ID: 1174224773

View in Genome Browser
Species Human (GRCh38)
Location 20:48988578-48988600
Sequence AGCATCTATGAAGAGATAGA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 483
Summary {0: 1, 1: 0, 2: 4, 3: 46, 4: 432}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174224772_1174224773 -5 Left 1174224772 20:48988560-48988582 CCAGAAGAGTATCTCTCAAGCAT 0: 1
1: 0
2: 1
3: 10
4: 113
Right 1174224773 20:48988578-48988600 AGCATCTATGAAGAGATAGAAGG 0: 1
1: 0
2: 4
3: 46
4: 432

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174224773 Original CRISPR AGCATCTATGAAGAGATAGA AGG Exonic
900008657 1:86020-86042 ATTATCTATGAAGAATTAGAGGG + Intergenic
903010218 1:20324551-20324573 CGGATCAATAAAGAGATAGAAGG - Intronic
903709696 1:25313910-25313932 AGAATCTAAGAAAAGATAGTTGG + Intronic
903717420 1:25378479-25378501 AGAATCTAAGAAAAGATAGTTGG - Intronic
903836146 1:26204404-26204426 AGCATCCTGGAGGAGATAGATGG - Intergenic
904230791 1:29069611-29069633 AGTCTATATGAAGAGATATAAGG + Intronic
904549065 1:31300039-31300061 AGTAGCTAGGAAGAGAAAGAGGG - Intronic
905380922 1:37561092-37561114 AGCATTTATGGGGAGATAGATGG + Intronic
906464966 1:46070093-46070115 AGTATCTAGAAAGAGATATAGGG + Intronic
907806571 1:57826505-57826527 AGCAGGTATGCAGAGATAGTGGG + Intronic
907823856 1:57996681-57996703 GACATCTATGCAGAGCTAGAAGG - Intronic
908984392 1:69999326-69999348 AGCATCTATGAACACTGAGAAGG + Intronic
909372707 1:74902999-74903021 AGGATACATGAAGAGATAGAAGG + Intergenic
910154509 1:84199342-84199364 AGAATTTATGAAGACAAAGAAGG - Intronic
910515928 1:88060192-88060214 GGTATCTAGGAAGAGAAAGAGGG - Intergenic
910605968 1:89084869-89084891 AGCAACAATGAAGAGGAAGAAGG + Intergenic
911419690 1:97624716-97624738 AGTATCTATCAACAGATAAATGG + Intronic
911540337 1:99150206-99150228 TGCATCTAGCAAGAAATAGAAGG + Intergenic
912673386 1:111652555-111652577 TTTATCTATGAAGAGCTAGATGG - Intronic
913964679 1:143366012-143366034 AGCATCCATCAACAGATGGATGG - Intergenic
913964771 1:143366859-143366881 AGCATCCATCAACAGATAGATGG + Intergenic
914059050 1:144191616-144191638 AGCATCCATCAACAGATGGATGG - Intergenic
914059143 1:144192462-144192484 AGCATCCATCAACAGATAGATGG + Intergenic
914120006 1:144773909-144773931 AGCATCCATCAACAGATAGATGG - Intergenic
914120099 1:144774755-144774777 AGCATCCATCAACAGATGGATGG + Intergenic
915483287 1:156202181-156202203 AGCAGGTATGAAGAGAAAGTTGG - Intronic
916321934 1:163513626-163513648 AGCAGCTCAGAAGAGAGAGAGGG + Intergenic
917130201 1:171733928-171733950 AACATCTATGAACTGATAAATGG + Intronic
919798461 1:201336182-201336204 AGCATCTGGATAGAGATAGAAGG - Intergenic
921032081 1:211342884-211342906 AGCATCTATCAACAGATGAATGG - Intronic
921263003 1:213400419-213400441 AGCATCAATGAATAAATGGATGG - Intergenic
921782150 1:219177442-219177464 AGCAACTATGGACAGCTAGAGGG - Intronic
924153363 1:241151257-241151279 AACATCTATGGAAAGAGAGACGG + Intronic
924920251 1:248621473-248621495 TGAATGTCTGAAGAGATAGAAGG + Intergenic
1062792288 10:316039-316061 AACATCTATGAAGAGGTGGGGGG - Intronic
1063837618 10:10033571-10033593 TGTATCTATAAATAGATAGATGG + Intergenic
1065067059 10:21980330-21980352 ATCATCTGTGATGAGATATATGG + Intronic
1065477544 10:26156898-26156920 ACCATCTATAAAGAGAGAGTTGG + Intronic
1066592761 10:37013348-37013370 GGAATCTAGGAAGAGATACAGGG + Intergenic
1066791581 10:39070543-39070565 AGAATCTGTGAAGAGATATTTGG + Intergenic
1066814742 10:39391908-39391930 AGAATCTATGAAGGGATATTTGG + Intergenic
1066930178 10:41749182-41749204 AGAATCTATGAAGGGATATTTGG + Intergenic
1066932298 10:41778435-41778457 AGCATCTGTGAAGGGATACTTGG + Intergenic
1066932324 10:41778946-41778968 AGCATCTGTGAAGGGATATTTGG + Intergenic
1068842489 10:61631009-61631031 AACATCTATGAAGAGGTAAAAGG - Intergenic
1070478485 10:76854380-76854402 AGCATCTATCAACAGATGAATGG + Intergenic
1070985508 10:80686579-80686601 AGCATATAGGGACAGATAGAAGG + Intergenic
1071902200 10:90132731-90132753 AATATCTATCAAGAGATAAATGG - Intergenic
1072391185 10:94988710-94988732 AGAAGAGATGAAGAGATAGATGG - Intronic
1073525825 10:104181131-104181153 GGCAGCTATGAAGAGAAAGAAGG - Intronic
1073935681 10:108628653-108628675 AGCATCTATTAACAAATAAATGG + Intergenic
1075375131 10:121972857-121972879 AGCATATATAAAGTGATAAAAGG + Intronic
1076259729 10:129055789-129055811 TGCATATATGAAGAGAAACACGG + Intergenic
