ID: 1174226773

View in Genome Browser
Species Human (GRCh38)
Location 20:49006968-49006990
Sequence CTCCAATGGCAGGCCGGCCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 149
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 142}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174226773_1174226778 18 Left 1174226773 20:49006968-49006990 CCGTGGCCGGCCTGCCATTGGAG 0: 1
1: 0
2: 1
3: 5
4: 142
Right 1174226778 20:49007009-49007031 GAAATGATCTGACATTTTAAAGG 0: 1
1: 0
2: 6
3: 53
4: 355

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174226773 Original CRISPR CTCCAATGGCAGGCCGGCCA CGG (reversed) Intronic
900392720 1:2440689-2440711 ATCCCCGGGCAGGCCGGCCAAGG - Intronic
902191906 1:14769642-14769664 CTGGAAGGGCAGGCCGGGCACGG - Intronic
904612636 1:31733804-31733826 CTCCCCTGGCAGGGAGGCCAGGG - Intronic
910846165 1:91606497-91606519 CCCCAAAGGCAGGCTGGACAAGG - Intergenic
914454614 1:147824297-147824319 CTCACATGGCAGGCAGTCCAAGG + Intergenic
918145476 1:181752297-181752319 CTCCAAAGGCAGGCCAGCCATGG - Intronic
920050326 1:203160953-203160975 CTCCTATGGCAGCCCTGCCAGGG + Intronic
920751890 1:208686126-208686148 CTCCACTAGCAGGCTGGCCTGGG + Intergenic
922009531 1:221567961-221567983 CTCCAATGCCAGGCTGCCCAGGG - Intergenic
924111197 1:240701492-240701514 CTCCAGTACCAGGCCGGGCATGG - Intergenic
1064214248 10:13386311-13386333 CTCCGCAGGCAGGACGGCCAGGG + Intergenic
1067697387 10:48545747-48545769 CTCCAAGGGCAGGCTGGATAAGG + Intronic
1070368177 10:75756468-75756490 GTCTAAAGGCAGGCAGGCCAAGG - Intronic
1071816032 10:89233607-89233629 AAGCAATGGCAGGCCGGGCACGG + Intronic
1073193964 10:101672914-101672936 CTCCAGGGACAGGACGGCCAAGG - Exonic
1077504704 11:2924600-2924622 CTCCCTTGGCAGGCCTGGCAGGG + Intronic
1080368681 11:31609083-31609105 CTTCATTGGCAGGCTGGACAAGG + Intronic
1080435080 11:32232665-32232687 CTACAAAGTCAGGCCGGGCACGG + Intergenic
1083265989 11:61547013-61547035 CCCCATGGGCAGGCCGACCATGG - Intronic
1084439809 11:69166370-69166392 CTCCACATGCAGACCGGCCATGG - Intergenic
1085736735 11:79045570-79045592 CTCCAGTAGCAGCCAGGCCAGGG - Intronic
1088619944 11:111671555-111671577 CTCCAATCACAGCCAGGCCAAGG - Intronic
1089268270 11:117282451-117282473 CTCCATGGTCAGGCCTGCCATGG - Exonic
1089495276 11:118905216-118905238 ATCTAAGGGCAGGCCGGGCACGG + Intronic
1089684720 11:120139401-120139423 CTCCAAGGCCAGGCTGGGCAGGG + Intronic
1091339409 11:134798674-134798696 CTCCAGGAGCTGGCCGGCCAGGG - Intergenic
1091545042 12:1496035-1496057 CTCCAATGGCAGGCAGCCCGAGG + Intergenic
1096783863 12:54006173-54006195 CTCAAATGTCAGTGCGGCCAGGG - Intronic
1097685747 12:62689370-62689392 CTTCAATGGCAGCCCAGGCATGG - Intronic
1101529099 12:105558123-105558145 CTCCAATGCCAAGTCAGCCAAGG + Intergenic
