ID: 1174204185

View in Genome Browser
Species Human (GRCh38)
Location 20:48827521-48827543
Sequence TTGCCTCGGGGGCGCCCCGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 75
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 67}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174204185_1174204198 13 Left 1174204185 20:48827521-48827543 CCTGCGGGGCGCCCCCGAGGCAA 0: 1
1: 0
2: 1
3: 6
4: 67
Right 1174204198 20:48827557-48827579 GGGACCACGGCCACAGGTTGTGG 0: 1
1: 0
2: 0
3: 13
4: 127
1174204185_1174204196 7 Left 1174204185 20:48827521-48827543 CCTGCGGGGCGCCCCCGAGGCAA 0: 1
1: 0
2: 1
3: 6
4: 67
Right 1174204196 20:48827551-48827573 CCCACGGGGACCACGGCCACAGG 0: 1
1: 0
2: 1
3: 8
4: 106
1174204185_1174204204 26 Left 1174204185 20:48827521-48827543 CCTGCGGGGCGCCCCCGAGGCAA 0: 1
1: 0
2: 1
3: 6
4: 67
Right 1174204204 20:48827570-48827592 CAGGTTGTGGGGACCGCAGCGGG 0: 1
1: 0
2: 1
3: 13
4: 156
1174204185_1174204203 25 Left 1174204185 20:48827521-48827543 CCTGCGGGGCGCCCCCGAGGCAA 0: 1
1: 0
2: 1
3: 6
4: 67
Right 1174204203 20:48827569-48827591 ACAGGTTGTGGGGACCGCAGCGG 0: 1
1: 0
2: 0
3: 19
4: 168
1174204185_1174204199 14 Left 1174204185 20:48827521-48827543 CCTGCGGGGCGCCCCCGAGGCAA 0: 1
1: 0
2: 1
3: 6
4: 67
Right 1174204199 20:48827558-48827580 GGACCACGGCCACAGGTTGTGGG 0: 1
1: 0
2: 0
3: 11
4: 66
1174204185_1174204191 -8 Left 1174204185 20:48827521-48827543 CCTGCGGGGCGCCCCCGAGGCAA 0: 1
1: 0
2: 1
3: 6
4: 67
Right 1174204191 20:48827536-48827558 CGAGGCAATTCTCCACCCACGGG 0: 1
1: 0
2: 5
3: 5
4: 70
1174204185_1174204190 -9 Left 1174204185 20:48827521-48827543 CCTGCGGGGCGCCCCCGAGGCAA 0: 1
1: 0
2: 1
3: 6
4: 67
Right 1174204190 20:48827535-48827557 CCGAGGCAATTCTCCACCCACGG 0: 1
1: 0
2: 0
3: 4
4: 73
1174204185_1174204200 15 Left 1174204185 20:48827521-48827543 CCTGCGGGGCGCCCCCGAGGCAA 0: 1
1: 0
2: 1
3: 6
4: 67
Right 1174204200 20:48827559-48827581 GACCACGGCCACAGGTTGTGGGG 0: 1
1: 0
2: 1
3: 10
4: 96
1174204185_1174204205 27 Left 1174204185 20:48827521-48827543 CCTGCGGGGCGCCCCCGAGGCAA 0: 1
1: 0
2: 1
3: 6
4: 67
Right 1174204205 20:48827571-48827593 AGGTTGTGGGGACCGCAGCGGGG 0: 1
1: 0
2: 0
3: 10
4: 106
1174204185_1174204193 0 Left 1174204185 20:48827521-48827543 CCTGCGGGGCGCCCCCGAGGCAA 0: 1
1: 0
2: 1
3: 6
4: 67
Right 1174204193 20:48827544-48827566 TTCTCCACCCACGGGGACCACGG 0: 1
1: 0
2: 3
3: 6
4: 139
1174204185_1174204192 -7 Left 1174204185 20:48827521-48827543 CCTGCGGGGCGCCCCCGAGGCAA 0: 1
1: 0
2: 1
3: 6
4: 67
Right 1174204192 20:48827537-48827559 GAGGCAATTCTCCACCCACGGGG 0: 1
1: 0
2: 0
3: 10
4: 69

