ID: 1174211316

View in Genome Browser
Species Human (GRCh38)
Location 20:48880742-48880764
Sequence GCTTATTTACTAGGAAAGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174211310_1174211316 -2 Left 1174211310 20:48880721-48880743 CCACCCCAAATAAAGTTCAGGGC No data
Right 1174211316 20:48880742-48880764 GCTTATTTACTAGGAAAGAAGGG No data
1174211311_1174211316 -5 Left 1174211311 20:48880724-48880746 CCCCAAATAAAGTTCAGGGCTTA No data
Right 1174211316 20:48880742-48880764 GCTTATTTACTAGGAAAGAAGGG No data
1174211313_1174211316 -7 Left 1174211313 20:48880726-48880748 CCAAATAAAGTTCAGGGCTTATT No data
Right 1174211316 20:48880742-48880764 GCTTATTTACTAGGAAAGAAGGG No data
1174211312_1174211316 -6 Left 1174211312 20:48880725-48880747 CCCAAATAAAGTTCAGGGCTTAT No data
Right 1174211316 20:48880742-48880764 GCTTATTTACTAGGAAAGAAGGG No data
1174211307_1174211316 5 Left 1174211307 20:48880714-48880736 CCTGATGCCACCCCAAATAAAGT No data
Right 1174211316 20:48880742-48880764 GCTTATTTACTAGGAAAGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174211316 Original CRISPR GCTTATTTACTAGGAAAGAA GGG Intergenic
No off target data available for this crispr