ID: 1174216727

View in Genome Browser
Species Human (GRCh38)
Location 20:48921705-48921727
Sequence GCGTCACGTGACCACGTGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 215
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 207}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174216727_1174216729 -8 Left 1174216727 20:48921705-48921727 CCAGTCACGTGGTCACGTGACGC 0: 1
1: 0
2: 0
3: 7
4: 207
Right 1174216729 20:48921720-48921742 CGTGACGCGCTCCAACATGGCGG 0: 1
1: 0
2: 0
3: 1
4: 18
1174216727_1174216730 0 Left 1174216727 20:48921705-48921727 CCAGTCACGTGGTCACGTGACGC 0: 1
1: 0
2: 0
3: 7
4: 207
Right 1174216730 20:48921728-48921750 GCTCCAACATGGCGGCGCCGTGG 0: 1
1: 0
2: 4
3: 9
4: 62
1174216727_1174216732 2 Left 1174216727 20:48921705-48921727 CCAGTCACGTGGTCACGTGACGC 0: 1
1: 0
2: 0
3: 7
4: 207
Right 1174216732 20:48921730-48921752 TCCAACATGGCGGCGCCGTGGGG 0: 1
1: 0
2: 2
3: 6
4: 38
1174216727_1174216734 8 Left 1174216727 20:48921705-48921727 CCAGTCACGTGGTCACGTGACGC 0: 1
1: 0
2: 0
3: 7
4: 207
Right 1174216734 20:48921736-48921758 ATGGCGGCGCCGTGGGGCCGAGG 0: 1
1: 0
2: 1
3: 9
4: 173
1174216727_1174216739 26 Left 1174216727 20:48921705-48921727 CCAGTCACGTGGTCACGTGACGC 0: 1
1: 0
2: 0
3: 7
4: 207
Right 1174216739 20:48921754-48921776 CGAGGTGTCGCTTCCTGACGGGG 0: 1
1: 0
2: 0
3: 2
4: 36
1174216727_1174216731 1 Left 1174216727 20:48921705-48921727 CCAGTCACGTGGTCACGTGACGC 0: 1
1: 0
2: 0
3: 7
4: 207
Right 1174216731 20:48921729-48921751 CTCCAACATGGCGGCGCCGTGGG 0: 1
1: 0
2: 1
3: 10
4: 42
1174216727_1174216738 25 Left 1174216727 20:48921705-48921727 CCAGTCACGTGGTCACGTGACGC 0: 1
1: 0
2: 0
3: 7
4: 207
Right 1174216738 20:48921753-48921775 CCGAGGTGTCGCTTCCTGACGGG 0: 1
1: 0
2: 0
3: 3
4: 40
1174216727_1174216736 24 Left 1174216727 20:48921705-48921727 CCAGTCACGTGGTCACGTGACGC 0: 1
1: 0
2: 0
3: 7
4: 207
Right 1174216736 20:48921752-48921774 GCCGAGGTGTCGCTTCCTGACGG 0: 1
1: 0
2: 1
3: 1
4: 75
1174216727_1174216740 29 Left 1174216727 20:48921705-48921727 CCAGTCACGTGGTCACGTGACGC 0: 1
1: 0
2: 0
3: 7
4: 207
Right 1174216740 20:48921757-48921779 GGTGTCGCTTCCTGACGGGGCGG 0: 1
1: 0
2: 0
3: 4
4: 74

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174216727 Original CRISPR GCGTCACGTGACCACGTGAC TGG (reversed) Intergenic
900167642 1:1249931-1249953 GGGTCACGTGTCCACTGGACGGG + Intergenic
900220312 1:1505204-1505226 GGGTCACGTGTCCACTGGACGGG + Intergenic
900957210 1:5893408-5893430 GGGTCACGTGTCCACTGGACAGG + Intronic
900973429 1:6003968-6003990 CCGTCCCATGACCACGTGACAGG - Intronic
904164437 1:28544654-28544676 GAGTCACGTGTCCACCAGACGGG + Intergenic
905709028 1:40085306-40085328 GGGTCACGTGTCCACTGGACAGG - Intronic
905835618 1:41117806-41117828 GGGTCACGTGTCCACTGGACAGG - Intronic
908818570 1:68058666-68058688 GGGTCACGTGTCCACTGGACGGG - Intergenic
909455309 1:75843124-75843146 GGGTCACGTGTCCACTGGACAGG - Intronic