1101529210 12:105558946-105558968 CTCCAATGCCAAGTCAGCCAAGG - Intergenic
1103283332 12:119778928-119778950 CTCACAGGGCAGGCCGGGCATGG + Intronic
1105548787 13:21372077-21372099 ATCAAATTGCAGGCCGGGCACGG - Intergenic
1107905012 13:45053683-45053705 CTCAAATGCCAGCCCTGCCAGGG - Intergenic
1108402297 13:50058470-50058492 CTCCCATGACAGGCCTGGCATGG - Intergenic
1113355207 13:109572578-109572600 CAGCAAAGGCCGGCCGGCCAGGG - Intergenic
1114769110 14:25408570-25408592 CTGCAGTGGCGGGCCGGGCACGG - Intergenic
1118313050 14:64706895-64706917 CTCCAAGGCCAGGGCGGCCTGGG - Intronic
1127807823 15:62537303-62537325 CTACAATGACAGGCCGGGCGCGG - Intronic
1132861135 16:2072367-2072389 CCCCAACCCCAGGCCGGCCATGG - Intronic
1133783139 16:8954683-8954705 CAGCAATTGCAGGCCGGGCACGG + Intronic
1135794115 16:25424970-25424992 TTCCCATGCCAGGCCGGGCACGG - Intergenic
1137248745 16:46727815-46727837 CCCCAATGGCAGGCCCGGCGGGG - Intronic
1137605834 16:49786299-49786321 CCCCACTGGCAGGGTGGCCAGGG + Intronic
1137611080 16:49818047-49818069 ATCCAGTGCCAGGCCTGCCATGG + Intronic
1141410538 16:83829992-83830014 GCCCTATGGCAGTCCGGCCAAGG + Intergenic
1141428704 16:83959860-83959882 CTCAAATGTCAGTGCGGCCAAGG + Intronic
1142594368 17:1022384-1022406 CCCCAATGACAGGCCGGCTTCGG - Intronic
1143938959 17:10518406-10518428 CTTCACTGGCAGGGCTGCCAGGG + Intronic
1144545276 17:16189101-16189123 ATCAAATAGCAGGCCGGGCATGG + Intronic
1145758263 17:27408668-27408690 CTCCAAAGGCATTCCTGCCAAGG + Intergenic
1147659216 17:42108235-42108257 CTCCAGAGGGAGGCCGGCTAGGG + Intronic
1147671556 17:42179865-42179887 CTCCAATGGGTGGGAGGCCAGGG + Intronic
1148291858 17:46458829-46458851 TTCCCATGGGAGGCCGGGCACGG - Intergenic
1148314048 17:46676520-46676542 TTCCCATGGGAGGCCGGGCATGG - Intronic
1148579611 17:48734570-48734592 CTCCAACAACAGGGCGGCCACGG + Intergenic
1148972934 17:51500110-51500132 CTGCAAGGGCAGCCAGGCCAAGG - Intergenic
1149647898 17:58253651-58253673 CTGCAATGTCAGGGTGGCCAGGG - Intronic
1152555064 17:81048984-81049006 CTTCATAGGCAGGCCGGCCCAGG + Intronic
1157097323 18:44697744-44697766 GTGCAATGTCAGTCCGGCCAAGG + Intronic
1160197786 18:76770921-76770943 CTTCACTTGCAGCCCGGCCACGG + Intergenic
1160464248 18:79062895-79062917 TTCCAAGGGAAGGCCGGGCAAGG + Intergenic
1160891460 19:1380842-1380864 ATCTAAGGGCAGCCCGGCCAGGG + Intergenic
1167440594 19:49506572-49506594 CCCCAATTGCAGGCCGGGCACGG - Intergenic
925379859 2:3417203-3417225 CACCCAGGGCAGGCCGGACATGG - Intronic
926707011 2:15844139-15844161 CTCAAGTGCCAGGCAGGCCAAGG + Intergenic
928263286 2:29787083-29787105 CTCCCAGGGAAGGCCGGGCATGG - Intronic
929004047 2:37378500-37378522 GGCCAATGGCAGTCAGGCCAAGG - Intergenic
931877156 2:66526383-66526405 CACCCATGGCAGGCCGGGCCTGG + Intronic
932467940 2:71935362-71935384 CTCCCCTGGCAGGCCTACCAGGG + Intergenic
