ID: 1174207033

View in Genome Browser
Species Human (GRCh38)
Location 20:48847782-48847804
Sequence CTGACTGGAAGGGGACCCGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174207033_1174207046 27 Left 1174207033 20:48847782-48847804 CCCCCGGGTCCCCTTCCAGTCAG No data
Right 1174207046 20:48847832-48847854 AGTTTTGCCTGCCATGTAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174207033 Original CRISPR CTGACTGGAAGGGGACCCGG GGG (reversed) Intergenic
No off target data available for this crispr