911073477 1:93850513-93850535 GGGTCACGTGTCCACTGGACAGG + Intergenic
911958043 1:104262889-104262911 GGGTCACGTGTCCACTGGACAGG + Intergenic
914711009 1:150213707-150213729 GCGGTGCGGGACCACGTGACTGG + Intergenic
915481937 1:156192866-156192888 GGGTCACGTGTCCACTGGACAGG - Intergenic
917862165 1:179156761-179156783 GCGTCACCTTTCCAAGTGACCGG - Intronic
923820128 1:237429287-237429309 GAGTCACTTGACCAAGTGGCCGG + Intronic
923863507 1:237916015-237916037 GAGTCACGTGTCCACTGGACAGG - Intergenic
1063787566 10:9402680-9402702 GAGTCACGTGTCCACTGGACAGG - Intergenic
1064018838 10:11793380-11793402 GGGTCACGTGTCCACTGGACAGG - Intergenic
1065899335 10:30191058-30191080 AAGTCACATGTCCACGTGACAGG - Intergenic
1068222376 10:54060765-54060787 GAGTCACGTGATCTAGTGACAGG + Intronic
1069111515 10:64453255-64453277 GTGTCAGGTGACCTCCTGACTGG + Intergenic
1072863259 10:99029547-99029569 GGGTCACGTGTCCACTGGACAGG + Intronic
1073083726 10:100875307-100875329 GCGTCACCTACCCACGTGAGTGG - Intergenic
1076896333 10:133314427-133314449 GTGTCACGTGTCCACTGGACAGG - Intronic
1077006738 11:361627-361649 GGGTCACGTGTCCACTGGACAGG + Intergenic
1077520122 11:3028183-3028205 GGGTCACGTGTCCACTGGACAGG - Intronic
1082580103 11:54855682-54855704 GTGTCACGTGTCCACTGGACAGG - Intergenic
1082954176 11:58851052-58851074 GAGTCACGTGTCCACCAGACAGG - Intronic
1083349450 11:62017038-62017060 GGGTCACGTGTCCACTGGACAGG - Intergenic
1083910601 11:65706996-65707018 GGGTCACGTGTCCACTGGACAGG - Intergenic
1084687246 11:70703867-70703889 GCATCACCTGACCACATGGCTGG - Intronic
1092224958 12:6742263-6742285 GGGTCACGTGTCCACTGGACAGG - Intergenic
1092444197 12:8538429-8538451 GGGTCACGTGTCCACTGGACAGG - Intronic
1092449061 12:8585091-8585113 GGGTCACGTGTCCACTGGACAGG - Intergenic
1094477372 12:30851649-30851671 GAGTCACGTGTCCACCGGACAGG - Intergenic
1097089987 12:56497318-56497340 GGGTCACGTGTCCACTGGACAGG - Intergenic
1097090520 12:56500952-56500974 GGGTCACGTGTCCACTGGACAGG + Intergenic
1097591670 12:61582426-61582448 GGGTCACGTGTCCACTGGACAGG + Intergenic
1098935335 12:76472614-76472636 GGGTCACGTGTCCACTGGACAGG + Intronic
1102306942 12:111812024-111812046 GGGTCACGTGTCCACTGGACAGG + Intergenic
1103357999 12:120336047-120336069 GGGTCACGTGTCCACTGGACAGG - Intergenic
1105019905 12:132809093-132809115 GGGTCACGTGTCCACTGGACGGG + Intronic
1105020188 12:132811050-132811072 GGGTCACGTGCCCACTGGACAGG - Intronic
1105043125 12:132977491-132977513 GGGTCACGTGTCCACTGGACAGG - Intergenic
1105675611 13:22668649-22668671 GGGTTAAGTGACCAGGTGACAGG - Intergenic
1107807230 13:44164879-44164901 GCCACACGTGACCACCTGAGTGG + Intergenic
1113856742 13:113450610-113450632 GGGTCACGTGTCCACTGGACAGG + Intronic
1115176066 14:30562890-30562912 GGGTCACGTGTCCACTGGACAGG - Intronic
1117632552 14:57708851-57708873 GGGTCACGTGTCCACTGGACAGG + Intronic
1118289002 14:64503801-64503823 GCCCCACGTGACCGCGTGTCTGG + Exonic
