ID: 1174236296

View in Genome Browser
Species Human (GRCh38)
Location 20:49095438-49095460
Sequence TAGCTACTTGGAAGGCTGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2322
Summary {0: 2, 1: 12, 2: 124, 3: 703, 4: 1481}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174236296_1174236304 16 Left 1174236296 20:49095438-49095460 CCTGTCAGCCTTCCAAGTAGCTA 0: 2
1: 12
2: 124
3: 703
4: 1481
Right 1174236304 20:49095477-49095499 GCTAATTTTTTATTTTTTTGTGG 0: 7
1: 92
2: 614
3: 2392
4: 12851
1174236296_1174236305 23 Left 1174236296 20:49095438-49095460 CCTGTCAGCCTTCCAAGTAGCTA 0: 2
1: 12
2: 124
3: 703
4: 1481
Right 1174236305 20:49095484-49095506 TTTTATTTTTTTGTGGAGACAGG 0: 26
1: 600
2: 7362
3: 45369
4: 90578
1174236296_1174236306 24 Left 1174236296 20:49095438-49095460 CCTGTCAGCCTTCCAAGTAGCTA 0: 2
1: 12
2: 124
3: 703
4: 1481
Right 1174236306 20:49095485-49095507 TTTATTTTTTTGTGGAGACAGGG 0: 21
1: 536
2: 5953
3: 37067
4: 78588

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174236296 Original CRISPR TAGCTACTTGGAAGGCTGAC AGG (reversed) Intronic
Too many off-targets to display for this crispr