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174204185 Original CRISPR TTGCCTCGGGGGCGCCCCGC AGG (reversed) Intronic
900487202 1:2928630-2928652 GTGCATCGGGGGCTCCCAGCTGG + Intergenic
902400931 1:16156223-16156245 TGGACTCGCGGGCTCCCCGCAGG + Intergenic
911114917 1:94237289-94237311 TCCACTCGGGGCCGCCCCGCGGG + Intronic
915355002 1:155250621-155250643 TTTCCTCGAAGGGGCCCCGCAGG + Exonic
1067853292 10:49768927-49768949 CTGCCGCGGCCGCGCCCCGCTGG + Intergenic
1084019676 11:66410070-66410092 TTGACTCTGGGGAGCCCTGCCGG - Intergenic
1084557663 11:69884478-69884500 TTGCCTGGGGGCGGCCCCACTGG + Intergenic
1086700602 11:89896898-89896920 CTGCCGCGGGGGCGCGCCCCAGG - Intergenic
1086705567 11:89947628-89947650 CTGCCGCGGGGGCGCGCCCCAGG + Intergenic
1089273204 11:117315678-117315700 CGGCCTGGGGGGCGCCCCCCTGG - Exonic
1089494711 11:118902290-118902312 GAGCCTAGGGGGCCCCCCGCTGG - Exonic
1091312386 11:134584013-134584035 TTGCATCGGGGGCTGCACGCAGG - Intergenic
1103894414 12:124263668-124263690 TTGCCTCAGGGGCCCCTCCCTGG + Intronic
1117315282 14:54566578-54566600 TCCCCGCGGGGCCGCCCCGCTGG + Intergenic
1121098524 14:91234069-91234091 AGGCCTCGGGGGCACCCAGCGGG + Exonic
1122464884 14:101925270-101925292 TAGCCTCCGGGGCGCCGCGTCGG + Exonic
1123049251 14:105532684-105532706 TGGCCTCGAGGGAGGCCCGCAGG + Intergenic
1123799131 15:23803015-23803037 TTGCCTGGGGCCCGCACCGCCGG - Intergenic
1129301768 15:74629620-74629642 TTGCCTCTGGGACGCCTTGCTGG - Intronic
1141675452 16:85515104-85515126 TTGCCTCCTGGGCTCCCCGGAGG - Intergenic
1147179101 17:38673829-38673851 GAGCCTCGGGGGCGGCCGGCGGG + Exonic
1152892493 17:82890474-82890496 TTGCCTGGAGGGCTCCCCACAGG - Intronic
1158202867 18:54959464-54959486 CTGCCCTGGGCGCGCCCCGCGGG - Exonic
1160897299 19:1408622-1408644 TTGCCTCGGCGCCTCCCCGCCGG + Intronic
1161856226 19:6767397-6767419 CAGCCTCGTGGGAGCCCCGCGGG - Exonic
1165166236 19:33859171-33859193 TTGCCACGGGGGAGGCGCGCGGG - Intergenic
1165312041 19:35034292-35034314 CTGCCCCGGGGGAGCCGCGCTGG + Intronic
1165420269 19:35718761-35718783 TTACCTGTGGGCCGCCCCGCCGG + Intronic
1166049494 19:40249489-40249511 TTCTCTCTGGGGTGCCCCGCAGG - Intronic
1166106798 19:40601599-40601621 TCCCCCCGGGGCCGCCCCGCCGG - Intronic
1168658942 19:58150902-58150924 TTGCCTCGGGGCGGACGCGCAGG + Intronic
934321377 2:91974727-91974749 TCGCCGCGGGGGCGCGCAGCAGG + Intergenic
934580715 2:95435413-95435435 CTGCCGCGGGGGCGCGCCCCAGG + Intergenic
934598736 2:95641304-95641326 CTGCCGCGGGGGCGCGCCCCAGG - Intergenic
935149035 2:100417416-100417438 TGGCCCTGGGGGCGCCGCGCGGG + Exonic
944632757 2:201643410-201643432 TTGCGCCGGGGCAGCCCCGCGGG - Exonic
948658845 2:239494208-239494230 TTGTCCTGGGGACGCCCCGCTGG + Intergenic