1079620328 11:22546800-22546822 AGCATCTATAAAGAGATTCTTGG - Intergenic
1081096180 11:38938939-38938961 AGCATTCATGAGGAGATACAGGG - Intergenic
1081109599 11:39118519-39118541 TGCATATATGAAGGGATGGATGG + Intergenic
1081316145 11:41632648-41632670 ATGATCTATGAAGGGATACAAGG + Intergenic
1082144680 11:48652612-48652634 AGAATCTGTGAAGAGATATTTGG + Intergenic
1082145303 11:48659737-48659759 AGAATCTGTGAAGAGATATTTGG + Intergenic
1082145687 11:48665357-48665379 AGAATCTGTGAAGGGATATATGG + Intergenic
1082146139 11:48671965-48671987 AGAATCTGTGAAGAGATATTTGG + Intergenic
1082299009 11:50482299-50482321 AGCAACTATGAAGGGATATTTGG - Intergenic
1082303231 11:50537179-50537201 AGAATCTGTGAAGAGATATTTGG - Intergenic
1082303334 11:50538718-50538740 AGAATCTGTGAAGAGATATTTGG - Intergenic
1082306522 11:50583758-50583780 AGAATCTGTGAAGAGATATTAGG + Intergenic
1082310680 11:50643966-50643988 AGAATCTATGAAGAAATATTTGG + Intergenic
1082311237 11:50651205-50651227 AGCATCTGTGAAAGGATATATGG + Intergenic
1082312255 11:50665887-50665909 AGAATCCATGAAGTGATACATGG - Intergenic
1082577486 11:54826713-54826735 AGAATCTGTGAAGAGATATTTGG + Intergenic
1082577697 11:54829864-54829886 AGCATCTGTGAAGAGATATTTGG + Intergenic
1082579766 11:54851269-54851291 AGAATCTTTGAAGAGATATTTGG + Intergenic
1082579802 11:54851954-54851976 AGAATCTGTGAAGAGATATTTGG + Intergenic
1082579854 11:54852642-54852664 AGAATCTGGGAAGAGATATAAGG + Intergenic
1082580199 11:54856724-54856746 AGAATCTATGAAGAGATACTTGG + Intergenic
1082581003 11:54868894-54868916 AGAATCTGTGAAGAGATATTTGG - Intergenic
1082581514 11:54875522-54875544 AGAATCTATGAAGGGATATTTGG - Intergenic
1082581604 11:54876723-54876745 AGAATCTGTGAAGAGATATCTGG - Intergenic
1082581797 11:54879526-54879548 AGCATCTGCGAAGAGATATTTGG - Intergenic
1082582645 11:54892182-54892204 AGAATCTGTGAAGAGATAACTGG + Intergenic
1082583859 11:54909305-54909327 AGAATCTATGAAGGGATATTTGG - Intergenic
1082585667 11:54936215-54936237 AGTATCTATGAAGGGATATCTGG - Intergenic
1082587993 11:54967024-54967046 AGAATCTGTGAAGAGATATTTGG + Intergenic
1082588404 11:54972732-54972754 AGAATCTGTGAAGAGATATTTGG + Intergenic
1082589047 11:54982464-54982486 AGGATCTGTGAAGAGATATTTGG + Intergenic
1082589770 11:54991603-54991625 AGAATCTGTGAAGAGATATCTGG + Intergenic
1082592932 11:55036494-55036516 AGAGTCTATGAAGAGATATTTGG - Intergenic
1082593942 11:55050762-55050784 AGAATCTATGAAGGGATACTGGG - Intergenic
1082595702 11:55078536-55078558 AGAATCTGTGAAGAGATATTTGG - Intergenic
1082595993 11:55082935-55082957 AGAATCTGTGAAGAGATATTTGG - Intergenic
1082597725 11:55105784-55105806 AGAATCTGTGAAGAGATATTTGG + Intergenic
1082598262 11:55112525-55112547 AGAATCTGTGAAGAGATATTTGG + Intergenic
1082598432 11:55114928-55114950 AGGATCTACGAAGAGATATTTGG + Intergenic
1082648302 11:55755659-55755681 GGCAACTATGAAGACATAGAAGG - Intergenic
1083733099 11:64663792-64663814 AGCATCCACCAACAGATAGATGG + Intronic
1086914633 11:92515177-92515199 ACCCACTATGAACAGATAGATGG + Intronic
1087358660 11:97128861-97128883 AGCATCCATCAACAGATAAATGG - Intergenic
1087997845 11:104833224-104833246 AGCATCTATCAACAGATGAATGG - Intergenic
1089032144 11:115342978-115343000 AACATTCATGAAGAGATACAAGG + Intronic
1089152274 11:116373311-116373333 GGCCTCAATGAAGAGACAGAAGG + Intergenic
1090084162 11:123636543-123636565 AGCATCTTTAAAGTGATAAATGG - Intronic
1090611248 11:128472846-128472868 AGCATCTATGAAGGAAAAAAAGG - Intronic
1091182880 11:133622733-133622755 AGGATCTATGGAGAGCTGGAGGG - Intergenic
1092623095 12:10294955-10294977 AACATCTATAAAGAGAAAGAGGG + Intergenic
1093593386 12:20933260-20933282 AGCATCTAGGAAAAGATGAATGG - Intergenic
1094235424 12:28160324-28160346 TACTTCTATGAAGAGATAGAAGG - Intronic
1094859350 12:34443683-34443705 AGAATCTATGAAGGGATATTTGG - Intergenic
1094860372 12:34459277-34459299 AGAATCTGTGAAGAGATATTTGG - Intergenic
1094863171 12:34494427-34494449 AGAATCTGTGAAGAGATATTTGG - Intergenic
1094864466 12:34513892-34513914 AGAATCTATGAAGGGATATTTGG - Intergenic
1094864734 12:34518179-34518201 AGAATCTGTGAAGAGATATTTGG - Intergenic
1094873665 12:34615466-34615488 AGAATCTATGAAGTGATATTTGG + Intergenic
1094873772 12:34617188-34617210 AGAATCTATGAAGGGATATTTGG + Intergenic
1094876495 12:34650766-34650788 AGAATCTGTGAAGAGATATTTGG + Intergenic
1094876655 12:34653678-34653700 AGTATCTGAGAAGAGATATATGG + Intergenic
