ID: 1174239114

View in Genome Browser
Species Human (GRCh38)
Location 20:49118579-49118601
Sequence GTGCATTAGGAGAAGGAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 600
Summary {0: 1, 1: 0, 2: 3, 3: 54, 4: 542}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174239114 Original CRISPR GTGCATTAGGAGAAGGAGGC AGG (reversed) Intronic
900889012 1:5435762-5435784 GTGCCGGAGGAGGAGGAGGCAGG + Intergenic
900998878 1:6137577-6137599 GTACATTGGGAGACTGAGGCAGG - Intronic
902109265 1:14064602-14064624 GGGCATTGTGAAAAGGAGGCGGG + Intergenic
903049895 1:20592844-20592866 GTGCTTTGGGAGGATGAGGCTGG + Intronic
903443486 1:23405727-23405749 ATGCATTAGGGGAGGGAGCCAGG + Intronic
903694892 1:25199390-25199412 GTGCAGAAGGAGAAGGTGGGAGG + Intergenic
903988177 1:27244591-27244613 GTGCTTTGGGAGACCGAGGCAGG - Intronic
904076163 1:27844247-27844269 GTGCTTTGGGAGACTGAGGCAGG - Intronic
904118303 1:28178186-28178208 GGACATTAGGAGGAGGAGCCTGG - Intronic
904604409 1:31691055-31691077 GGGCCTTTGGAGGAGGAGGCTGG - Intronic
904658699 1:32068792-32068814 GTGCTTTGGGAGGTGGAGGCAGG - Intergenic
904715046 1:32461390-32461412 CAGCACTAGGAGAACGAGGCAGG - Intergenic
904832110 1:33311978-33312000 GTGCATGTGATGAAGGAGGCGGG - Intronic
904896534 1:33822261-33822283 GGGCATGAGGAGAAGGAGCAGGG + Intronic
904944015 1:34185851-34185873 GTGCATCTAGAGATGGAGGCAGG - Intronic
905810557 1:40909625-40909647 GTACTTTGGGAGAATGAGGCAGG - Intergenic
906224633 1:44111240-44111262 GTGTTTTAGGAGACCGAGGCAGG - Intergenic
906243121 1:44254505-44254527 GTGCTCTAGGACAAGTAGGCAGG - Intronic
906350359 1:45053513-45053535 GTGCTTTGGGAGGCGGAGGCAGG + Intronic
907002382 1:50874603-50874625 GTGCATTGGGAGACTGAGGCAGG - Intronic
907354909 1:53864143-53864165 GTTGGTGAGGAGAAGGAGGCAGG - Intronic
907679619 1:56551048-56551070 GTGCAGTAGGACAGGGAGGGAGG - Intronic
910875344 1:91873215-91873237 GTGCTTTAGGAGGCTGAGGCAGG - Intronic
911208222 1:95114169-95114191 GTGCTTTGGGAGACTGAGGCAGG - Intergenic
912281903 1:108324472-108324494 GTGCTTTTGGAGACGGAGGCAGG + Intergenic
912430880 1:109627749-109627771 GGGCATGAGGAGAACAAGGCAGG - Intronic
912568365 1:110605156-110605178 CTGCATTGGGGGAAGGTGGCTGG + Intronic
913697515 1:121341811-121341833 GTGCTTTAGGAGGAGTAGGGTGG + Intronic
914140044 1:144938241-144938263 GTGCTTTAGGAGGAGTAGGGTGG - Intronic
914203201 1:145504914-145504936 GTGCTTTGGGAGGACGAGGCAGG - Intergenic
914237130 1:145822837-145822859 GTGCTTTGGGAGGACGAGGCAGG - Intronic
914401001 1:147319860-147319882 GTACTTTGGGAGAATGAGGCAGG + Intergenic
914482323 1:148078068-148078090 GTGCTTTGGGAGGACGAGGCAGG - Intergenic
915367786 1:155325170-155325192 GTGCAGAAGGTGAAGGTGGCTGG + Exonic
916080250 1:161227750-161227772 GTGCCTCAGGGGATGGAGGCAGG - Intronic
916388016 1:164298908-164298930 GTACCTTTGAAGAAGGAGGCAGG + Intergenic
916456273 1:164973922-164973944 TTGCATTAGGAGAAAGAGCATGG + Intergenic
916490812 1:165300824-165300846 ATGAATGAGGAGAAGCAGGCAGG - Intronic
916579385 1:166094081-166094103 GTGCAGCAGGGGAAGGAAGCAGG + Intronic
917650826 1:177075886-177075908 GTGCTTTGGGAGGATGAGGCAGG - Intronic
918618303 1:186573406-186573428 GTGCATTGGGAGGTTGAGGCAGG + Intergenic
919053835 1:192544018-192544040 GTGCTTTAGGAGGCCGAGGCAGG - Intergenic
919825394 1:201499866-201499888 GCACATTAGGAGACCGAGGCAGG - Intronic
