ID: 1174209153

View in Genome Browser
Species Human (GRCh38)
Location 20:48863442-48863464
Sequence TTGTGGAGAAGGAGCGGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174209153_1174209165 3 Left 1174209153 20:48863442-48863464 CCCTCCCCGCTCCTTCTCCACAA No data
Right 1174209165 20:48863468-48863490 CCTGGCAACCACAGTTTTGTGGG No data
1174209153_1174209163 2 Left 1174209153 20:48863442-48863464 CCCTCCCCGCTCCTTCTCCACAA No data
Right 1174209163 20:48863467-48863489 CCCTGGCAACCACAGTTTTGTGG No data
1174209153_1174209166 4 Left 1174209153 20:48863442-48863464 CCCTCCCCGCTCCTTCTCCACAA No data
Right 1174209166 20:48863469-48863491 CTGGCAACCACAGTTTTGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174209153 Original CRISPR TTGTGGAGAAGGAGCGGGGA GGG (reversed) Intergenic
No off target data available for this crispr