1095072850 12:37877773-37877795 AGAATCTATGAAGGGATATTTGG - Intergenic
1095078038 12:37957154-37957176 AGAATCTGTGAAGAGATATTTGG - Intergenic
1095078313 12:37962456-37962478 AGAATCTGTGAAGAGATATTTGG + Intergenic
1095079210 12:37977199-37977221 AGAATCTATGAAGGGATATTTGG + Intergenic
1095079512 12:37981821-37981843 AGAATCTATGAAGGGATATTTGG + Intergenic
1095684607 12:45018742-45018764 AGCATCTAGGAACAGATAAATGG + Intronic
1096002287 12:48139958-48139980 AGCATTTATGAAGAGAGACTGGG - Intronic
1096915798 12:55031434-55031456 AGCTTCTATCAAGGGAAAGATGG - Intergenic
1098014634 12:66091503-66091525 AGAATCTATGAACACAAAGAAGG - Intergenic
1098025816 12:66200482-66200504 ATCCTCTATGATGGGATAGAGGG + Intronic
1098514178 12:71354519-71354541 AGCATCTCTGATGTGACAGATGG + Intronic
1098760598 12:74420310-74420332 ATGATCTATGAAGTGAGAGATGG - Intergenic
1098947525 12:76605415-76605437 AGCAAATGTGAACAGATAGAAGG + Intergenic
1099482305 12:83183214-83183236 ACCATCTATGAATAGAAAGCAGG - Intergenic
1100358362 12:93853445-93853467 GGCATGTTTGAAGAGATAAAAGG + Intronic
1101114985 12:101523158-101523180 AACATCTATGCAGACATGGAGGG + Intergenic
1101408982 12:104453766-104453788 AGCATCCTTGAAGGGAGAGAGGG - Intergenic
1101568477 12:105932007-105932029 AGAATCTATGAAAAGAAAGAGGG + Intergenic
1101953753 12:109196421-109196443 AGCATCTATGAAACGAAAGGTGG - Intronic
1105871333 13:24508070-24508092 AGCATCTGTGCATAGATAGGAGG + Intronic
1107494481 13:40912579-40912601 AGCAACTATGTAGAAAAAGATGG + Intergenic
1107877706 13:44805261-44805283 AGGAGCTAGGAAGAGAGAGAAGG - Intergenic
1109961190 13:69634219-69634241 AGCATCTATCAACAGATTAATGG - Intergenic
1110950891 13:81489359-81489381 AGCACCAATGAGGAGATAGAAGG + Intergenic
1110969187 13:81739698-81739720 AGTATCTTTGGAGAGAGAGAAGG - Intergenic
1111481982 13:88841239-88841261 AGCATCCATTAACAGATAAATGG + Intergenic
1111850422 13:93566454-93566476 TGCATCTCTGAAGAGAAGGAGGG - Intronic
1112148672 13:96731481-96731503 AGTATCTATGAAAAGATAAATGG - Intronic
1113332100 13:109338810-109338832 AGCCTCTAGCAAGAGAGAGAGGG - Intergenic
1113646196 13:111998217-111998239 GGGATCTATAAAGAGGTAGAAGG + Intergenic
1114627567 14:24139323-24139345 GGCTTCTAAGAAGAGGTAGAGGG + Intronic
1116689441 14:48085853-48085875 AGCTTCTATTAAGAGGTAAATGG + Intergenic
1120918526 14:89731802-89731824 AGTGTCTATGAACAGATAAATGG - Intergenic
1122149028 14:99714438-99714460 AGCATCCATCAACAGATAAATGG + Intronic
1125976822 15:43960929-43960951 AGCATTTGTGAAGAGAAAGCAGG + Intronic
1126871145 15:52989395-52989417 AGAATATATGAACACATAGAAGG - Intergenic
1126994398 15:54423841-54423863 ACCATCTGGGAAGAGATAGGAGG + Intronic
1127685077 15:61335601-61335623 AGCATGTATGAAAAGCAAGATGG - Intergenic
1129526483 15:76219227-76219249 AGTCTCTTTGAACAGATAGATGG + Intronic
1133073201 16:3260469-3260491 ATCATCTATGAAAAAATAGTTGG - Intergenic
1133608078 16:7407752-7407774 TGAATCTATGAAGATACAGAAGG - Intronic
1134208153 16:12254151-12254173 AACATCTACGGAGAGACAGAAGG + Intronic
1136740733 16:32522163-32522185 AGAATCTCTGAAGGGATACAAGG - Intergenic
1136741610 16:32535808-32535830 AGAATCTATGAAGGGATATATGG - Intergenic
1136744756 16:32576173-32576195 AGCATCTGTGAAGGGATATTTGG + Intergenic
1136745557 16:32587081-32587103 AGAATCTATGAAGGGATATTTGG - Intergenic
1137073247 16:35927951-35927973 AGAATCTATGAAGAGACATTTGG - Intergenic
1137413478 16:48249547-48249569 AACATCTATGAAATTATAGATGG - Intronic
1138787308 16:59862990-59863012 AGAATCTATGAGGGGATGGATGG + Intergenic
1138991955 16:62401275-62401297 AGTATCTAGGAAGATATAGATGG + Intergenic
1140590117 16:76341640-76341662 GGCATCCATGAATAGATATATGG + Intronic
1203024841 16_KI270728v1_random:499055-499077 AGCATCTGTGAAGGGATATTTGG - Intergenic
1203027992 16_KI270728v1_random:539426-539448 AGAATCTATGAAGGGATATATGG + Intergenic
1203028869 16_KI270728v1_random:553070-553092 AGAATCTCTGAAGGGATACAAGG + Intergenic
1203042852 16_KI270728v1_random:781361-781383 AGAATCTCTGAAGGGATACAAGG - Intergenic
1203043729 16_KI270728v1_random:795005-795027 AGAATCTATGAAGGGATATATGG - Intergenic
1203046880 16_KI270728v1_random:835376-835398 AGCATCTGTGAAGGGATATTTGG + Intergenic
1203047683 16_KI270728v1_random:846286-846308 AGAATCTATGAAGGGATATTTGG - Intergenic
1143879688 17:10020389-10020411 AGAATCCATGAAGAGCTGGATGG + Intronic
1145417557 17:22733148-22733170 AGAATCTGTAAAGAGATACATGG + Intergenic
