ID: 1174215097

View in Genome Browser
Species Human (GRCh38)
Location 20:48910520-48910542
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174215095_1174215097 13 Left 1174215095 20:48910484-48910506 CCAGAACTTTCTGGAAAAAGGGT No data
Right 1174215097 20:48910520-48910542 AACCATATAAAGTAACTTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174215097 Original CRISPR AACCATATAAAGTAACTTCC TGG Intergenic
No off target data available for this crispr