1121325513 14:93017521-93017543 GCGTCACCTGACCCCAAGACAGG + Intronic
1123183494 14:106491613-106491635 GGGTCACGTGTCCACTGGACAGG + Intergenic
1123193220 14:106591480-106591502 GGGTCACGTGTCCACTGGACAGG + Intergenic
1125760298 15:42091886-42091908 GGGTCACGTGTCCACTGGACAGG - Intronic
1127752189 15:62056882-62056904 GGGTCACGTGTCCACAGGACAGG - Intronic
1127877549 15:63123674-63123696 GGGTCACGTGTCCACTGGACAGG + Intronic
1129923291 15:79339208-79339230 GGGTCACGTGTCCACTGGACAGG - Intronic
1132967918 16:2669770-2669792 GGGTCACGTGTCCACTGGACAGG + Intergenic
1135670894 16:24374640-24374662 GGGTCACGTGTCCACTGGACGGG + Intergenic
1136191201 16:28615788-28615810 GGGTCACGTGTCCACTGGACAGG + Intronic
1137017325 16:35391153-35391175 GAGTCACGTGTCCACCGGACAGG + Intergenic
1142364156 16:89640978-89641000 GAGTCACGTGTCCACTGGACAGG + Intergenic
1142415350 16:89938115-89938137 GGGTCACGTGTCCACTGGACAGG + Intergenic
1142546600 17:708298-708320 AAGTCACATGTCCACGTGACAGG + Intronic
1142587456 17:982515-982537 GGGTCACGTGTCCACTGGACAGG - Intergenic
1142913670 17:3116142-3116164 GCGTCACCTGGCCAAGTGAGGGG + Intergenic
1143464501 17:7127005-7127027 GGGTCACGTGTCCACTGGACAGG - Intergenic
1145732040 17:27198163-27198185 GGGTCACGTGTCCACTGGACAGG - Intergenic
1147189353 17:38729989-38730011 GCGTCGCGTCACCTCGGGACGGG - Intergenic
1147820081 17:43236273-43236295 GAGTCACGTGTCCACTGGACAGG - Intergenic
1147823886 17:43258201-43258223 GAGTCACGTGTCCACTGGACAGG - Intergenic
1147824644 17:43262640-43262662 GAGTCACGTGTCCACTGGACAGG - Intergenic
1147825801 17:43269124-43269146 GAGTCACGTGTCCACTGGACAGG - Intergenic
1147826973 17:43275906-43275928 GAGTCACGTGTCCACTGGACAGG - Intergenic
1147827821 17:43280466-43280488 GAGTCACGTGTCCACTGGACAGG - Intergenic
1147828929 17:43286626-43286648 GAGTCACGTGTCCACTGGACAGG - Intergenic
1147830024 17:43292769-43292791 GAGTCACGTGTCCACTGGACAGG - Intergenic
1147834948 17:43323370-43323392 GAGTCACGTGTCCACTGGACAGG + Intergenic
1147836229 17:43333936-43333958 GAGTCACGTGACCACTGGACAGG + Intergenic
1147838309 17:43351003-43351025 AAGTCACTTGTCCACGTGACAGG + Intergenic
1147959753 17:44159664-44159686 AAGTCACGTGTCCACGTGATGGG + Intronic
1150858361 17:68774852-68774874 GAGTCACGTGTCCACCGGACAGG - Intergenic
1151740624 17:75979450-75979472 GCCTCGCGTGGTCACGTGACGGG - Exonic
1152682519 17:81676491-81676513 GGGTCACGTGTCCACTGGACAGG - Intergenic
1152874301 17:82777533-82777555 GGGTCACGTGTCCACTGGACGGG + Intronic
1156466015 18:37348252-37348274 GCCTCACCTCACCACGTGAAGGG - Intronic
1157662874 18:49460692-49460714 GTGCCACGTGACCACCTGGCTGG - Exonic
1160632646 18:80257564-80257586 GGGTCACGTGTCCACTGGACAGG + Intergenic
1161834050 19:6632973-6632995 GAGTCACGTGTCCACTGGACAGG + Intergenic
1161894043 19:7066900-7066922 GGGTCACGTGTCCACTGGACAGG + Intergenic
1162236352 19:9312667-9312689 GAGTCACGTGTCCACCAGACAGG - Intergenic