1146529104 17:33592742-33592764 AGCATCTCTCAGGAGACAGAAGG + Intronic
1148377032 17:47157755-47157777 TGCATCTATGTATATATAGAAGG - Intronic
1152006573 17:77685909-77685931 AGAATGTATGCACAGATAGATGG - Intergenic
1152006595 17:77686039-77686061 AGAATGTATGGACAGATAGATGG - Intergenic
1152006621 17:77686163-77686185 AGAATGTATGGACAGATAGATGG - Intergenic
1153186617 18:2493240-2493262 AGAATCTAGGAATAGAGAGAAGG + Intergenic
1153193106 18:2564434-2564456 ACCATATATAAAGTGATAGATGG - Intronic
1153254270 18:3155084-3155106 AGCATCTGTGGAGACAGAGAAGG + Exonic
1153632593 18:7086317-7086339 ATCATCTAGGCAGAAATAGAAGG + Intronic
1153699412 18:7677758-7677780 AGCATTTAGGCAGAGATGGAAGG - Intronic
1156108321 18:33692432-33692454 AGCATCCCTGCAGAGATAGTAGG - Intronic
1156871399 18:41949833-41949855 ATCATCTATAAAGAGGCAGAGGG + Intergenic
1157968026 18:52231073-52231095 AGCCTCTATACAGAGAAAGATGG + Intergenic
1158150726 18:54366521-54366543 AGTATCCATCAACAGATAGAAGG - Intronic
1158199699 18:54926124-54926146 AGCATCTATGTAAATACAGAGGG + Intronic
1158313958 18:56190005-56190027 AGCCCCTATAAAGGGATAGACGG + Intergenic
1159618531 18:70610587-70610609 AAAATCTATTGAGAGATAGATGG - Intergenic
1160057740 18:75500971-75500993 TGCATATATGAGGAGAGAGAAGG - Intergenic
1161184742 19:2909638-2909660 CTCATCTGTGAAGATATAGATGG - Intronic
1161403937 19:4081594-4081616 AGCATCTAGGAGGAGGGAGAAGG - Intergenic
1164327714 19:24214124-24214146 AGAATCTATGAAGGGATATTTGG - Intergenic
1164328303 19:24223543-24223565 AGAATCTAGGAAGGGATATATGG - Intergenic
1164328537 19:24227472-24227494 AGAATCTGTGAAGAGATACTTGG - Intergenic
1164328708 19:24229842-24229864 AGTATCTAGGAAGAGGTATAGGG - Intergenic
1164333912 19:24289382-24289404 AGAATCTGTGAAGAGATATTTGG + Intergenic
1164335427 19:24313712-24313734 AGAATCTATGAAGGGATATTTGG + Intergenic
1164335843 19:24320501-24320523 AGAATCTGTGAAGGGATATATGG + Intergenic
1164337034 19:24335393-24335415 AGTATCTGTGAAGAGATATTTGG + Intergenic
1164337159 19:24337609-24337631 AGAATCTGTGAAGGGATAGTTGG + Intergenic
1164337287 19:24339824-24339846 AGATTCTATGAAGAGATGTATGG + Intergenic
1164337343 19:24340684-24340706 AGAATCTGTGAAGAGATATTTGG + Intergenic
1164337387 19:24341530-24341552 AGAATCTGTGAAGAGATATTTGG + Intergenic
1164337485 19:24343075-24343097 AGTATCTATGAAGGGATATTTGG + Intergenic
1164337758 19:24347500-24347522 AGAATCTGTGAAGGGATATATGG + Intergenic
1164337811 19:24348531-24348553 AGAATCTATGAAGTGATATATGG + Intergenic
1164337966 19:24350927-24350949 AGAATCTATGAAGGGATATATGG + Intergenic
1164338585 19:24360969-24360991 AGAATCTATGAAGGGATATTTGG + Intergenic
1164339623 19:24376941-24376963 AGCATCTGCCAAGAGATATATGG + Intergenic
1164339717 19:24378498-24378520 AGAATCTGTGAAGAGATATTTGG + Intergenic
1164359734 19:27491617-27491639 AGAATCTATGAAGGGATATATGG + Intergenic
1164360281 19:27499913-27499935 AGAATCTAGGAAGGGATATATGG + Intergenic
1164362546 19:27531123-27531145 AGAATCAATGAAGAGATATTTGG + Intergenic
1164362553 19:27531295-27531317 AGGATCTATGAAGAGATATATGG + Intergenic
1164362609 19:27532154-27532176 AGGACCTATGAAGAGATATATGG + Intergenic
1164362661 19:27533016-27533038 AGAATCTATGAAGGGATATATGG + Intergenic
1164362746 19:27534490-27534512 AGAAACTATGAAGGGATATATGG + Intergenic
1164363207 19:27541881-27541903 AGAATCTGTGAAGAGATATTTGG + Intergenic
1164363965 19:27552716-27552738 AGAATCTATGAAGGGATACGTGG + Intergenic
1164366981 19:27596084-27596106 AGCATCTGTGAAGGGATATTTGG + Intergenic
1164366989 19:27596256-27596278 AGCATCTGTGAAGGGATATTTGG + Intergenic
1164367830 19:27606051-27606073 AGAATCTATGAAGGGATATATGG + Intergenic
1164368249 19:27612481-27612503 AGAATCTATGAAGGGGTATATGG + Intergenic
1164368333 19:27613848-27613870 AGCATCTGTGAAGGGATATTTGG + Intergenic
1164368691 19:27620270-27620292 AGAATCTGTGAAGGGATATATGG + Intergenic
1167298824 19:48667547-48667569 TTCATGTATGAAGAAATAGAGGG + Intronic
1168156606 19:54476765-54476787 AGCAACGATGGAGAGATAAAAGG + Intergenic
1168157133 19:54480881-54480903 AGCAACGATGGAGAGATAAAAGG + Intergenic
1202698454 1_KI270712v1_random:143502-143524 AGCATCCATCAACAGATGGATGG - Intergenic
1202698547 1_KI270712v1_random:144349-144371 AGCATCCATCAACAGATAGATGG + Intergenic
925092806 2:1168787-1168809 AGCATGAATGAAGACCTAGAGGG + Intronic
925167147 2:1723242-1723264 TGAATCAATGAACAGATAGATGG + Intronic
