ID: 1174236265

View in Genome Browser
Species Human (GRCh38)
Location 20:49094993-49095015
Sequence AAATGGAGACTTTAATGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 282
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 265}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174236259_1174236265 20 Left 1174236259 20:49094950-49094972 CCTGTCCAGGAAGGGTAAGTGTG 0: 1
1: 0
2: 0
3: 12
4: 97
Right 1174236265 20:49094993-49095015 AAATGGAGACTTTAATGGGAGGG 0: 1
1: 0
2: 1
3: 15
4: 265
1174236260_1174236265 15 Left 1174236260 20:49094955-49094977 CCAGGAAGGGTAAGTGTGTTGTC 0: 1
1: 0
2: 1
3: 12
4: 159
Right 1174236265 20:49094993-49095015 AAATGGAGACTTTAATGGGAGGG 0: 1
1: 0
2: 1
3: 15
4: 265
1174236258_1174236265 23 Left 1174236258 20:49094947-49094969 CCGCCTGTCCAGGAAGGGTAAGT 0: 1
1: 0
2: 0
3: 12
4: 120
Right 1174236265 20:49094993-49095015 AAATGGAGACTTTAATGGGAGGG 0: 1
1: 0
2: 1
3: 15
4: 265

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174236265 Original CRISPR AAATGGAGACTTTAATGGGA GGG Intronic
900191122 1:1352699-1352721 AGATGGGGACTTTATTGTGATGG + Exonic
902380765 1:16051236-16051258 AAATGGGGTGTTTACTGGGAAGG + Intronic
905401091 1:37703839-37703861 AAAATGATTCTTTAATGGGAGGG + Intronic
906748237 1:48236408-48236430 CAATGGAGATTTTCATAGGAGGG + Intronic
907700651 1:56784650-56784672 AAAAGGAGACTCTAAAGAGAAGG - Intronic
907795609 1:57713532-57713554 AAAGGGAAGCTATAATGGGAAGG + Intronic
907846614 1:58214184-58214206 ACTTGGAGGCTTTAATGGCAGGG - Intronic
909205124 1:72746204-72746226 AAATAGAAACTCTAATTGGAAGG - Intergenic
909712593 1:78668761-78668783 AAATGGAATATTTACTGGGATGG + Intergenic
909990735 1:82220082-82220104 AAATAGAGACTTTGTTGGGGTGG + Intergenic
910215810 1:84843181-84843203 AAATGGAGTTTTAAATGTGAAGG - Intronic
915060582 1:153180071-153180093 AAAAGGTTACTTTAAAGGGAAGG - Intergenic
916611586 1:166397004-166397026 AAATGGAAACATTGATAGGATGG + Intergenic
919441838 1:197644132-197644154 ATATGGAGAGTTGAATTGGAAGG - Intronic
919827531 1:201514054-201514076 GAATGGAGACTTTACAGGGAGGG + Intergenic
921899044 1:220431072-220431094 AAATAGATCCTTTAATAGGAAGG + Intergenic
922392125 1:225155691-225155713 AAATGGAAACTCTAATTGAAGGG - Intronic
923129371 1:231061856-231061878 AACTGGAAAATTGAATGGGAGGG + Intergenic
923593012 1:235336979-235337001 AAATGGAGAATTCAAAGGGAAGG + Intronic
924151710 1:241136388-241136410 CAGTGGAGACTTTCATTGGATGG + Intronic
1063699894 10:8374103-8374125 ATATGCAGACAGTAATGGGATGG + Intergenic
1063826519 10:9904563-9904585 AAATGGAAAATTAGATGGGAAGG - Intergenic
1064753343 10:18554041-18554063 AAATGGAGAATGGAATGGAATGG + Intronic
1064753348 10:18554080-18554102 GAATGGAGACTGGAATGGAATGG + Intronic
1064753493 10:18555121-18555143 AAATGGAGAATGTAATGTAATGG + Intronic
1064753686 10:18556459-18556481 AAATGGAGAATGGAATGGAATGG + Intronic
1064754658 10:18563157-18563179 AAATGGAGAATGGAATGGAATGG + Intronic
1064754898 10:18564860-18564882 GAATGGAGACTGGAATGGAATGG - Intronic
