ID: 1174209057

View in Genome Browser
Species Human (GRCh38)
Location 20:48862489-48862511
Sequence AGGCAGAACCTGCACATTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174209053_1174209057 1 Left 1174209053 20:48862465-48862487 CCCATTTTACAGAGAAGAAAACT 0: 12
1: 181
2: 1339
3: 4828
4: 11558
Right 1174209057 20:48862489-48862511 AGGCAGAACCTGCACATTGGTGG No data
1174209054_1174209057 0 Left 1174209054 20:48862466-48862488 CCATTTTACAGAGAAGAAAACTG 0: 11
1: 211
2: 1532
3: 5435
4: 12493
Right 1174209057 20:48862489-48862511 AGGCAGAACCTGCACATTGGTGG No data
1174209052_1174209057 25 Left 1174209052 20:48862441-48862463 CCAAGGAGATAGGCACTATTATA No data
Right 1174209057 20:48862489-48862511 AGGCAGAACCTGCACATTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174209057 Original CRISPR AGGCAGAACCTGCACATTGG TGG Intergenic
No off target data available for this crispr