926706895 2:15843515-15843537 AGCATCTATGAGGGGAGAAAAGG + Intergenic
926910603 2:17849321-17849343 AGCTTCTCTGCAGAGATAAAAGG - Intergenic
928087683 2:28356082-28356104 AGCATCTGTGTGGAGATGGAAGG - Intergenic
931010702 2:57909747-57909769 AAAATCTATTAAGAGTTAGAAGG - Intronic
931202874 2:60117074-60117096 AGAATTTATGAAGACAAAGAAGG - Intergenic
934279795 2:91602130-91602152 AGCATCCATCAACAGATAGATGG + Intergenic
935106073 2:100044929-100044951 AGCAGACATGAAGAGAGAGATGG + Intronic
936095227 2:109526126-109526148 AGCATCTGTGAAAAGACATAAGG - Intergenic
936865701 2:117074182-117074204 AGCATCAGTGAAGAGGCAGAGGG - Intergenic
937100515 2:119264673-119264695 AGCATCTTTGAAGACAAAGAGGG + Exonic
939094916 2:137823508-137823530 AGCATATATGAAGAAAAAGACGG - Intergenic
939405499 2:141750300-141750322 AGCATCTTTCTAGAAATAGAAGG - Intronic
939670473 2:145005519-145005541 AGAATATATTAAAAGATAGATGG - Intergenic
939755037 2:146099861-146099883 AGCATCCTTGAAGAGCTAGGAGG + Intergenic
940754458 2:157666229-157666251 AGTATCAATGAAGATATGGAAGG + Intergenic
941711133 2:168714395-168714417 GGCATCTATGAAGGGACAGTAGG - Intronic
942633951 2:177981485-177981507 AGACTCTGTGAAGAGATACAGGG - Intronic
944130216 2:196339583-196339605 AGGATAGATGAGGAGATAGATGG + Intronic
944174250 2:196812057-196812079 CGCAGCTATGAAAAGAAAGAAGG + Intergenic
944513478 2:200487495-200487517 AGCATCACTGAAAAGCTAGAGGG - Intergenic
948334066 2:237194059-237194081 ACCAGCTGTGAAGAGAGAGAAGG - Intergenic
1170505198 20:17018574-17018596 AAAATCTCCGAAGAGATAGAGGG + Intergenic
1173244237 20:41324163-41324185 AGCATCTATTAACAGATAAATGG + Intergenic
1173885442 20:46453607-46453629 TATATCTATGTAGAGATAGATGG - Intergenic
1174224773 20:48988578-48988600 AGCATCTATGAAGAGATAGAAGG + Exonic
1181158637 22:20942462-20942484 AGTATCCATCAAGAGATAAATGG - Intronic
1181385393 22:22541612-22541634 AGAATGGATGAATAGATAGATGG + Intergenic
1182394329 22:30024621-30024643 AGCATAAATGAAAAGTTAGAAGG + Intronic
949365537 3:3276604-3276626 AGCATCTATTAATACATACAAGG + Intergenic
951497574 3:23348223-23348245 AGCATTTATGCAGAGAGATAAGG - Intronic
952710272 3:36424605-36424627 AGCTTCCTTGAAGAAATAGATGG + Intronic
952737804 3:36707468-36707490 AGCATGTAGGAAGAGAGAAAGGG + Intergenic
953308603 3:41854315-41854337 AGCATCTTTGAAGAGCTCTAAGG + Intronic
954478436 3:50772043-50772065 AGCATCCATGAACAGATGAATGG + Intronic
954487353 3:50865541-50865563 AGCATCTATCAACAGACAAATGG - Intronic
957493156 3:80955809-80955831 AGAATCTACGAAGACATAAATGG - Intergenic
957567987 3:81908940-81908962 AGCATCTTTCAAGAGGCAGATGG - Intergenic
957697625 3:83661859-83661881 AGCATATATGAAGAGAAAGAGGG + Intergenic
957729027 3:84107925-84107947 AGCATCTATTAAGAGATGAGGGG + Intergenic
958677024 3:97278059-97278081 AGTATCTATCAACAGATAAACGG - Intronic
959561040 3:107781756-107781778 AGGAACTATGTAAAGATAGAAGG - Intronic
960463599 3:117967857-117967879 AGCATGTATGAATAAATATATGG + Intergenic
960726566 3:120676200-120676222 AGCATCTATGAAGAGGTGTGTGG + Intronic
960741348 3:120836970-120836992 AGTATCTATGAACAGATGAATGG + Intergenic
960948847 3:122985590-122985612 CACATCTATGAAGAGGTAAAAGG + Intronic
962207710 3:133448631-133448653 AGAAACTATGAAGAGGTAGGAGG + Exonic
964674506 3:159262615-159262637 AGCTTCTCTGAGGAGACAGAGGG - Exonic
967013824 3:185463981-185464003 ATAATCTATTAAGAGATATAAGG + Intronic
967802502 3:193678807-193678829 AGCATCTTTGAAGAGAGAAAGGG - Intronic
969030962 4:4213703-4213725 AGCATCCATCAACAGATAGATGG - Intronic
969959907 4:10933979-10934001 TGCAGCTCTGAAGACATAGAGGG - Intergenic
970206144 4:13657491-13657513 CGCGTCTATAAAGAGAGAGAAGG + Intergenic
970411292 4:15810399-15810421 AGCATCTTTGCAGACAAAGATGG - Intronic
970779372 4:19717798-19717820 AGAAAATATGAAGAGAGAGAAGG - Intergenic
972293977 4:37718900-37718922 AACATCTATGGACAGAAAGAAGG + Intergenic
972442159 4:39105087-39105109 ACCACATATGAAGAGATAAAAGG - Intronic
973222368 4:47743251-47743273 AGCATCTATGATGGAATAGAAGG - Intronic
974490398 4:62557287-62557309 AGAAACTATGAGGAGATATATGG - Intergenic
976008170 4:80455558-80455580 AGGATTTATAAAAAGATAGATGG + Intronic
977224590 4:94380234-94380256 AGCATCTATGAAACGATGGCAGG + Intergenic
977275027 4:94966934-94966956 AAGTTCTATGAAGAGAGAGACGG + Intronic
978268697 4:106860602-106860624 AACATCTATAAAGAAATGGAAGG + Intergenic