1064754911 10:18564975-18564997 AAATGGAGAATGGAATGGAATGG - Intronic
1064755160 10:18566661-18566683 AAATGGAGCATTCAATGGAATGG - Intronic
1064755403 10:18568401-18568423 AAATGGAGAATGGAATGGAATGG - Intronic
1064755475 10:18568909-18568931 AAATGGAGAATGGAATGGAATGG - Intronic
1064755498 10:18569043-18569065 AAATGGAGAATTGATTGGAATGG - Intronic
1064756155 10:18573285-18573307 GAATGGAGAATGGAATGGGATGG - Intronic
1065236983 10:23662093-23662115 AAATGGAAAACTTAATGGTATGG + Intergenic
1069173440 10:65261561-65261583 AAATCTAGAATTTAATGGTAAGG + Intergenic
1069319271 10:67147958-67147980 AAAAGCAGAAATTAATGGGATGG + Intronic
1073850752 10:107615012-107615034 AAGTAAAGCCTTTAATGGGAGGG + Intergenic
1073869324 10:107844640-107844662 AAATGAAGTCTTTAATGGTGTGG - Intergenic
1075971871 10:126661750-126661772 AAATGGAAATTTTACTGGGTGGG - Intronic
1077846588 11:6031907-6031929 AAAGGGAGACATAAATGGAAGGG + Intergenic
1078674041 11:13392745-13392767 TAATGAAGTCTTTAATTGGATGG - Intronic
1078946318 11:16071799-16071821 ACATGGAGACAGTAATTGGAGGG + Intronic
1079871457 11:25803140-25803162 AAACGAATACTTTAATGGAAGGG + Intergenic
1080022674 11:27579699-27579721 AAATGAAGAATTTATTGGAAGGG + Intergenic
1080862584 11:36162844-36162866 AAAGGGAGACTGTCATGAGAAGG - Intronic
1081284182 11:41247030-41247052 AAATGAAGGCTGTAATGAGAAGG - Intronic
1081306219 11:41515370-41515392 AAGTGGAAACTTTCCTGGGAGGG - Intergenic
1081931983 11:46877800-46877822 AAATGGGGACAATAATGGGGTGG + Intronic
1081933658 11:46889848-46889870 AAATGGCAACTCTAAGGGGAAGG + Intronic
1082275194 11:50213781-50213803 AAATCTAGAGTTTAAGGGGAAGG - Intergenic
1085483078 11:76838660-76838682 AAATGGAGATTTTCACTGGATGG + Intergenic
1086169293 11:83817473-83817495 GAATTGAGACTTTATTTGGATGG + Intronic
1086974875 11:93120165-93120187 AAATGGAGACTATAATTAGTAGG + Intergenic
1087238939 11:95753952-95753974 AAATGGAGATTTTTATCTGAAGG - Intergenic
1087245374 11:95829258-95829280 AATTGGAGGCATTAGTGGGAAGG + Exonic
1088348811 11:108861633-108861655 AAAGGGAGTCATTACTGGGAAGG + Intronic
1088767399 11:112996899-112996921 AAATGCAGACATTACTGGTAAGG + Intronic
1090685918 11:129119339-129119361 AAATTGAGACTTAAACAGGATGG + Intronic
1091169783 11:133509814-133509836 AAATGGAGACTTACATAGAAAGG - Intronic
1091709953 12:2732652-2732674 AAATTGAGAATTTAGAGGGAGGG - Intergenic
1092599725 12:10046717-10046739 AAATGCTGACGTTAGTGGGAAGG + Intronic
1092840453 12:12535545-12535567 AAATTGAGACTTTGATAGGAAGG - Intronic
1093673592 12:21906459-21906481 AAATAAAGAGTTTAATGAGATGG + Intronic
1094050414 12:26214459-26214481 AAATGGAGACAATAATGTCATGG - Intronic
1095472865 12:42554926-42554948 ATATGGACACTTAGATGGGATGG + Intronic
1096361958 12:50995564-50995586 AAGTGAAGACTGCAATGGGATGG - Intronic
1096836880 12:54356850-54356872 AATTGGAAATTTTAGTGGGAAGG + Intergenic
1097382097 12:58907484-58907506 AAGTGGATTCTTGAATGGGAGGG - Intronic
1099288252 12:80742702-80742724 AAAGGGAGACTTCAAGGGGATGG + Intergenic
