ID: 1174208374

View in Genome Browser
Species Human (GRCh38)
Location 20:48857681-48857703
Sequence CAGGATCACTTGAACCAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174208367_1174208374 11 Left 1174208367 20:48857647-48857669 CCTGTGGTCCCAATTACTCGGGA 0: 5
1: 200
2: 5844
3: 81209
4: 210084
Right 1174208374 20:48857681-48857703 CAGGATCACTTGAACCAAGAAGG No data
1174208369_1174208374 3 Left 1174208369 20:48857655-48857677 CCCAATTACTCGGGAGGCTGAGG 0: 75
1: 4779
2: 120798
3: 304980
4: 220340
Right 1174208374 20:48857681-48857703 CAGGATCACTTGAACCAAGAAGG No data
1174208371_1174208374 2 Left 1174208371 20:48857656-48857678 CCAATTACTCGGGAGGCTGAGGT 0: 13
1: 606
2: 14773
3: 156889
4: 317706
Right 1174208374 20:48857681-48857703 CAGGATCACTTGAACCAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174208374 Original CRISPR CAGGATCACTTGAACCAAGA AGG Intergenic
No off target data available for this crispr