ID: 1174215322

View in Genome Browser
Species Human (GRCh38)
Location 20:48911977-48911999
Sequence TCTGGGGAACCTAACTGTAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174215322_1174215330 12 Left 1174215322 20:48911977-48911999 CCACTACAGTTAGGTTCCCCAGA No data
Right 1174215330 20:48912012-48912034 GACAAGGATTTGGGTGCAAATGG No data
1174215322_1174215332 22 Left 1174215322 20:48911977-48911999 CCACTACAGTTAGGTTCCCCAGA No data
Right 1174215332 20:48912022-48912044 TGGGTGCAAATGGTTTATTTGGG No data
1174215322_1174215331 21 Left 1174215322 20:48911977-48911999 CCACTACAGTTAGGTTCCCCAGA No data
Right 1174215331 20:48912021-48912043 TTGGGTGCAAATGGTTTATTTGG No data
1174215322_1174215334 24 Left 1174215322 20:48911977-48911999 CCACTACAGTTAGGTTCCCCAGA No data
Right 1174215334 20:48912024-48912046 GGTGCAAATGGTTTATTTGGGGG No data
1174215322_1174215326 -4 Left 1174215322 20:48911977-48911999 CCACTACAGTTAGGTTCCCCAGA No data
Right 1174215326 20:48911996-48912018 CAGAAGCACATCCTCAGACAAGG No data
1174215322_1174215327 2 Left 1174215322 20:48911977-48911999 CCACTACAGTTAGGTTCCCCAGA No data
Right 1174215327 20:48912002-48912024 CACATCCTCAGACAAGGATTTGG No data
1174215322_1174215328 3 Left 1174215322 20:48911977-48911999 CCACTACAGTTAGGTTCCCCAGA No data
Right 1174215328 20:48912003-48912025 ACATCCTCAGACAAGGATTTGGG No data
1174215322_1174215333 23 Left 1174215322 20:48911977-48911999 CCACTACAGTTAGGTTCCCCAGA No data
Right 1174215333 20:48912023-48912045 GGGTGCAAATGGTTTATTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174215322 Original CRISPR TCTGGGGAACCTAACTGTAG TGG (reversed) Intergenic
No off target data available for this crispr