948828696 2:240586857-240586879 TTGCCTCGGGGTCGCAGCCCCGG - Exonic
1168800642 20:642032-642054 TTGCCTGGGGGGGGCCCAGCGGG + Intergenic
1168800671 20:642095-642117 TTGCCTGGGGGGGGCCCAGCGGG + Intergenic
1168800737 20:642225-642247 TTGCCTGGGGGGGGCCCAGCGGG + Intergenic
1168800779 20:642316-642338 TTGCCTGGGGGGGGGCCAGCGGG + Intergenic
1172474520 20:35226870-35226892 CTGCCTCCCGGGCGCCGCGCGGG + Exonic
1172667953 20:36613786-36613808 TTGCCTCTGGGGTGCCCAGGAGG + Exonic
1172767709 20:37359568-37359590 CTGCCTCGGGGTCTCCCCACTGG - Intronic
1174204185 20:48827521-48827543 TTGCCTCGGGGGCGCCCCGCAGG - Intronic
1175216559 20:57394416-57394438 GTGACTCGGGGGCTCCCTGCCGG + Intronic
1179525964 21:41976028-41976050 TTGCCTCAGGAGGGCCCTGCAGG - Intergenic
1181510556 22:23386976-23386998 TCCCCTCGGGGGTGCCCCACAGG + Intergenic
1183250339 22:36725808-36725830 TTGCCTCTGGGCGGCCCCACGGG + Intergenic
1184759827 22:46537817-46537839 TTGCCTCGGCCCCGCCCCACCGG - Intergenic
1184766845 22:46576753-46576775 TGGCCTCGCCCGCGCCCCGCGGG - Intronic
950531344 3:13553896-13553918 GTGAATCGGGGGCGCCCCCCTGG + Intronic
952905463 3:38136939-38136961 TTGCCTGAGCGGTGCCCCGCAGG - Exonic
953589969 3:44242031-44242053 GTGCCCCGGGGCCGGCCCGCTGG - Exonic
976595609 4:86892362-86892384 ACGCCTCGGGGCCGCGCCGCAGG + Intronic
992067376 5:73120429-73120451 TTCCCTCGCGGGCGCGCCCCGGG + Exonic
992320792 5:75611641-75611663 TGGCCCCGGGCGCGCCCGGCGGG - Exonic
997293767 5:132756781-132756803 ATGCCTGGGGTGCGACCCGCAGG + Intronic
997539313 5:134648664-134648686 TGGCCTCGGGGCAGCCCGGCTGG + Intronic
1015155340 6:130088675-130088697 TTGCCTCTGGGGAGCCAGGCTGG - Intronic
1019206990 6:170370193-170370215 AGGCCTGGGGGCCGCCCCGCTGG - Intronic
1028160160 7:87475874-87475896 TTGCCGCCGGGGCGCCCGGCTGG + Intronic
1035520433 8:272003-272025 TGGCCTCTGGGGCGCCCCGCAGG - Intergenic
1038612828 8:29070620-29070642 GGGCCTCGGGGGCACCCAGCCGG + Exonic
1049988561 9:972777-972799 TAGCCTGGGGCGCTCCCCGCTGG - Intergenic
1054805317 9:69391709-69391731 TCGGCTCGGGGCCTCCCCGCTGG - Exonic
1057600173 9:96450600-96450622 TAGCCCCGGGGGCGGCCTGCAGG + Exonic
1058153440 9:101486635-101486657 GTGTCTCGGGGGCGCCTCCCTGG - Intronic
1060196085 9:121624214-121624236 CTGCCTCTGGGCAGCCCCGCTGG - Intronic
1060988704 9:127836151-127836173 TTGCCTCTGGGGCCCCCGGCCGG - Intronic
1061796455 9:133088316-133088338 TTGCCTGGGGGGCTCCGCGGTGG + Intergenic
1062506797 9:136881765-136881787 TTGCCCTGGGGGAGCCCCCCTGG + Intronic
1185761332 X:2691500-2691522 CGGCGTTGGGGGCGCCCCGCGGG + Intronic
1192561501 X:72130979-72131001 TTTCCCCGGGGGCGCCGAGCGGG - Exonic