920484904 1:206360460-206360482 GTGCTTTAGGAGGAGTAGGGTGG + Intronic
921307710 1:213813672-213813694 GTTCTTCAGGAGAAGGAGGGTGG + Intergenic
922083184 1:222318213-222318235 ATGCATGTGGAGAAGGAGGGCGG - Intergenic
922599706 1:226840547-226840569 GTGCTTTAGGAGTCTGAGGCAGG + Intergenic
924459170 1:244243154-244243176 GTGCTTTAGGAGGCCGAGGCAGG + Intergenic
924671181 1:246127597-246127619 GTGAAATATGAAAAGGAGGCTGG + Intronic
924718203 1:246598442-246598464 GTACATTAGGGGAATGGGGCAGG - Intronic
924876870 1:248115677-248115699 TGGCATCAGGAGACGGAGGCTGG + Intergenic
1062928676 10:1337901-1337923 GTGCACGAGGTGAAGAAGGCTGG - Intronic
1063344244 10:5296374-5296396 CTGCAACAGGAGAAGGAAGCTGG - Intergenic
1063613078 10:7579770-7579792 GTGCACGAGGAGGAGGACGCAGG - Exonic
1063969338 10:11370618-11370640 GCACTTTGGGAGAAGGAGGCAGG + Intergenic
1064429903 10:15261869-15261891 GTGCTTTAGGAGGCTGAGGCAGG + Intronic
1065127941 10:22592426-22592448 GTGCCCCAGGAGGAGGAGGCAGG + Intronic
1065192034 10:23221348-23221370 GTCCATTTGGAGAAGGGGCCTGG - Intronic
1065478833 10:26171713-26171735 CTGCCTCAGGAGCAGGAGGCTGG + Intronic
1065567240 10:27025414-27025436 GTGCTTTAGGAGGCTGAGGCAGG - Intronic
1066234998 10:33477016-33477038 GTGCTTGGGGAAAAGGAGGCAGG - Intergenic
1066668954 10:37816834-37816856 GTGTTTTAGGAGAAGGGTGCTGG + Intronic
1066958692 10:42199326-42199348 GCACATTAGGAGACTGAGGCAGG - Intergenic
1067014380 10:42745845-42745867 GTACTTTAGGAGATGGAGGCGGG - Intergenic
1067329000 10:45296835-45296857 GTGCTTTGGGAGACTGAGGCAGG - Intergenic
1067352579 10:45489980-45490002 GGGCATGAGAGGAAGGAGGCTGG - Intronic
1067447100 10:46357823-46357845 TGGCATGAGGAGAAGGGGGCAGG - Intergenic
1067716076 10:48691995-48692017 GTTCTTTAGGAGAAGGAGGAGGG + Intronic
1067748243 10:48952664-48952686 CTGCATTAGGAGGAGGAGGGTGG - Intronic
1067910795 10:50344621-50344643 GCGCTTTGGGAGAACGAGGCGGG + Intronic
1069654099 10:70075143-70075165 TTGCCTTAGAAGACGGAGGCAGG - Intronic
1070688127 10:78504917-78504939 GTGCCTTGGGGAAAGGAGGCAGG + Intergenic
1071480156 10:86059042-86059064 GCTCATGAGGAGGAGGAGGCAGG + Intronic
1071676410 10:87659796-87659818 GAGGAGTAGGAGAAGGGGGCTGG + Exonic
1072368980 10:94744730-94744752 GTGCTTTGGGAGGATGAGGCAGG + Intronic
1072496094 10:95961279-95961301 GTGCTTTAGGAGGCTGAGGCAGG + Intronic
1073219541 10:101858703-101858725 GTGCATTAGCAGGTGGACGCAGG + Intronic
1074141718 10:110679465-110679487 GTGCTTTAGGAGGGTGAGGCAGG - Intronic
1074331230 10:112511706-112511728 TTGAATTAGGAGGAGGAGGAGGG - Intronic
1074426111 10:113352949-113352971 GTGCTTTGGGAGAGTGAGGCAGG + Intergenic
1075432639 10:122401429-122401451 TGGCAATAGGAGAAGGAGGAAGG + Intronic
1075449136 10:122536069-122536091 GCGTATTGGGGGAAGGAGGCTGG + Intergenic
1076109800 10:127851683-127851705 GTGCCCCAGGGGAAGGAGGCAGG + Intergenic
1077278708 11:1732193-1732215 GTGCTTTGGGAGACTGAGGCAGG - Intergenic
1079240602 11:18719889-18719911 GTGCCCTAGGAGAAGGAGGAAGG + Exonic
1079489128 11:20967882-20967904 ATGAATTTGGAGAAGTAGGCAGG - Intronic
1081901525 11:46632914-46632936 GTGCTTTGGGAGATGGAGGTGGG + Intronic
1083222445 11:61261915-61261937 GTGCTTCAGGAGAAGGAGCTGGG + Intronic
1083489201 11:63002648-63002670 GTGGAGTAGGAGAGGGAGGAAGG - Intronic
1084035002 11:66504332-66504354 GTACCTTGGGAGGAGGAGGCAGG - Intronic
1084575622 11:69986264-69986286 GCGCACGAGGAGCAGGAGGCAGG + Intergenic
