - Intronic
1110921150 13:81087593-81087615 AAAAATGGCCAGCAGGTATATGG + Intergenic
1112046142 13:95600317-95600339 AAAAGTGGAGAGCTGGTGGGGGG - Intronic
1113421433 13:110174383-110174405 AACAGTGGCCAGGGGATGGGAGG - Intronic
1114934213 14:27513537-27513559 AAAAGTTGCCAGTGGGTTGAGGG + Intergenic
1116619422 14:47180179-47180201 AACAGAGGCCAGAGGGTGGGAGG - Intronic
1117433798 14:55697407-55697429 AGAAGTGACCAGGGGGTGAATGG - Intronic
1128151754 15:65367621-65367643 GAGAGTGGCCAGCGGGTGGCGGG - Intronic
1129242566 15:74260219-74260241 AAAAGGGACCCGAGGGTGGAGGG + Intronic
1131432215 15:92395913-92395935 AAAAGTTCCCAGCATGTGGAAGG - Intronic
1131809759 15:96160694-96160716 AAAACTTGGGAGCGGGTGGAAGG + Intergenic
1132336964 15:101053875-101053897 CAGAGTGGCCAGAGGGTGAAAGG + Intronic
1135165845 16:20138584-20138606 AAAAGAAGCCACCAGGTGGAAGG + Intergenic
1135637598 16:24092183-24092205 AATAGTTGCCAGAGGCTGGAGGG - Intronic
1136184269 16:28576548-28576570 AAAAGTAGCCAGCGTGGTGATGG + Intronic
1136271193 16:29149183-29149205 CAAAGAGGCCAGCGTGAGGAAGG + Intergenic
1141138754 16:81483617-81483639 AACAGTGGGCAGCTGGGGGAGGG - Intronic
1141849020 16:86631341-86631363 AAAAGTGGGAAGCGGGTGAGCGG + Intergenic
1141927231 16:87177753-87177775 AAAGGTCGCCAGCTGTTGGAGGG - Intronic
1143434575 17:6914194-6914216 AAAAGTGGGCTGCGAGTGCAGGG + Intronic
1145861059 17:28210748-28210770 AAAAGTGGGCAGGGGGAGCAAGG - Intergenic
1146497863 17:33338898-33338920 GAAAGTTGCCAGGGGCTGGAGGG + Intronic
1146579556 17:34024687-34024709 AAACCTGGCCAGCGTGGGGAGGG + Intronic
1146582891 17:34055106-34055128 TAAAGTGGCCAGCAGTTAGATGG + Intronic
1148194266 17:45701909-45701931 AAGAGTGGGCAGAGTGTGGAAGG + Intergenic
1149442657 17:56688009-56688031 ATTAGTGGACAGAGGGTGGATGG + Intergenic
1152631328 17:81411855-81411877 AAGAGTGACCAGGGTGTGGAGGG - Intronic
1157785044 18:50474178-50474200 CAAAATGACCAGTGGGTGGATGG + Intergenic
1159904693 18:74078628-74078650 GAAAGGGGCCAGTGGGAGGAAGG - Intronic
1160391980 18:78540739-78540761 AAAACTGGCCTGCGGGAGCATGG + Intergenic
1164946295 19:32295850-32295872 AAAAGTGGCCAGGAGGTAGCAGG - Intergenic
1165837570 19:38768929-38768951 AAAACCGTCCAGTGGGTGGAGGG + Intronic
1166582768 19:43916911-43916933 AAAAGTGGCCAGGGGATCTAGGG + Intronic
1167316922 19:48769279-48769301 AAAAGTGGCCAGGAGCTGAAGGG - Intergenic
1168700661 19:58437494-58437516 AAAATTGGCCAGCAGGAGGGAGG - Intronic
925145911 2:1583272-1583294 AAGAGTGACCAGCGGGAGGGAGG - Intergenic
929100584 2:38308458-38308480 AAAGGTAGTCAGAGGGTGGAGGG + Intronic
