ID: 1174211278

View in Genome Browser
Species Human (GRCh38)
Location 20:48880463-48880485
Sequence CATTCTAAGGATAGTGAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174211278_1174211288 23 Left 1174211278 20:48880463-48880485 CCTGCCTCACTATCCTTAGAATG No data
Right 1174211288 20:48880509-48880531 TCGTGCTGCAGGATGACTGCAGG No data
1174211278_1174211285 12 Left 1174211278 20:48880463-48880485 CCTGCCTCACTATCCTTAGAATG No data
Right 1174211285 20:48880498-48880520 TAAAGTCCACCTCGTGCTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174211278 Original CRISPR CATTCTAAGGATAGTGAGGC AGG (reversed) Intergenic
No off target data available for this crispr