1099548768 12:84016901-84016923 AAATAAAGCCATTAATGGGATGG + Intergenic
1102353882 12:112216094-112216116 AAATGGAGGCTCTAATGGCGAGG + Intronic
1104706038 12:130948302-130948324 AAATGGAGTCTTTACTTGGCTGG - Intergenic
1107062516 13:36174975-36174997 AAATGGAGACTATATAGGGAGGG - Intronic
1109225909 13:59695179-59695201 AAAGTGGGCCTTTAATGGGATGG - Intronic
1110649854 13:77931209-77931231 AAATAAAGACATTAATGGAAAGG + Intergenic
1111672151 13:91346179-91346201 CAATGTTGACTTTAATTGGAAGG + Intergenic
1113320845 13:109230531-109230553 TGATGGAGACTTGGATGGGATGG + Intergenic
1120568335 14:86086659-86086681 AAATTGAGAAATTAATGTGATGG - Intergenic
1121738871 14:96237579-96237601 AAAGAGAGAATTTAAGGGGAGGG + Intronic
1121747708 14:96312973-96312995 AAATTGAGACTTTAATAAAATGG + Intronic
1121809170 14:96865194-96865216 AACTGTAGACTTAAATGTGATGG - Intronic
1122136198 14:99634296-99634318 AAATGGAAAATATAATGGAAAGG - Intergenic
1126635379 15:50774780-50774802 AAATGTTGACTTGAATGGCAGGG + Intergenic
1126899444 15:53298190-53298212 AGATGAAGACTTGAATGTGATGG + Intergenic
1128666335 15:69540778-69540800 AAATGGAGCCTCTAATGGATGGG + Intergenic
1129068161 15:72927093-72927115 AAATGAAGACTAAAATGGAAGGG - Intergenic
1129513682 15:76143319-76143341 AGATTGAGACATGAATGGGAGGG - Intronic
1130008648 15:80128754-80128776 AAATGCAGTCTTTAAAGTGAAGG - Intronic
1130780423 15:87032302-87032324 AAATGGAGAAAGTAAGGGGAAGG + Intergenic
1131631567 15:94182131-94182153 AAATGAAGACTTTTATGGCTGGG + Intergenic
1135215606 16:20564657-20564679 ACATGGAGAAGGTAATGGGATGG - Exonic
1136087467 16:27895816-27895838 CAGTGGATACTTTAGTGGGATGG + Intronic
1140282846 16:73570536-73570558 AAATGGCGACTTTCATGATATGG + Intergenic
1146172390 17:30644057-30644079 AAATGGGGAATTTCATTGGAAGG + Intergenic
1146345844 17:32060068-32060090 AAATGGGGAATTTCATTGGAAGG + Intergenic
1146548798 17:33762492-33762514 AAATGGTGACTATAATGGTCTGG - Intronic
1149287458 17:55180589-55180611 AAATGGAGACTTTACAGGTAAGG + Intergenic
1149924528 17:60689745-60689767 AAATGCAGATTTAAATGGTATGG + Exonic
1152784134 17:82239286-82239308 ACAACGTGACTTTAATGGGAGGG + Exonic
1155327224 18:24676834-24676856 GAATGGAGAGTTGAATGGTAGGG + Intergenic
1155493613 18:26422474-26422496 AAAGGGAGTCTTTAGGGGGAGGG - Intergenic
1156009850 18:32484070-32484092 AAATGGAAACTTTTATTGGTTGG + Intergenic
1157281178 18:46347317-46347339 GGATGGAGACTGGAATGGGAGGG - Intronic
1158281863 18:55837057-55837079 AAAGGGACACTTTAATGACATGG + Intergenic
1158339007 18:56445486-56445508 AAAAGGAGACTTTAAAGAGGTGG + Intergenic
1159196741 18:65125504-65125526 AAAGGGAAAGGTTAATGGGATGG + Intergenic
1159345629 18:67199793-67199815 AAATGGAGATTTAAATGTGAGGG + Intergenic
1159934945 18:74357150-74357172 AACTGGAGCCTTTATTGGGGTGG + Exonic
1160352293 18:78193856-78193878 ACATGCAGACTTCAATAGGATGG - Intergenic
1162951532 19:14074273-14074295 GAATGGAGGCTTTCATGGGGAGG + Intronic
1164966137 19:32486205-32486227 AAATGGAGATTATATTGGGTGGG - Intergenic