932746155 2:74335285-74335307 CTCCAGTGGCAGCTCTGCCAAGG - Intronic
932774183 2:74517335-74517357 GTCCAAGGGCAGGCAGGGCACGG + Intergenic
934696391 2:96403700-96403722 CTCCAAGGGCAAGCCAGACATGG + Intergenic
937997697 2:127707692-127707714 ATCAAATGGCAGGCCAGGCATGG + Intronic
947611734 2:231528924-231528946 TTGCAATGGCAGTGCGGCCAGGG - Exonic
948597714 2:239091236-239091258 CTCCTATGGGAGTCTGGCCAGGG + Intronic
1172596624 20:36154820-36154842 CTCCTCTGGCAGGCAGGCCGCGG - Exonic
1173839107 20:46145640-46145662 CTCCCATGACAGGCCTGACAAGG - Intergenic
1174226773 20:49006968-49006990 CTCCAATGGCAGGCCGGCCACGG - Intronic
1174484538 20:50852883-50852905 CTCAAATGCCAGGCTGGGCAGGG - Intronic
1175085540 20:56455637-56455659 CTCACATGGCTGGCCGGGCATGG + Intronic
1175133002 20:56803513-56803535 CTCCAGTGGTTGGCCGGGCATGG + Intergenic
1175905338 20:62376801-62376823 CTCCAGGGGCAGGGTGGCCAGGG - Intergenic
1175983662 20:62753762-62753784 CTCCATTGGAAGCCGGGCCATGG + Intronic
1179921804 21:44511678-44511700 CTCCACTGGAAGGACGCCCAGGG - Intronic
1181491615 22:23263774-23263796 CTCCAGGGACAGGACGGCCAAGG + Intronic
1184696756 22:46143698-46143720 GTCCAATGTCATGCCAGCCAAGG + Intergenic
950095855 3:10329973-10329995 CTCCAATAACTGGCCGGCCAGGG - Intronic
950787125 3:15446222-15446244 CTCGAACAGCAGGCCGGGCACGG + Intronic
954367267 3:50153224-50153246 CTTCAATGGCAGGGAGACCAGGG - Intergenic
958930686 3:100204593-100204615 GTCCAAAGACAGGCCGGGCATGG - Intergenic
962299685 3:134227961-134227983 CTCCAAAGTCAGGCCAGGCACGG - Intronic
963164167 3:142183887-142183909 TTCCTAAGGCAGGCCGGGCATGG - Intronic
964991074 3:162813473-162813495 GTCCAATTTCAGACCGGCCACGG + Intergenic
969632172 4:8345192-8345214 CTCCCAGGGCAGCCCGGCCGTGG + Intergenic
969846818 4:9925910-9925932 TTCCAATGGCAGGCTCCCCATGG + Intronic
970654140 4:18212874-18212896 CTCCAAGGGCATGCAGCCCAGGG - Intergenic
974396176 4:61337970-61337992 CTGCCATGACAGGCCGGGCACGG + Intronic
982504396 4:156198749-156198771 TTCCACTGGCAGGCTCGCCAAGG - Intergenic
984040997 4:174733667-174733689 CTGCAAAGGCAGGCAGGGCAAGG - Intronic
984881495 4:184413506-184413528 CTCCAGTAGCAGCCCTGCCAGGG + Intronic
985509551 5:305087-305109 CTCCAGGGGCAGGCAGGCCTGGG + Intronic
985738724 5:1601804-1601826 CTCCAGGGGCAGGCAGGCCTGGG - Intergenic
985923288 5:2996335-2996357 CTCCAATGGCAGAGCTGCGAGGG + Intergenic
990925961 5:61022933-61022955 CACTAAAGGCAGGCCGGGCATGG - Intronic
992110204 5:73485662-73485684 CACCAATGGCAAGGTGGCCATGG - Intergenic
997625594 5:135328698-135328720 CTCCATTCCCAGGCCTGCCAAGG + Intronic
998143781 5:139714107-139714129 CTCCCATGCCAGGCCGGGCGCGG - Intergenic
1002898534 6:1392822-1392844 CTCCCAGGGAAGGCCGGCCGCGG - Intronic
1002957871 6:1885784-1885806 CTGCAGTGGCAGGCTGGCCTGGG + Intronic