930641968 2:53862461-53862483 AAAAGTGGCCTGCGGCTTAAAGG + Intergenic
931382347 2:61765183-61765205 AATAGTGGCCAGAGGGGGGCCGG - Intergenic
932112091 2:69011117-69011139 GAATGTGGAAAGCGGGTGGAGGG - Intergenic
934522346 2:95027150-95027172 AAAGGAGGCCAGCGGGGGGCTGG - Intronic
936481780 2:112891441-112891463 GAAAGAGGCCAGCTGGTGGTAGG + Intergenic
937062719 2:118992342-118992364 ATGAGTGGGGAGCGGGTGGAGGG - Intronic
937213845 2:120297769-120297791 AAAAATGGCGAGGGGGTGAAGGG - Intergenic
938371450 2:130771174-130771196 AACAGTGGTCAGTGGGTGGGAGG - Intergenic
938955688 2:136295955-136295977 AAAAGTGGTTAAGGGGTGGAAGG - Intergenic
944518374 2:200536642-200536664 AAAACTGGACAGCAGGTAGATGG + Intronic
948395301 2:237640864-237640886 AAGAGAGGCCAGGGGTTGGAAGG - Intronic
1169122703 20:3106962-3106984 AAAAGTGCCCAGCCGCTGGGAGG + Intergenic
1169435328 20:5582548-5582570 AAAGGTGGAAAGCGGGTGGGCGG - Intronic
1171237440 20:23539143-23539165 AAAAGTGGGAAGCAGGAGGAGGG - Intergenic
1172412144 20:34732946-34732968 AAAAGTGGCAACAAGGTGGATGG - Intronic
1174157935 20:48528683-48528705 GAAAGAGACCAGCAGGTGGAAGG + Intergenic
1174203950 20:48826341-48826363 AAAAGTGGCCAGCGGGTGGAGGG - Intronic
1176385952 21:6138610-6138632 AGAGGGGGCCGGCGGGTGGATGG + Intergenic
1177514554 21:22131896-22131918 GAAAGTGAGCAGCCGGTGGAAGG + Intergenic
1179737521 21:43399642-43399664 AGAGGGGGCCGGCGGGTGGATGG - Intergenic
1181637717 22:24182006-24182028 ATAAGTGGCAAGAGGGTCGATGG - Intronic
1183741172 22:39669470-39669492 ATAAGTGGCTGGTGGGTGGATGG + Intronic
1183879518 22:40815315-40815337 AAAACTGGCCATGGGCTGGAGGG + Intronic
1184406684 22:44304536-44304558 CAGAGAGGCCTGCGGGTGGATGG - Intronic
1184478888 22:44736019-44736041 AAGAGTGGCCACCAGGTGGCGGG - Intronic
949416154 3:3816462-3816484 AAAAGTGGACTGAGGGTGGAGGG - Intronic
952957206 3:38564776-38564798 CAAGGTGGCCAGCGGCTGGTGGG + Intronic
953700507 3:45191931-45191953 AAAAAAGGCCAGTGGATGGAGGG - Intergenic
954144963 3:48629984-48630006 AACAGAGGGCAGCGGTTGGAGGG + Intronic
955179452 3:56653470-56653492 AAAAGTAGCCAGGGGGCGGCAGG + Intronic
956790664 3:72677594-72677616 AGAAGAGGCCAGCGGGTGAACGG - Intergenic
960055864 3:113275982-113276004 TGAAGAGGCCAGCAGGTGGAGGG - Intronic
961797849 3:129422575-129422597 AAGAGTGCCCAGGGTGTGGATGG - Intronic
964878292 3:161394733-161394755 AGAAGTGGGCAACTGGTGGAGGG + Intergenic
964881035 3:161423183-161423205 ACAAGAGGCCGGAGGGTGGAAGG - Intergenic
966194106 3:177296976-177296998 AAAAGTGGTCAGCGAAGGGAAGG - Intergenic
966973148 3:185063566-185063588 ACAAATGGCCAGCAGGTGTATGG + Intergenic