1164966477 19:32489266-32489288 AAATGGAGATTATATTGGGTGGG - Intergenic
1166864120 19:45825890-45825912 AAATGGACCATTAAATGGGAAGG - Intronic
927478019 2:23428874-23428896 AAAAGGAGACTTAAAGGGAAAGG - Intronic
929400450 2:41574267-41574289 AGATGGGGACTTTCATGGAATGG + Intergenic
931139498 2:59441403-59441425 AAATGGAGATATTGCTGGGATGG - Intergenic
933186178 2:79281367-79281389 AAATGGAGCCGTTAAAGGGGAGG - Intronic
933225431 2:79743499-79743521 AAATGGAAAATTTTATGTGAGGG - Intronic
933440710 2:82310376-82310398 AAATGAAGGCTTTAATGACAAGG + Intergenic
934569627 2:95360946-95360968 AAATGGAGACTTTGATGGGGAGG + Intronic
935108010 2:100063632-100063654 AAATGGAGAATACAATGAGAAGG + Intronic
935311855 2:101792166-101792188 GAATGGAGACTTTGGTAGGAAGG - Intronic
935487778 2:103678927-103678949 GAAAGGAGACTTGAATAGGATGG + Intergenic
935514815 2:104022732-104022754 ACATGAAGACTTGAAGGGGAGGG + Intergenic
935787655 2:106563505-106563527 GAAAGGAGACTTTAATGAGAAGG + Intergenic
937796844 2:126033426-126033448 AACTGGTGACTTTAAGGTGAAGG + Intergenic
937937099 2:127255158-127255180 AAAGGGAGACTTTATTTGAAAGG + Intergenic
939513138 2:143131930-143131952 AAATGGATACATCACTGGGATGG - Intronic
939648244 2:144728890-144728912 AAATAAAGACTTCAAAGGGATGG + Intergenic
939700179 2:145381618-145381640 AAACGTAGTCTTTAATTGGAGGG + Intergenic
940282862 2:152005505-152005527 CAATGGAGACTTCAAAAGGAGGG + Intronic
940982144 2:160015788-160015810 AAATGAAGATTCTAAGGGGATGG + Intronic
941034497 2:160553421-160553443 AAATGGAGACTCTGAAGGGCTGG + Intergenic
941293327 2:163703375-163703397 AAATGGTTACTTTAAAAGGAAGG + Intronic
943070561 2:183136062-183136084 AAATGTAGACTTTAAAGACACGG - Intronic
944894414 2:204149875-204149897 AAATGCAGAGTTTAATTGGTAGG - Intergenic
945350984 2:208779525-208779547 AAATGGAAAAATTAATGAGATGG - Intronic
946651483 2:221896464-221896486 AAATGGAGACTTAGATTAGAGGG - Intergenic
948224436 2:236298235-236298257 AAATGGAGACCTGAAAGGGAGGG - Intergenic
1169184286 20:3600726-3600748 TTATGTATACTTTAATGGGAGGG + Intronic
1169190286 20:3654608-3654630 AAATGGAGTCTTCAAGGGGCAGG - Intergenic
1170059554 20:12244977-12244999 ACATGGAGACTTTAATCTCAGGG - Intergenic
1170452123 20:16494145-16494167 AATTAGTGACTTTCATGGGATGG - Intronic
1173657148 20:44707503-44707525 AAATGGAGAAATTAATAGAAAGG + Intergenic
1174226006 20:49000783-49000805 AAATGCAGACTTTAAAGAGTTGG - Intronic
1174236265 20:49094993-49095015 AAATGGAGACTTTAATGGGAGGG + Intronic
1174405532 20:50300546-50300568 AAATGGATAATTTAATGGCTGGG + Intergenic
1174703827 20:52635812-52635834 AAATGCAGACTTTCATGCCAAGG - Intergenic
1178150600 21:29789669-29789691 AAATAGAGACTTTATTTGAAAGG - Intronic
1179658287 21:42859289-42859311 AAATGCAGCCCGTAATGGGATGG + Intronic
1184561598 22:45266937-45266959 ACATGGAGACTTGAACAGGAAGG + Intergenic
1184930322 22:47676446-47676468 AAATGTAGAATTTCAAGGGAGGG - Intergenic
949480520 3:4490158-4490180 AAATGGCCATTTTAATGGGCTGG + Intergenic
951060816 3:18204966-18204988 AAGTGGAGACCATAATGGGCAGG - Intronic
