ID: 1174211285

View in Genome Browser
Species Human (GRCh38)
Location 20:48880498-48880520
Sequence TAAAGTCCACCTCGTGCTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174211281_1174211285 -1 Left 1174211281 20:48880476-48880498 CCTTAGAATGTGGCCTCCATCCT No data
Right 1174211285 20:48880498-48880520 TAAAGTCCACCTCGTGCTGCAGG No data
1174211280_1174211285 8 Left 1174211280 20:48880467-48880489 CCTCACTATCCTTAGAATGTGGC No data
Right 1174211285 20:48880498-48880520 TAAAGTCCACCTCGTGCTGCAGG No data
1174211278_1174211285 12 Left 1174211278 20:48880463-48880485 CCTGCCTCACTATCCTTAGAATG No data
Right 1174211285 20:48880498-48880520 TAAAGTCCACCTCGTGCTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174211285 Original CRISPR TAAAGTCCACCTCGTGCTGC AGG Intergenic
No off target data available for this crispr