967508147 3:190277534-190277556 GAAAGTGGACAGTGGGAGGAGGG - Intergenic
968479965 4:828921-828943 GAAAGGGGCCAGCAGGTTGAAGG + Intergenic
969182413 4:5452264-5452286 CAGAGAGGCCAGCGAGTGGAGGG + Intronic
970120435 4:12747108-12747130 CAAAGTGGACAGTGGGTGGGAGG - Intergenic
970292306 4:14586617-14586639 AAAAGTGGCCAGTGTAGGGACGG + Intergenic
971924249 4:32986264-32986286 AAAAGTGTCCAGATGGTGCATGG + Intergenic
975255276 4:72227630-72227652 AAAAATGGGCAGCAGGGGGATGG + Intergenic
980005624 4:127538985-127539007 AAAAGTTGCCACCGGGGGGCAGG - Intergenic
983409892 4:167382908-167382930 AAAATTAGCCAGCTGGTGGCAGG - Intergenic
984583281 4:181534741-181534763 AACAGTGAACGGCGGGTGGAGGG - Intergenic
984964209 4:185127090-185127112 AAAAGTGGCAAGCGGGGGAGGGG - Intergenic
986384237 5:7216204-7216226 AAGAGTGGGCATGGGGTGGAGGG + Intergenic
988323907 5:29737617-29737639 AAAAGAGGCCAGCAGCTGGGGGG - Intergenic
990014230 5:51039447-51039469 GAAAGTGGGGAGGGGGTGGAAGG - Intergenic
991423348 5:66464276-66464298 AATAGTGGGCAGGGGGTGGGAGG + Intergenic
994140554 5:96336176-96336198 AATAGGGGGCAGCGGGTGGTAGG - Intergenic
994525638 5:100902110-100902132 CACAGAGGCCAGCGGGTGGAAGG + Intronic
995832140 5:116364967-116364989 AAAAATGGGCTGAGGGTGGAGGG - Intronic
997179192 5:131811029-131811051 AGAAGTGGCCAGAGGTTGAAAGG + Intronic
997366955 5:133331908-133331930 AAATGTGGGCAGCCCGTGGAGGG + Intronic
997639904 5:135442335-135442357 AAAAGTGGCTTGGGGGAGGAAGG + Intergenic
998657143 5:144194023-144194045 AAAAATGCCCAGCAGGTGTATGG + Intronic
1001173396 5:169442934-169442956 AAAAGCGGGTAGGGGGTGGAGGG + Intergenic
1002493936 5:179599268-179599290 CAGAGTGGGCAGCTGGTGGAGGG + Intronic
1004294467 6:14397597-14397619 ACAAGTGGCCAGCGGGTACTGGG + Intergenic
1004320617 6:14628819-14628841 GACAATGGCCAGCGAGTGGAGGG - Intergenic
1006055329 6:31379680-31379702 CATAGTTGCCAGAGGGTGGAAGG + Intergenic
1006931578 6:37692183-37692205 AGATGTGGCCAGCAGGGGGAGGG - Intronic
1007202235 6:40119489-40119511 AAAAGTGGAAAGGTGGTGGATGG - Intergenic
1007547212 6:42703634-42703656 AACAGTTGCCAGGGGCTGGAGGG + Intronic
1007766386 6:44162690-44162712 AAAAGGGGCCACCAGGTTGATGG - Intronic
1010006899 6:71005389-71005411 AAAAATGGCCAACGGGTATATGG - Intergenic
1012245510 6:96922126-96922148 AAAAGTGGACACTGGGTGGCTGG - Intergenic
1013178755 6:107700416-107700438 AGAAGCTGCCTGCGGGTGGATGG + Intergenic
1013480332 6:110547432-110547454 AAATGTGGCATGGGGGTGGAGGG - Intergenic
1014035363 6:116761202-116761224 AAAAGTGACCAGTAGATGGAAGG + Intronic
1014827604 6:126064188-126064210 AAAGGTGGGCATGGGGTGGAGGG + Intergenic