951188991 3:19747495-19747517 AGATGGGGAATTTAATGAGATGG + Intergenic
953915383 3:46916669-46916691 AATTGTACACTTTAATGGGTGGG - Intergenic
955954143 3:64271058-64271080 ATATGGAGAATATAATGAGAAGG + Intronic
956763571 3:72464800-72464822 AAATGTGGACTTTATTTGGAGGG + Intergenic
957562987 3:81847899-81847921 CAATGGAGACATTAATAAGAAGG + Intergenic
962314071 3:134347771-134347793 AAATAGAGACATTAATTGCAGGG - Intergenic
962576168 3:136756943-136756965 GAAGGCAGACATTAATGGGAAGG - Intergenic
962733753 3:138305725-138305747 GAAGGGAGAGTTTAATGAGAAGG - Intronic
963851488 3:150214985-150215007 AAATGGAAACTGCAATGAGATGG - Intergenic
965142564 3:164858142-164858164 AAATGGAGAATTTAATATAAGGG + Intergenic
965944205 3:174219992-174220014 TAATGAAGACTGTAGTGGGAAGG + Intronic
966033184 3:175376901-175376923 AAATGAAAAATTTACTGGGAGGG - Intronic
966669332 3:182509236-182509258 AAATGGAGAGGGAAATGGGAAGG + Intergenic
967103368 3:186235442-186235464 GAATGAAGACTTTGATGGCAAGG + Intronic
967617566 3:191590408-191590430 AGATGGAGATTTTTATGGGAAGG + Intergenic
967622769 3:191652886-191652908 ATATGGAGACTTGCCTGGGATGG - Intergenic
967622786 3:191653183-191653205 ATATGGAGACTTGCCTGGGAGGG - Intergenic
969610666 4:8226163-8226185 GAAAGGAGACATTACTGGGAAGG - Intronic
970233117 4:13931488-13931510 AAATGAGGACTTTACTTGGAGGG + Intergenic
971472783 4:27044709-27044731 AAATGAAGACTTTACTGGAGGGG + Intergenic
971881016 4:32372331-32372353 ACCTGGAGAATTTAATGAGAAGG + Intergenic
972640457 4:40920558-40920580 AAATGCAGGCTTTAAAGGGCAGG + Intronic
973284150 4:48396535-48396557 ATATCGAGACATTAAAGGGAGGG + Intronic
974819804 4:67051901-67051923 AAATGTAGACTTTATTCTGAGGG + Intergenic
975931462 4:79528625-79528647 AAATGCAGGCTTGAAAGGGAAGG + Intergenic
975975621 4:80092644-80092666 AATTGGATAATTTAATGGAAAGG - Intronic
976824266 4:89242406-89242428 AAATGGAGACTTTAAACTTATGG - Exonic
977209135 4:94198132-94198154 AAATGGTGACTATAAAGGAAGGG + Intergenic
977892165 4:102324872-102324894 AAAAGGATAAATTAATGGGACGG - Intronic
978714223 4:111822675-111822697 AGAGGGACACTTTAAGGGGAAGG + Intergenic
979293459 4:119003651-119003673 ACATAGAGACTATACTGGGAGGG - Intronic
979312084 4:119214558-119214580 AAAAAGATATTTTAATGGGAAGG + Intronic
980704025 4:136469134-136469156 AAATCAAGAATTTAATGTGATGG - Intergenic
980979736 4:139644026-139644048 CAATGGAGACTTGGATGGGTGGG - Intergenic
981024804 4:140066816-140066838 TAATTGAGACTTAAATTGGATGG - Intronic
981340851 4:143619776-143619798 AGATGGAAACTTTAATAGTAGGG - Intronic
984222532 4:176995276-176995298 AAATGGAGAGTTTATTGACATGG - Intergenic
985091335 4:186365217-186365239 AAATGGAGTATTAAATGCGATGG - Intergenic
988051663 5:26038990-26039012 AAATGGATAATTTATTGGAAAGG + Intergenic
990705513 5:58524592-58524614 AAATAGAGAAATAAATGGGAGGG - Intergenic
991091932 5:62701974-62701996 AAATGCAGACTTTACAGGTAGGG + Intergenic
992438273 5:76775877-76775899 CAATGCAGACTCTAATGAGAAGG - Intergenic
