ID: 1174204424

View in Genome Browser
Species Human (GRCh38)
Location 20:48828288-48828310
Sequence GAGCGTACCAACTCCGCGCC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174204415_1174204424 19 Left 1174204415 20:48828246-48828268 CCCCGCGGAGCCGGGAGTCCGAG No data
Right 1174204424 20:48828288-48828310 GAGCGTACCAACTCCGCGCCCGG No data
1174204421_1174204424 -5 Left 1174204421 20:48828270-48828292 CCGCGCGCACGCCGAACCGAGCG No data
Right 1174204424 20:48828288-48828310 GAGCGTACCAACTCCGCGCCCGG No data
1174204418_1174204424 17 Left 1174204418 20:48828248-48828270 CCGCGGAGCCGGGAGTCCGAGGC No data
Right 1174204424 20:48828288-48828310 GAGCGTACCAACTCCGCGCCCGG No data
1174204412_1174204424 28 Left 1174204412 20:48828237-48828259 CCGGAAGGGCCCCGCGGAGCCGG No data
Right 1174204424 20:48828288-48828310 GAGCGTACCAACTCCGCGCCCGG No data
1174204419_1174204424 9 Left 1174204419 20:48828256-48828278 CCGGGAGTCCGAGGCCGCGCGCA No data
Right 1174204424 20:48828288-48828310 GAGCGTACCAACTCCGCGCCCGG No data
1174204416_1174204424 18 Left 1174204416 20:48828247-48828269 CCCGCGGAGCCGGGAGTCCGAGG No data
Right 1174204424 20:48828288-48828310 GAGCGTACCAACTCCGCGCCCGG No data
1174204420_1174204424 1 Left 1174204420 20:48828264-48828286 CCGAGGCCGCGCGCACGCCGAAC No data
Right 1174204424 20:48828288-48828310 GAGCGTACCAACTCCGCGCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174204424 Original CRISPR GAGCGTACCAACTCCGCGCC CGG Intergenic