ID: 1174213737

View in Genome Browser
Species Human (GRCh38)
Location 20:48900193-48900215
Sequence CTGCAGGAATAATGGGAAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174213737_1174213744 -5 Left 1174213737 20:48900193-48900215 CCCTTTTCCCATTATTCCTGCAG No data
Right 1174213744 20:48900211-48900233 TGCAGGATTTCAAGTCTCAAGGG No data
1174213737_1174213746 6 Left 1174213737 20:48900193-48900215 CCCTTTTCCCATTATTCCTGCAG No data
Right 1174213746 20:48900222-48900244 AAGTCTCAAGGGAACAATTTGGG No data
1174213737_1174213745 5 Left 1174213737 20:48900193-48900215 CCCTTTTCCCATTATTCCTGCAG No data
Right 1174213745 20:48900221-48900243 CAAGTCTCAAGGGAACAATTTGG No data
1174213737_1174213743 -6 Left 1174213737 20:48900193-48900215 CCCTTTTCCCATTATTCCTGCAG No data
Right 1174213743 20:48900210-48900232 CTGCAGGATTTCAAGTCTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174213737 Original CRISPR CTGCAGGAATAATGGGAAAA GGG (reversed) Intergenic
No off target data available for this crispr