994222341 5:97209925-97209947 AAATGTAGCCTTTACTTGGATGG + Intergenic
994261747 5:97667636-97667658 AACTGTAGTGTTTAATGGGAAGG - Intergenic
994556376 5:101311176-101311198 AAATAAACACATTAATGGGATGG + Intergenic
994759045 5:103830624-103830646 ATATGGAGACATGTATGGGATGG + Intergenic
995398981 5:111719260-111719282 AAATGGAGACTAATGTGGGAGGG - Intronic
996662024 5:126015562-126015584 AAAAGGAGAGTTTTATGGAAAGG + Intergenic
999640133 5:153664144-153664166 AAATAGAGAATACAATGGGAGGG + Intronic
1000177835 5:158775393-158775415 AAATGGAACCATTAATGGGCAGG + Intronic
1003545350 6:7053331-7053353 GAATGGAGATTTAAAAGGGATGG + Intergenic
1004016843 6:11739338-11739360 AAATGGTGACTTTAAGGACAAGG - Intronic
1004977118 6:20980627-20980649 AAATGCAGTCTTTAACGGCATGG + Intronic
1005756158 6:28926576-28926598 AAATAGAGAAATTAATGGGAAGG - Intergenic
1008586270 6:52953014-52953036 AAAGGAAAACTTTAAAGGGAAGG - Intergenic
1009514501 6:64597692-64597714 AACTGGAGACTTAAAAGGGTGGG + Intronic
1009578596 6:65500684-65500706 AAAAGGATACTATAATGTGAAGG - Intronic
1010117922 6:72337325-72337347 AAATGAAGGCATTATTGGGAAGG + Intronic
1010653602 6:78484503-78484525 AAAGTCAAACTTTAATGGGAAGG + Intergenic
1012498709 6:99864266-99864288 AATTGGAGAATTCTATGGGAAGG + Intergenic
1012703110 6:102488103-102488125 AAAGGGAGACTAAAGTGGGAGGG + Intergenic
1013707737 6:112858616-112858638 AAATGAAAATTTTAATGGGCTGG + Intergenic
1013858069 6:114599135-114599157 AAATGGAGATTTTAAGTAGAGGG - Intergenic
1015840594 6:137472720-137472742 AAAAAGACACTTTACTGGGAGGG + Intergenic
1016256709 6:142115284-142115306 AGATGGAGAGTATAGTGGGAGGG + Intergenic
1018298054 6:162370539-162370561 TAATGGTTACTTTAATTGGAGGG + Intronic
1018409738 6:163531868-163531890 AGATGGAGAAATTAATGGAATGG - Intronic
1020566444 7:9802258-9802280 AAAGGGAGACATTAATGAAAGGG + Intergenic
1021031473 7:15742371-15742393 AACTGGGGACTTGAATAGGAAGG - Intergenic
1024168284 7:46757092-46757114 ACATGCAGATTTTCATGGGAAGG - Intronic
1027798784 7:82725681-82725703 AAAAGGAGTTTTTAATGGGTAGG - Intergenic
1027927188 7:84480908-84480930 AAATAAAGACTTTAATAGCATGG + Intronic
1028605319 7:92649288-92649310 AAATGAAGATTTTTATGGCAAGG + Intronic
1030396016 7:108987974-108987996 GAATGGAGATTTTAATGGTTGGG + Intergenic
1030850530 7:114479489-114479511 AAATGGAGAACTAAATGAGAAGG + Intronic
1030914684 7:115297762-115297784 AAATGCAGCCTTCAATGGGGAGG - Intergenic
1031672732 7:124569779-124569801 AGAAGGAGACAGTAATGGGATGG - Intergenic
1031956302 7:127945835-127945857 AAATGGAGACTGTAGTGTAATGG - Intronic
1032368777 7:131326151-131326173 AAATAGACACTTTAAAGGGGAGG - Intronic
1033026472 7:137778270-137778292 AAGGGGAGACTTTTAAGGGAAGG + Intronic
1035370996 7:158378894-158378916 TCAAGGGGACTTTAATGGGATGG + Intronic
1036469270 8:9036811-9036833 GAATGGACACTTCAAGGGGAAGG - Intronic
1037794216 8:21978222-21978244 AAATGGAAACTGTGATGAGAAGG + Intronic
1042067352 8:64892808-64892830 AGAAGGAGACTTTTAGGGGAAGG - Intergenic
1045416113 8:101969217-101969239 AAATGGAGACATCATTTGGATGG - Intronic