978661448 4:111131780-111131802 AGTATCCATTAAGAGATAAATGG - Intergenic
980474327 4:133292031-133292053 AGCATATATCAAGAGAAAGCTGG + Intergenic
980962161 4:139485899-139485921 ATCCACTAGGAAGAGATAGATGG - Intergenic
982155097 4:152511435-152511457 AGCATAAAGGAAGAGATAAAGGG - Intronic
982459645 4:155652743-155652765 AGAAGCTATGGAGACATAGAGGG + Intergenic
982480401 4:155902122-155902144 AACAACTATGTAGAGAAAGAGGG + Intronic
982713861 4:158786046-158786068 AGGTTCTAGGAAGAGACAGATGG - Intronic
982978724 4:162103549-162103571 AGCATCCTTGAACAGAGAGATGG - Intronic
983133095 4:164045941-164045963 AGCATCCATGAAGTGACAGCAGG - Intronic
983411587 4:167405173-167405195 ATCAGCAATGAAGAGATGGAAGG - Intergenic
986247916 5:6028040-6028062 AGCATCTATTGAGTGATAAAAGG - Intergenic
986303796 5:6500520-6500542 AGAATATAGGTAGAGATAGATGG + Intergenic
988274259 5:29059947-29059969 AGCATCTATGGACAGATAGGTGG - Intergenic
989071691 5:37518594-37518616 AGCATCCATCAACAGATAAATGG - Intronic
989286137 5:39702105-39702127 AGCATCTGAGAGGAGAGAGAAGG + Intergenic
989426206 5:41298984-41299006 AGGATCTATCAAAAGAAAGATGG + Intergenic
989594194 5:43141198-43141220 AACATTTGTGAATAGATAGATGG + Intronic
989830392 5:45910194-45910216 AGAATCTTTGAAGAGATATTTGG + Intergenic
989833207 5:45947425-45947447 AGAATCTATGAAGGGATATTTGG + Intergenic
989835440 5:45982838-45982860 AGAATCTGTGAAGAGATATTTGG + Intergenic
989836356 5:45998492-45998514 AGAATCCATGAAGGGATACAAGG + Intergenic
989836425 5:45999687-45999709 AGAATCTGTGAAGAGATATTTGG + Intergenic
989837715 5:46014337-46014359 AGCATCTGTGAAGGGATAATTGG + Intergenic
989837787 5:46015707-46015729 AGAATCTATGAAGCCATATATGG + Intergenic
989837809 5:46016050-46016072 AGAATCTGTGAAGGGATAGTTGG + Intergenic
989839278 5:46040907-46040929 AGTATCTGTGAAGGGATATATGG + Intergenic
989840112 5:46054153-46054175 AGAATCTGTGAAGAGATATTTGG + Intergenic
989841033 5:46070206-46070228 AGAATCTGTGAAGAGATATTTGG + Intergenic
989841225 5:46073647-46073669 AGAATCTATGAAGGGATATTTGG + Intergenic
989841738 5:46082890-46082912 AGAATCTATGAAGGGATATTTGG + Intergenic
989844770 5:46128225-46128247 AGAACCTGTGAAGAGATATATGG - Intergenic
989845684 5:46137642-46137664 AGAATCTGTGAAGAGATATTTGG + Intergenic
989846164 5:46145120-46145142 AGAATCTGTGAAGAGATATTTGG + Intergenic
989846539 5:46151267-46151289 AGAATCTGTGAAGAGATATTTGG + Intergenic
989847900 5:46169138-46169160 AGTATTTATGAAGAGATATTTGG + Intergenic
989849294 5:46188596-46188618 AGAATCTGTGAAGAGATATTTGG + Intergenic
989849573 5:46192696-46192718 AGGATCTATGAAGGGATATTTGG - Intergenic
989852704 5:46235271-46235293 AGGACCTATGAAGAGATATTTGG - Intergenic
989853976 5:46255414-46255436 AGTATCTATGAAGGGATATTTGG - Intergenic
989854020 5:46256116-46256138 AGAATCTGTGAAGAGATATATGG - Intergenic
989855369 5:46280436-46280458 AGAATCCAAGAAGAGATAGTTGG - Intergenic
989855440 5:46282026-46282048 AGAATCTATGAAGGGATATTTGG - Intergenic
992169951 5:74091840-74091862 AGCATCCATCAACAGATGGATGG - Intergenic
992748568 5:79841939-79841961 AGCAGCTATGAAGAGCCAAAAGG + Intergenic
992921176 5:81523000-81523022 AGCATCTAAAAACAGATAAAGGG + Intronic
993671117 5:90763126-90763148 AGCATCTAGGAATAGAAAGTGGG + Intronic
994689122 5:102994862-102994884 ATCATCTATGAAGATATAAAAGG - Intronic
994816657 5:104594547-104594569 AGCATCTATGAAGAGAGATAGGG - Intergenic
996525755 5:124477693-124477715 AGCAACAATGAAGACACAGAAGG - Intergenic
996816577 5:127580658-127580680 AGCATCTGTCAACAGATAAATGG + Intergenic
997660918 5:135588996-135589018 AGCATCACTGAAGAGAAAAAGGG + Intergenic
997863913 5:137444209-137444231 AGCATCTAGGCAGAGGTAGAAGG - Intronic
999812077 5:155137223-155137245 AGCATGTATAAACACATAGAGGG - Intergenic
1001855795 5:175009545-175009567 TGAATCAATGAATAGATAGATGG + Intergenic
1001993690 5:176136626-176136648 AGAATATATGAACACATAGAGGG - Intergenic
1006256436 6:32836194-32836216 AGTATCTATGATGACAGAGAAGG - Intronic
1006258537 6:32850132-32850154 AGCATCTTTAAAGAGAGGGAGGG + Intronic
1006771880 6:36560527-36560549 AGAATCTGTGAAGAGTCAGAAGG - Intergenic
1008170031 6:48193581-48193603 AGCATCTGTGAAAAGAGGGAAGG - Intergenic
1009062106 6:58409459-58409481 AGAATCTGTGAAGGGATATATGG - Intergenic
1009249796 6:61284020-61284042 AGAATCTGTGAAGGGATATATGG - Intergenic
1009249906 6:61285738-61285760 AGAATCTATGAAGAGATAATAGG - Intergenic
1009259095 6:61460760-61460782 AGAATCTATGAAGGGATATTTGG + Intergenic