1162290497 19:9776503-9776525 GGGTCACGTGTCCACTGGACAGG - Intronic
1162729989 19:12712647-12712669 GGGTCACGTGTCCACTGGACAGG - Intronic
1163456255 19:17407486-17407508 GGGTCACGTGTCCACTGGACAGG + Intronic
1163881794 19:19930150-19930172 GGGTCACGTGTCCACTGGACAGG + Intronic
1163992151 19:21008651-21008673 GAGTCACGTGTCCACTGGACAGG - Intergenic
1164955162 19:32376853-32376875 GGGTCACGTGTCCACTGGACAGG + Intronic
1165541170 19:36492862-36492884 GGGTCACGTGTCCACTGGACAGG + Intergenic
1165618929 19:37227756-37227778 GAGTCACGTGTCCACCAGACAGG + Intronic
1165671196 19:37680776-37680798 GGGTCACGTGTCCACTGGACAGG + Intronic
1165915769 19:39258488-39258510 GAGTCACGTGTCCACATGACAGG + Intergenic
1166483273 19:43191446-43191468 GGGTCACGTGTCCACTGGACAGG + Intronic
1167206795 19:48107927-48107949 GAGTCACGTGTCCACTGGACAGG - Intronic
1167318524 19:48780920-48780942 AAGTCACGTGTCCATGTGACAGG + Intergenic
1167497306 19:49827178-49827200 GCCTCTCACGACCACGTGACCGG + Intronic
1167519073 19:49941624-49941646 GGGTCACGTGTCCACTGGACAGG - Intronic
1167719569 19:51169058-51169080 GAGTCACGTGTCCACTGGACAGG + Intergenic
1167939146 19:52932329-52932351 AAGTCACGTGATCACGGGACAGG - Intronic
1167979142 19:53258329-53258351 GGGTCACGTGTCCACTGGACAGG - Exonic
1167990953 19:53360259-53360281 GGGTCACGTGTCCACTGGACAGG + Intergenic
1168039398 19:53746050-53746072 GAGTCACGTGTCCACCGGACAGG + Intergenic
1168058564 19:53877556-53877578 AAGTCACGTGATCACGGGACAGG + Intergenic
1168131466 19:54322627-54322649 GGGTCACGTGTCCACTGGACAGG + Intergenic
1168215081 19:54919384-54919406 GGGTCACGTGTCCACTGGACAGG + Intergenic
1168480888 19:56718770-56718792 GGGTCACGTGTCCACTGGACAGG + Intergenic
1202666524 1_KI270708v1_random:125696-125718 GGGTCACGTGTCCACCAGACGGG - Intergenic
930115750 2:47716940-47716962 GGGTCACGTGTCCACTGGACAGG - Intronic
930813673 2:55569621-55569643 GGGTCACGTGTCCACTGGACAGG - Intronic
932342761 2:70977043-70977065 GAGTCACGTGTCCACCGGACAGG + Intronic
932673016 2:73754494-73754516 GAGTCACGTGTCCACTGGACAGG - Intergenic
936144447 2:109970446-109970468 GAGTCACGTGTCCACCGGACAGG - Intergenic
936181131 2:110268406-110268428 GAGTCACGTGTCCACCGGACAGG - Intergenic
936200240 2:110401023-110401045 GAGTCACGTGTCCACCGGACAGG + Intergenic
936388269 2:112049871-112049893 GGGTCACGTGTCCACTGGACGGG - Intergenic
940357147 2:152755615-152755637 GGGTCACGTGTCCACTGGACAGG - Intronic
941928243 2:170916698-170916720 GGGTCACGTGTCCACTGGACAGG - Intergenic
943084464 2:183295620-183295642 GAGTCACGTGTCCACTGGACAGG - Intergenic
945779565 2:214152774-214152796 GGGTCACGTGTCCACTGGACAGG + Intronic
947606567 2:231489792-231489814 GGGTCACGTGTCCACTGGACAGG + Intergenic
949019316 2:241732314-241732336 GGGTCACGTGTCCACTGGACAGG + Intergenic
949046705 2:241875537-241875559 GGGTCACGTGTCCACTGGACAGG + Intergenic
1169295494 20:4393873-4393895 GGGTCACGTGTCCACTGGACAGG + Intergenic
1172358941 20:34298930-34298952 GGGTCACGTGTCCACTGGACAGG - Intronic