1003095063 6:3135982-3136004 CTCCAAAGGCAGGCCTGCTCTGG - Intronic
1003464284 6:6363688-6363710 AGCCAATGGCAGCCTGGCCATGG - Intergenic
1005296921 6:24435964-24435986 CTCCAGTGGCTGGCCGAGCATGG + Intronic
1013552005 6:111217094-111217116 CTCCAATAGCAGTCAGGCTAGGG - Intronic
1013773328 6:113651238-113651260 CACCAGTGGCAGGCCAGCCTGGG - Intergenic
1016451502 6:144187483-144187505 CTCAAGTAGCAGGCCGGCCCGGG + Exonic
1017732911 6:157333784-157333806 CTCCAAGAGCAGGCAGGCGAAGG + Intergenic
1018557512 6:165064253-165064275 CACCACTGGCAGTCCGGCCTGGG + Intergenic
1019158983 6:170057165-170057187 TCCCAAGGGCAGGCTGGCCATGG - Intergenic
1020010523 7:4803569-4803591 CCCCACTGCCAGGCCTGCCAGGG + Exonic
1024081985 7:45863754-45863776 CAACAATGGCAGGCCCACCATGG + Intergenic
1024880964 7:54084569-54084591 CTCCAGTGGCAGGCTGACCTTGG - Intergenic
1026932564 7:74231968-74231990 CTCCAGTGGCTGGCCAGGCACGG - Exonic
1030400252 7:109040396-109040418 GTACCATGGCAGGCCGGGCACGG + Intergenic
1032399183 7:131611764-131611786 CTGCAGGGGCAGGCCGGGCATGG - Intergenic
1033651555 7:143347328-143347350 CTAAAATGGGAGGCCGGGCATGG + Intronic
1034344171 7:150375872-150375894 GTCCTACAGCAGGCCGGCCAGGG - Intronic
1038984426 8:32793110-32793132 CTCAAATGGCAGAAGGGCCAAGG + Intergenic
1039831102 8:41215696-41215718 CTGTAATGGCAGGAAGGCCAAGG + Intergenic
1040865783 8:52047813-52047835 TTCCAAAAGCTGGCCGGCCATGG + Intergenic
1045124887 8:99078765-99078787 CTCCAGTGGCAGGCCAGCAGTGG + Intronic
1046125660 8:109903822-109903844 CCTCAATGGATGGCCGGCCATGG + Intergenic
1049503999 8:142985225-142985247 CTCCCTTGCCAGGCAGGCCATGG - Intergenic
1051145373 9:14021741-14021763 ATCCAATAGCATGCCGTCCATGG - Intergenic
1051601726 9:18881849-18881871 TTCGAAGGGCAGGCCTGCCATGG - Intronic
1056539655 9:87560284-87560306 TTCCAAGGGCAGGCTGGGCATGG - Intronic
1057192912 9:93097126-93097148 ACCCCATGGCAGCCCGGCCAGGG + Intronic
1059067563 9:111101635-111101657 CTTCAAATGCAGGCCGGGCATGG - Intergenic
1059718154 9:116932713-116932735 CTGCAATTCCAGGCCGGGCATGG + Intronic
1059964184 9:119597514-119597536 CTCCATTGGCAGGACACCCAGGG - Intergenic
1060363516 9:122984546-122984568 CTCCAATGGACGACCAGCCAGGG + Exonic
1061427534 9:130509240-130509262 CACCAGTGGAAGGCCAGCCATGG + Intergenic
1061878821 9:133558221-133558243 CTTTGATGGCAGGCCGGCCGGGG - Intronic
1062288402 9:135783958-135783980 CTCCAGTGGCACGGCAGCCACGG - Intronic
1062422252 9:136488440-136488462 ATCCGATGCCAGGCTGGCCATGG + Intergenic
1062501151 9:136852593-136852615 CCCCCCTTGCAGGCCGGCCAAGG - Intronic
1188054205 X:25522670-25522692 GTCCAAAGGCAGGCCGGGCGCGG - Intergenic
1188744207 X:33821787-33821809 GTCCAATGGAAGGGAGGCCACGG - Intergenic
1192144527 X:68672720-68672742 CCCCCATGGCAGGGCAGCCAAGG + Intronic