1009262586 6:61513163-61513185 AGAATCTATGAAGGGATATTTGG + Intergenic
1009722678 6:67493995-67494017 AACATTTATGAAGAGATAAATGG - Intergenic
1010014998 6:71094491-71094513 AGTATCCATGAATGGATAGATGG + Intergenic
1012172483 6:96035473-96035495 TGCATGTATTAAGAGATAAAAGG - Intronic
1012763629 6:103334809-103334831 AGCATTTAAGAAGAAATACAGGG + Intergenic
1013165683 6:107589801-107589823 ACTATCTATGAAGAGGTAGGTGG - Intronic
1015208276 6:130666766-130666788 ATCATCTCTGCAGAGCTAGAAGG + Intergenic
1016729428 6:147412577-147412599 AGTATCTATCAATAAATAGATGG + Intergenic
1017779796 6:157706939-157706961 AGGATCTATGATGAGATAATAGG + Intronic
1018189739 6:161299994-161300016 AACATCTATCAAGAGATGAATGG + Intergenic
1018299156 6:162381664-162381686 GGCATTTATAAAGAGATAGTGGG - Intronic
1018523834 6:164685035-164685057 AGGATCTAGGAACAGATATATGG + Intergenic
1019795759 7:3047131-3047153 AGGATTGATGGAGAGATAGATGG - Intergenic
1020394596 7:7700196-7700218 GCCATCTATGAACAGAAAGAAGG - Intronic
1020418767 7:7975931-7975953 AACATTTATGAAGAGAGAAAAGG - Intronic
1021049853 7:15969671-15969693 AGCAGGTTTGAAGAGAAAGATGG + Intergenic
1021316885 7:19158651-19158673 AACATCTGTGAAAAGAAAGAGGG - Intergenic
1022116249 7:27263485-27263507 AGCTTCTTTGAAGAGACAGTAGG - Intergenic
1024963544 7:55003157-55003179 AGCTTCTATTAAAAAATAGATGG - Intergenic
1025242989 7:57293632-57293654 TGCATCTATGAAGATATCAATGG - Intergenic
1025502811 7:61326886-61326908 AGAATCTGTGAATAGATATATGG - Intergenic
1025517679 7:61673107-61673129 AGAATCTGTGAATAGATATATGG - Intergenic
1025531173 7:61886116-61886138 AGAATCTGTGAAGAGATATTTGG - Intergenic
1025531455 7:61890399-61890421 AGAATCTATGAAGGGATATATGG - Intergenic
1025533012 7:61913787-61913809 AGAATCTGTGAAGAGATATTTGG + Intergenic
1025533758 7:61922592-61922614 AGAATCTATGAAGGGATATTTGG + Intergenic
1025534055 7:61926226-61926248 AGAATCTGTGAAGAGATACTTGG + Intergenic
1025536396 7:61953557-61953579 AGAATCTACGAAGAGATATTTGG - Intergenic
1025536431 7:61954078-61954100 AGAATCTGTGAAGAGACATATGG - Intergenic
1025542004 7:62101755-62101777 AGAATCTGTGAATAGATATATGG - Intergenic
1025547332 7:62193462-62193484 AGAATCTCTGAAGGGATAGTTGG - Intergenic
1025547985 7:62201549-62201571 AGAATCTGTGAAGGGATAGTTGG - Intergenic
1025548094 7:62202918-62202940 AGAATCTATGAAGGGATATTTGG - Intergenic
1025576273 7:62646020-62646042 AGAATCTATGAAGTGATATTTGG - Intergenic
1025576634 7:62651930-62651952 AGAATCTATGAAGTGATATTTGG - Intergenic
1025577375 7:62665250-62665272 AGAATCTGTGAAGAGATATTTGG - Intergenic
1025578151 7:62674166-62674188 AGAATCTGTGAAGAGATATATGG + Intergenic
1025578638 7:62681404-62681426 AGAATCTGTGAAGAGATATTTGG + Intergenic
1025579432 7:62692948-62692970 AGAATCTGTGAAGAGATACTGGG + Intergenic
1025581111 7:62719257-62719279 AGAATCTGTGAAGAGATATTTGG + Intergenic
1025581574 7:62725806-62725828 AGAATCTGTGAAGAGATATTTGG + Intergenic
1025583638 7:62752649-62752671 AGAATCTATGAAGGGATATTTGG + Intergenic
1025587406 7:62808754-62808776 AGCATCTGTGAAGGGATATTTGG - Intergenic
1025587785 7:62814399-62814421 TGAATCTATGAAGAGATATTTGG - Intergenic
1025588254 7:62821080-62821102 AGAATCTGTGAAGAGATACTTGG + Intergenic
1025589715 7:62841910-62841932 AGAATCTGTGAAGAGATATTTGG + Intergenic
1025589757 7:62842721-62842743 AGAATCTGTGAAGAGATACTTGG + Intergenic
1025590716 7:62856981-62857003 AGAATCTATGAAGGGATATTTGG + Intergenic
1025592453 7:62879246-62879268 AGAATCTACGAAGAGATATTTGG + Intergenic
1025596581 7:62935405-62935427 AGAATCTGTGAAGAGATATTTGG - Intergenic
1025597814 7:62953011-62953033 AGAATCTGTGAAGAGATATTGGG + Intergenic
1025597841 7:62953340-62953362 AGAATCTGTGAAGAGATATTTGG + Intergenic
1025598162 7:62958311-62958333 AGAATCTGTGAGGAGATATATGG + Intergenic
1025598385 7:62961734-62961756 AGAATCTATGAAGAGATATTTGG + Intergenic
1025598412 7:62962077-62962099 AGAATCTGTGAAGAGATATTTGG + Intergenic
1025598431 7:62962418-62962440 AGAATCTGTGAAGAGATATGAGG + Intergenic
1025598499 7:62963439-62963461 AGAATCTGTGAAGAGATACTTGG + Intergenic
1025598539 7:62964125-62964147 AGAATCTGTGAAGAGATATTTGG + Intergenic
1025598678 7:62966173-62966195 AGAATCTGAGAAGAGATACAAGG + Intergenic
1025598739 7:62967202-62967224 AGAATCTGTGAAGAGATATTTGG + Intergenic
1025598945 7:62970622-62970644 AGAATCTGTGAAGAGATATTTGG + Intergenic
