ID: 1174211288

View in Genome Browser
Species Human (GRCh38)
Location 20:48880509-48880531
Sequence TCGTGCTGCAGGATGACTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174211283_1174211288 -6 Left 1174211283 20:48880492-48880514 CCATCCTAAAGTCCACCTCGTGC No data
Right 1174211288 20:48880509-48880531 TCGTGCTGCAGGATGACTGCAGG No data
1174211278_1174211288 23 Left 1174211278 20:48880463-48880485 CCTGCCTCACTATCCTTAGAATG No data
Right 1174211288 20:48880509-48880531 TCGTGCTGCAGGATGACTGCAGG No data
1174211281_1174211288 10 Left 1174211281 20:48880476-48880498 CCTTAGAATGTGGCCTCCATCCT No data
Right 1174211288 20:48880509-48880531 TCGTGCTGCAGGATGACTGCAGG No data
1174211280_1174211288 19 Left 1174211280 20:48880467-48880489 CCTCACTATCCTTAGAATGTGGC No data
Right 1174211288 20:48880509-48880531 TCGTGCTGCAGGATGACTGCAGG No data
1174211284_1174211288 -10 Left 1174211284 20:48880496-48880518 CCTAAAGTCCACCTCGTGCTGCA No data
Right 1174211288 20:48880509-48880531 TCGTGCTGCAGGATGACTGCAGG No data
1174211282_1174211288 -3 Left 1174211282 20:48880489-48880511 CCTCCATCCTAAAGTCCACCTCG No data
Right 1174211288 20:48880509-48880531 TCGTGCTGCAGGATGACTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174211288 Original CRISPR TCGTGCTGCAGGATGACTGC AGG Intergenic
No off target data available for this crispr