ID: 1174211100

View in Genome Browser
Species Human (GRCh38)
Location 20:48878632-48878654
Sequence CAGAAAAAGGGGAATGTGGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174211100_1174211110 27 Left 1174211100 20:48878632-48878654 CCGGCCACATTCCCCTTTTTCTG No data
Right 1174211110 20:48878682-48878704 ACCTTCCTTCCATGTGTTTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174211100 Original CRISPR CAGAAAAAGGGGAATGTGGC CGG (reversed) Intergenic
No off target data available for this crispr