1045452530 8:102342400-102342422 AAATGGAAACCTTAGAGGGAGGG + Intronic
1046168621 8:110474246-110474268 AAATGGAGACTTTGATTGGTTGG + Intergenic
1047045115 8:121044468-121044490 AAAGGGAGAAATTATTGGGAAGG + Intergenic
1047968644 8:130066158-130066180 AAGGGGAGATTTTATTGGGAAGG - Intronic
1049677997 8:143901758-143901780 AAGTGGAGACATTAAGTGGAGGG + Intergenic
1050169523 9:2800861-2800883 AAAAGGACACTTTAATGAAAAGG + Intronic
1050848637 9:10256670-10256692 CACTTAAGACTTTAATGGGACGG - Intronic
1052005137 9:23338261-23338283 TTATGTAGACTTTAATGTGAAGG - Intergenic
1052034227 9:23661944-23661966 AAATTGAGACTTGAATGAGAAGG - Intergenic
1052137165 9:24926983-24927005 AAATGTAGATGTTCATGGGAAGG - Intergenic
1052625346 9:30968452-30968474 AACTGGAGTCTTTAATGGAAAGG + Intergenic
1053274054 9:36770247-36770269 ATATGGAGGAGTTAATGGGATGG + Intergenic
1053316455 9:37055990-37056012 AAGTGGAGACTTGAAGGAGAAGG - Intergenic
1055122549 9:72678989-72679011 AAATATAGACTTCAGTGGGATGG - Intronic
1055164614 9:73176118-73176140 AAAGAGAGACTTTACTGAGAGGG - Intergenic
1056984799 9:91353019-91353041 AAATGATGACTTTCAAGGGATGG + Intronic
1057859730 9:98630759-98630781 AAAAGGAGAGTTGAATAGGATGG + Intronic
1061939797 9:133877780-133877802 TAATGGCCATTTTAATGGGAAGG + Intronic
1186859895 X:13662333-13662355 AAATGGAATCTTTAAGGTGACGG - Intronic
1189904195 X:45741292-45741314 ACATGGAGATATTAAGGGGATGG - Intergenic
1190637294 X:52448457-52448479 AAATGCAGACTTTATTTGTAAGG - Intergenic
1190638421 X:52459172-52459194 AAATGCAGACTTTCTCGGGAAGG + Intergenic
1190678236 X:52801272-52801294 AAATGCAGACTTTCTCGGGAAGG - Intergenic
1190679761 X:52815325-52815347 AAATGCAGACTTTCTTTGGAAGG + Intronic
1190751773 X:53368231-53368253 AAATTGGGAGTTTAATGGGAAGG + Intergenic
1192512092 X:71727301-71727323 AAATCGCAACTTTCATGGGACGG + Intergenic
1192514605 X:71754204-71754226 AAATCGCAACTTTCATGGGACGG - Intergenic
1194354927 X:92870973-92870995 AAAGGGAGACTATACTGGGTGGG + Intergenic
1194793269 X:98177858-98177880 AAATGGAAATTTGAATGGTAAGG + Intergenic
1195347850 X:103968502-103968524 AAATCAAGACTTTAATGAAAAGG - Intergenic
1195359592 X:104070339-104070361 AAATCAAGACTTTAATGAAAAGG + Intergenic
1196484183 X:116185021-116185043 AAATGGAGACTTAAAATGAAGGG + Intergenic
1196763821 X:119224675-119224697 AAATGCAGAGTTCAAGGGGAAGG + Intergenic
1197231823 X:124013730-124013752 AAATGGAGACTTTTTAGGGTGGG + Intronic
1197854462 X:130900516-130900538 AAAAGGAAACTGTAATGGGTAGG - Intronic
1198004643 X:132480524-132480546 AAATCGGGCCTTTGATGGGAGGG - Intronic
1198284784 X:135178681-135178703 AACTGGAGAATTAAATGGGGAGG + Intergenic
1198435762 X:136615540-136615562 AAATGGAGGCCTTATTGAGAAGG + Intergenic
1198649439 X:138845567-138845589 AAATGGAGTCCTGACTGGGAAGG + Intronic
1199331281 X:146562694-146562716 GAATGGAGACTTCAATGGCTAGG + Intergenic
1200663287 Y:5987990-5988012 AAAGGGAGACTATACTGGGTGGG + Intergenic
1201339406 Y:12917256-12917278 ACATTGGGACATTAATGGGATGG + Intronic