1174216727 20:48921705-48921727 GCGTCACGTGACCACGTGACTGG - Intergenic
1175301546 20:57946742-57946764 GCTTCATGTGTCCAAGTGACAGG - Intergenic
1176007469 20:62874272-62874294 GGGTCACGTGTCCACTGGACAGG - Intergenic
1176420290 21:6508632-6508654 GGGTCACGTGTCCACTGGACAGG + Intergenic
1180201010 21:46224231-46224253 GGGTCACGTGTCCACTGGACAGG - Intronic
1180830766 22:18904899-18904921 GGGTCACGTGTCCACTGGACAGG + Intergenic
1180992762 22:19947503-19947525 GGGTCACGTGTCCACTGGACGGG + Intronic
1181837866 22:25625866-25625888 GGGTCACGTGTCCACTGGACAGG - Intronic
1183637123 22:39070936-39070958 GAGTCACGTGCCCACATGGCAGG + Intronic
1184221607 22:43104166-43104188 AAGTCACGTGTCCACGTGACAGG + Intergenic
1184351608 22:43947741-43947763 GGGTCACGTGTCCACTGGACAGG + Intronic
1185355627 22:50367978-50368000 GAGTCACGTGTCCACTGGACAGG + Intronic
1203280855 22_KI270734v1_random:130170-130192 GGGTCACGTGTCCACTGGACAGG + Intergenic
950401331 3:12771345-12771367 GGGTCACGTGTCCACCAGACAGG - Intergenic
953059800 3:39417965-39417987 GGGTCACGTGTCCACTGGACAGG - Intergenic
953294186 3:41696413-41696435 GGGTCACGTGTCCACTGGACAGG - Intronic
954577601 3:51685190-51685212 CCGTCAGATGACCAGGTGACTGG - Intronic
956504226 3:69920619-69920641 GGGTCACGTGTCCACTGGACAGG - Intronic
960593370 3:119386785-119386807 GGGTCACGTGTCCACTGGACAGG + Intronic
964101435 3:152992641-152992663 GGGTCACGTGTCCACTGGACAGG - Intergenic
965644010 3:170860816-170860838 GGGTCACGTGTCCACTGGACAGG - Intergenic
966815584 3:183887255-183887277 GGGTCACGTGTCCACTGGACGGG - Intergenic
968050882 3:195654242-195654264 GGGTCACGTGTCCACTGGACAGG - Intergenic
968104942 3:195994096-195994118 GGGTCACGTGTCCACTGGACAGG + Intergenic
968108594 3:196022674-196022696 GAGTCACGTGTCCACCAGACAGG - Intergenic
968303237 3:197631683-197631705 GGGTCACGTGTCCACTGGACAGG + Intergenic
968397817 4:259851-259873 GGGTCACGTGTCCACTGGACAGG - Intergenic
968404699 4:329821-329843 GGGTCACGTGTCCACTGGACAGG + Intergenic
969045690 4:4334982-4335004 GAGTCACGTGTCCACTGGACAGG + Intergenic
972321214 4:37975188-37975210 GGGTCACGTGTCCACTGGACAGG + Intronic
973245252 4:48004197-48004219 GGGTCACGTGTCCACTGGACAGG - Intronic
974493420 4:62595869-62595891 GGGTCACGTGTCCACTGGACAGG - Intergenic
975377786 4:73665702-73665724 GGGTCACGTGTCCACTGGACAGG + Intergenic
975378423 4:73671111-73671133 GGGTCACGTGTCCACTGGACAGG + Intergenic
975387438 4:73773813-73773835 GGGTCACGTGTCCACTGGACAGG + Intergenic
975749247 4:77506078-77506100 GCATCACGTGGCCAGGTGACTGG - Intergenic
978502566 4:109424667-109424689 AAGTCACGTGTCCACGTGACGGG - Intergenic
981138474 4:141239259-141239281 GCATCTGGTGACCAAGTGACTGG + Intergenic
982763372 4:159315668-159315690 GGGTCACGTGTCCACTGGACAGG + Intronic
985613280 5:902826-902848 GGGTCACGTGTCCACTGGACAGG + Intronic
988289725 5:29270210-29270232 GCGTCACCTCACCACCTCACTGG + Intergenic
