ID: 1174237167

View in Genome Browser
Species Human (GRCh38)
Location 20:49103329-49103351
Sequence AGCACCTCTGGCCCATCCCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174237167_1174237169 -7 Left 1174237167 20:49103329-49103351 CCACGGGATGGGCCAGAGGTGCT No data
Right 1174237169 20:49103345-49103367 AGGTGCTCCAGAGCCAGCTGAGG No data
1174237167_1174237171 2 Left 1174237167 20:49103329-49103351 CCACGGGATGGGCCAGAGGTGCT No data
Right 1174237171 20:49103354-49103376 AGAGCCAGCTGAGGCACATCAGG No data
1174237167_1174237174 30 Left 1174237167 20:49103329-49103351 CCACGGGATGGGCCAGAGGTGCT No data
Right 1174237174 20:49103382-49103404 GTCACCCTGCACTTCCCCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174237167 Original CRISPR AGCACCTCTGGCCCATCCCG TGG (reversed) Intergenic
No off target data available for this crispr