1025600487 7:62991302-62991324 AGAATCTATGAAGGGATACTTGG + Intergenic
1027537541 7:79423894-79423916 AACATCTAGGAAGAGTTAGGAGG + Intronic
1028503476 7:91545558-91545580 AGCATGTGTGCAGAGAAAGACGG + Intergenic
1031628422 7:124017644-124017666 AGCATCCAAAAAGAGAAAGAGGG - Intergenic
1031642490 7:124181399-124181421 CCCATGTATGAAGTGATAGAGGG - Intergenic
1032757128 7:134901797-134901819 AGCCTCTGTGAAGAGACATAGGG - Intronic
1033524058 7:142192739-142192761 AGCTTCTCTGAAGAGAAAGATGG - Intronic
1034754223 7:153599634-153599656 AGCATCTCAGAAGAGACAAAAGG - Intergenic
1035176316 7:157054581-157054603 AGGACCTCTGAAGAGACAGAAGG - Intergenic
1039545508 8:38407987-38408009 AGAATCTATGAAGACACAGATGG + Intronic
1040114365 8:43598567-43598589 AGAATCTGTGAAGAGATATTTGG + Intergenic
1040117370 8:43638406-43638428 AGAATCTATGAAGAGACATTTGG + Intergenic
1040124031 8:43715938-43715960 AGAATCTATGAAGAGACATTTGG + Intergenic
1040124568 8:43722491-43722513 AGAATCTGTGAAGAGATATTTGG + Intergenic
1040127300 8:43752534-43752556 AGCATCTGTGAAGAGACATTTGG + Intergenic
1040913812 8:52547604-52547626 AGCATCTACAATGAGATAAATGG + Intronic
1041591829 8:59595902-59595924 AGCATCTATCCAAAGATAAATGG + Intergenic
1042632606 8:70836004-70836026 AGAATCTATGGACAGATATATGG - Intergenic
1043648379 8:82553951-82553973 GGCATCTATCTAGAGAGAGAAGG - Intergenic
1044028481 8:87204317-87204339 AGCCTCCATTAAGAGAGAGATGG - Intronic
1044632300 8:94291708-94291730 TGCATCTATGAAGAGCAGGATGG + Intergenic
1045962954 8:107990052-107990074 AGAATATCTGAAGAGATAAAGGG + Intronic
1046413658 8:113882208-113882230 ATTATCTATCAAGAGAAAGATGG + Intergenic
1047478467 8:125258065-125258087 AGCATCTATTCAGAGATAGAAGG + Intronic
1050494945 9:6230731-6230753 AGGATCTATGAGGATATAGTGGG - Intronic
1050791671 9:9479119-9479141 TGCATCTAAGAAGAACTAGATGG + Intronic
1051792144 9:20817423-20817445 AGGCTGTATGTAGAGATAGAAGG - Intronic
1053487165 9:38468492-38468514 AGAAAATATGAGGAGATAGATGG - Intergenic
1054362505 9:64189652-64189674 AGAATCTATGAAGGGATATTTGG + Intergenic
1055157574 9:73082885-73082907 AGTATATATTAAGACATAGAAGG - Intergenic
1055277081 9:74630187-74630209 AACATCAAGGCAGAGATAGATGG + Intronic
1056492948 9:87125773-87125795 AGAAGCTATGAAAAGATGGAGGG - Intergenic
1060600352 9:124873259-124873281 AGCATTGATGAAGAGTTAGGAGG + Intronic
1061287142 9:129630477-129630499 AGCAACTATGAGGAAAGAGAAGG - Intronic
1185750538 X:2607363-2607385 AGGATGGATAAAGAGATAGATGG - Intergenic
1187354755 X:18557458-18557480 AGTATCTACGAGGATATAGAGGG - Intronic
1188779120 X:34258457-34258479 AGCATCTATAAAGGCATGGAAGG - Intergenic
1190019742 X:46863286-46863308 AGCATATATGTGCAGATAGATGG + Intronic
1191131418 X:57015640-57015662 AGCATCTATCAACAGATGAATGG - Intergenic
1191260044 X:58308202-58308224 AGCATCTATGAAGAAACATTTGG + Intergenic
1191261731 X:58329988-58330010 AGAATCTGTGAAGAGATACAGGG + Intergenic
1191265617 X:58389059-58389081 AGTATCTGTGAAGAGATATTTGG - Intergenic
1191267278 X:58410968-58410990 AGAATCTATGAAGGGATATTTGG - Intergenic
1191269006 X:58437698-58437720 AGAATCTGTGAAGAGATATTTGG - Intergenic
1191269118 X:58439586-58439608 AGCATCTGTGAAGGGATATTTGG - Intergenic
1191575370 X:62698454-62698476 AGAATCTGTGAAGAGATATTTGG - Intergenic
1191577934 X:62727374-62727396 AGAATCTATGAAGGGATATTTGG - Intergenic
1191579931 X:62749545-62749567 AGAATCTATGAAGGGATATTTGG - Intergenic
1191583216 X:62788924-62788946 AGAATCTGTGAAGAGATATTTGG - Intergenic
1191583731 X:62795475-62795497 AGAATCTATGAAGGGATATTTGG - Intergenic
1193550496 X:82886671-82886693 AGCATCCATCAACAGATAAATGG - Intergenic
1194001094 X:88429429-88429451 AGCATCAATGAGGATATTGATGG - Intergenic
1194511886 X:94806745-94806767 TGGATCTATGAACACATAGAAGG - Intergenic
1194915250 X:99699243-99699265 GATATCTATGAAGAGGTAGAAGG + Intergenic
1195050658 X:101093841-101093863 ACCATCTGTGAAGAGAAAGTGGG - Intronic
1195928095 X:110046550-110046572 AGCATTTATTAACAGAAAGAAGG - Intronic
1196216990 X:113064748-113064770 AGCATCCATAAACAGATAAATGG - Intergenic
1196399776 X:115302000-115302022 ATAATCTATAAAGAGTTAGAAGG + Exonic
1196605235 X:117650066-117650088 AGCATCTATCAACAGATGAATGG + Intergenic
1197505827 X:127303678-127303700 AGCATTTATGCAGTGAGAGAAGG + Intergenic
1198763089 X:140054046-140054068 GGCCTCTGTGAAAAGATAGAGGG - Intergenic
1201579725 Y:15498435-15498457 AGCACCTATCAACAGATAAATGG - Intergenic