996184341 5:120458007-120458029 GAGTCACGTGTCCACCGGACAGG + Intergenic
1001699439 5:173696089-173696111 GCGTCAGGTGACCAGGTGTGTGG + Intergenic
1002205815 5:177561869-177561891 GAGTCACGTGTCCACTGGACAGG - Intergenic
1005576495 6:27194680-27194702 AAGTCACGTGTCCATGTGACAGG + Intergenic
1005709768 6:28491786-28491808 GGGTCACGTGTCCACTGGACAGG - Intergenic
1005922185 6:30411987-30412009 GAGTCACGTGTCCACCAGACAGG - Intergenic
1006652095 6:35559959-35559981 GGGTCACGTGTCCACTGGACAGG + Intergenic
1011328291 6:86174891-86174913 GGGTCACGTGTCCACTGGACAGG + Intergenic
1013589517 6:111608407-111608429 GGGTCACGTGTCCACTGGACAGG - Intergenic
1015240923 6:131022328-131022350 GTGTCACGTTACCATGTGACAGG - Intronic
1019109375 6:169697733-169697755 GGGTCACGTGTCCACTGGACAGG - Intronic
1023074335 7:36468063-36468085 GGGTCACGTGTCCACTGGACAGG - Intergenic
1029381428 7:100217695-100217717 GAGTCACGTGTCCACCAGACAGG + Intronic
1029400858 7:100345005-100345027 GAGTCACGTGTCCACCAGACAGG + Intronic
1029562132 7:101309467-101309489 GGGTCACGTGTCCACTGGACAGG + Intergenic
1029756040 7:102574201-102574223 GGGTCACGTGTCCACTGGACAGG - Intronic
1029773982 7:102673273-102673295 GGGTCACGTGTCCACTGGACAGG - Intergenic
1037057268 8:14457747-14457769 GGGTCACGTGTCCACTGGACAGG - Intronic
1046024002 8:108700185-108700207 ACGTCAAGGGACCATGTGACTGG + Intronic
1048241009 8:132741553-132741575 GGGTCACGTGTCCACTGGACAGG + Intronic
1049458715 8:142710017-142710039 GGGTCACGTGTCCACTGGACAGG + Intergenic
1055476283 9:76666575-76666597 GAGTCACGTGTCCACTGGACAGG - Intronic
1055720250 9:79165169-79165191 GCGTCTGGTGATCACATGACTGG + Intergenic
1057554500 9:96076879-96076901 GGGTCACGTGTCCACTGGACAGG - Intergenic
1059427929 9:114232630-114232652 GTGTCACCTGACCACATGAGGGG - Intronic
1061039172 9:128129710-128129732 GGGTCACGTGTCCACTGGACAGG + Intergenic
1061048803 9:128182089-128182111 GGGTCACGTGTCCACTGGACAGG - Intronic
1061535412 9:131245335-131245357 GGGTCACGTGTCCACTGGACCGG - Intergenic
1061785562 9:133025895-133025917 GGGTCACGTGTCCACTGGACAGG - Intergenic
1062531798 9:137004885-137004907 GGGTCACGTGTCCACTGGACGGG - Intergenic
1062557627 9:137122062-137122084 GAGTCACGTGTCCACCGGACAGG - Intergenic
1062639396 9:137510503-137510525 GAGTCACGTGTCCACTGGACAGG - Intronic
1062639632 9:137511907-137511929 AAGTCACCTGTCCACGTGACAGG - Intronic
1062642297 9:137525486-137525508 GAGTCACGTGTCCACCGGACAGG + Intronic
1062648006 9:137559721-137559743 GGGTCACGTGTCCACTGGACAGG - Intronic
1185619718 X:1446224-1446246 GAGTCACGTGTCCACTGGACAGG - Intronic
1191224882 X:58032230-58032252 CCCTCACGTGACCACAAGACAGG - Intergenic
1198287563 X:135207056-135207078 GGGTCACGTGTCCACTGGACAGG - Intergenic
1198344679 X:135747821-135747843 GGGTCACGTGTCCACTGGACAGG + Intergenic
1198998636 X:142606438-142606460 GGGTCACGTGTCCACTGGACAGG + Intergenic
1201649542 Y:16270271-16270293 GGGTCACGTGTCCACTGGACAGG - Intergenic