1015706056 6:136088880-136088902 AAAATTTGGCAGGGGGTGGAGGG + Intronic
1016697675 6:147016824-147016846 AAAGGTGGTAAGTGGGTGGATGG + Intergenic
1017643558 6:156517527-156517549 AAAAGTGGGCAGGGGGTGTCAGG + Intergenic
1017882865 6:158573642-158573664 AGAAGTGTCCACAGGGTGGATGG + Intronic
1019013394 6:168861207-168861229 AAACGTGGCCGGCGGAGGGAAGG - Intergenic
1019264593 7:106776-106798 AATAGTGGGGGGCGGGTGGAGGG + Intergenic
1021602304 7:22376538-22376560 AAAAGTGGCCAGACTGCGGAGGG + Intergenic
1021839691 7:24712636-24712658 CAGAGTGACCAGCGGGTGGAGGG + Intronic
1023170509 7:37386359-37386381 AAAAGGGGGCAGGGGCTGGAGGG + Intronic
1023876104 7:44287101-44287123 GAAGGTGGCCAGCTGGGGGAAGG + Intronic
1025021547 7:55484343-55484365 AAGACTGGCAAGGGGGTGGAAGG - Intronic
1031330812 7:120461436-120461458 AAACGTGGCTAGGGGATGGAGGG - Intronic
1032931054 7:136671441-136671463 AAAATTAGCCAGGTGGTGGAAGG - Intergenic
1032963155 7:137063994-137064016 ATCAGTGGCCAGAGGGTGGAGGG + Intergenic
1033591823 7:142815105-142815127 GAAAGTGGACAGTGGGTGGTGGG + Intergenic
1035908203 8:3536750-3536772 AAAAGTGTCCATTGTGTGGAAGG + Intronic
1036657131 8:10683917-10683939 AACAGGGGCCAGCCGGTGGAAGG - Intronic
1041792055 8:61707675-61707697 AAAAGTGGCCTGCGATAGGATGG + Intronic
1042186683 8:66142760-66142782 CAAAGGGGCCAGCTGGTGGAGGG + Intronic
1045974845 8:108120659-108120681 AAGAATTGCCAGAGGGTGGATGG - Intergenic
1048822926 8:138396269-138396291 AGCAGTGGCCAGCGTGTGGCAGG + Intronic
1049208656 8:141375267-141375289 AGAAGGGACCAGCGGGTGGCCGG + Intergenic
1050201748 9:3152135-3152157 ACACGGGGCCAGGGGGTGGATGG + Intergenic
1058781161 9:108336946-108336968 GAAAGTGGCAAGGGAGTGGAGGG + Intergenic
1060980786 9:127790460-127790482 GAAAGTGGGCAGAGGGTGAAGGG + Exonic
1061974283 9:134060646-134060668 CAAAGTAGCCAGCGGGGAGAGGG + Intronic
1062113841 9:134797007-134797029 CACAGTGGCCGGTGGGTGGAGGG + Intronic
1186434777 X:9533352-9533374 AAAAGTGGGGAGGGGGAGGAAGG - Intronic
1188284726 X:28313729-28313751 AAAAGTGGCAAGAGGAAGGAGGG - Intergenic
1195128415 X:101831353-101831375 AAAAGTGGCAAGTGGTAGGAAGG + Intergenic
1195177782 X:102327480-102327502 AAAAGTGGCAAGTGGTAGGAAGG - Intergenic
1195181082 X:102359613-102359635 AAAAGTGGCAAGTGGTAGGAAGG + Intergenic
1196046348 X:111260216-111260238 AGAAGTGGCAAGTGGGAGGAGGG + Intronic
1197178978 X:123513915-123513937 AATAGTGGGAAGCGGGTGGGAGG - Intergenic
1199595247 X:149501831-149501853 GAAAGAGGGCAGCGGGTGGAGGG + Intronic
1200240898 X:154493022-154493044 AAAATTGGCCAGAGGGAGAAAGG + Intergenic