ID: 1174204419

View in Genome Browser
Species Human (GRCh38)
Location 20:48828256-48828278
Sequence TGCGCGCGGCCTCGGACTCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174204419_1174204426 17 Left 1174204419 20:48828256-48828278 CCGGGAGTCCGAGGCCGCGCGCA No data
Right 1174204426 20:48828296-48828318 CAACTCCGCGCCCGGACGCGTGG No data
1174204419_1174204424 9 Left 1174204419 20:48828256-48828278 CCGGGAGTCCGAGGCCGCGCGCA No data
Right 1174204424 20:48828288-48828310 GAGCGTACCAACTCCGCGCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174204419 Original CRISPR TGCGCGCGGCCTCGGACTCC CGG (reversed) Intergenic