1084815553 11:71643945-71643967 GTGCATGAGGGGATGGAGGATGG - Intergenic
1084956462 11:72694132-72694154 GTGGATTGGGAGAGGGAGGAGGG - Intronic
1085251233 11:75145224-75145246 GTGCTTTGGGAGACCGAGGCAGG - Intronic
1086128633 11:83377243-83377265 GTGCTTTAGGAGGTAGAGGCAGG + Intergenic
1086411472 11:86548833-86548855 GTACATTAGTAGAAGGAGCTGGG - Intronic
1086761855 11:90641382-90641404 GTACCTTAGGAAAAGGTGGCAGG - Intergenic
1087061578 11:93983842-93983864 GTCCAGGAGGAGAAGGAGACAGG + Intergenic
1087533509 11:99414105-99414127 GTGGTTTAGGAGGAAGAGGCAGG - Intronic
1088344268 11:108805022-108805044 GGGCATTAGCACAAGGAGGCAGG + Intronic
1088907392 11:114165080-114165102 GTGGGTTAGGACAGGGAGGCAGG - Intronic
1089218060 11:116847725-116847747 GTGCTTTAGAGGAAGGAGTCTGG - Intronic
1089833813 11:121352404-121352426 GTGGGTTAGGAGGGGGAGGCTGG + Intergenic
1090155219 11:124430293-124430315 GTGCTTTCACAGAAGGAGGCTGG - Intergenic
1090193748 11:124798154-124798176 GTGCTTTGGGAGACTGAGGCAGG + Intronic
1090205513 11:124881625-124881647 GTGCTTTAGGAGGCTGAGGCAGG + Intergenic
1092427458 12:8386109-8386131 GTGCATGAGGGGATGGAGGATGG + Intergenic
1092534776 12:9377708-9377730 GTGGATTAGGGGAAGGAGCTTGG - Intergenic
1092800995 12:12166799-12166821 ATGAATTAGGAAAATGAGGCTGG + Intronic
1093194559 12:16114660-16114682 TTGCATCAGAAGAATGAGGCAGG - Intergenic
1093932702 12:24970187-24970209 GTGCATTAGGAGGATGGGGTGGG - Intergenic
1094377576 12:29807012-29807034 GTGCTTTGGGAGACCGAGGCAGG - Intergenic
1094473247 12:30822701-30822723 GTGGATTTGGAGAAGGGAGCGGG - Intergenic
1095900807 12:47325978-47326000 GTGCTTTAGGAGGCTGAGGCAGG + Intergenic
1096156577 12:49344823-49344845 CTGGAGTAGGAGAAGGAGGAGGG + Intergenic
1096240991 12:49960314-49960336 GGGCATGTGGAGAACGAGGCTGG - Intergenic
1096313593 12:50543981-50544003 GCGCTTTGGGAGGAGGAGGCTGG + Intronic
1098227368 12:68338629-68338651 CTGCAGTAGGAGAAGGAGGTTGG - Intergenic
1098353005 12:69583398-69583420 TTGGATGGGGAGAAGGAGGCAGG - Intergenic
1099002854 12:77201321-77201343 GTGGCTAGGGAGAAGGAGGCAGG + Intergenic
1100301727 12:93314216-93314238 GTGCATTGGGAGACTGAGGCGGG - Intergenic
1100384546 12:94093381-94093403 GGGCACTAGGAGATGGAAGCTGG - Intergenic
1101595326 12:106159533-106159555 GTGCATTGGGAGGGTGAGGCAGG + Intergenic
1101625691 12:106439126-106439148 GTGCTTTGGGAGACTGAGGCAGG + Intronic
1101708525 12:107243310-107243332 TTGCTTGAGGACAAGGAGGCAGG + Intergenic
1101735339 12:107458972-107458994 GGGGAGTAGGTGAAGGAGGCAGG - Intronic
1101846953 12:108370298-108370320 GTGCTTTGGGAGACTGAGGCAGG + Intergenic
1101971844 12:109320065-109320087 GTGCTTTAGGAGACTGAGGTGGG + Intergenic
1102447954 12:113018105-113018127 GTGCTTTGGGAGACTGAGGCAGG + Intergenic
1103324790 12:120113273-120113295 GTGCTTTGGGAGGATGAGGCGGG - Intronic
1105203938 13:18203497-18203519 GTACATTGGGAGACCGAGGCGGG + Intergenic
1105391669 13:19985368-19985390 GTACTTTAGGAGACAGAGGCAGG - Intronic
1105819007 13:24063118-24063140 GAGCACTGGGAGAAGGAGCCTGG - Intronic
1106217072 13:27712331-27712353 GTGCTTTGGGAGGTGGAGGCAGG - Intergenic
1106393946 13:29362229-29362251 GTGCTTTAGGAGGCTGAGGCAGG - Intronic
1108283693 13:48884733-48884755 GTACTTTAGGAGACCGAGGCGGG + Intergenic
1108301114 13:49077029-49077051 GTGCTTTGAGAGAATGAGGCAGG + Intronic
1108582247 13:51837522-51837544 GTGCGTTAGGAGAATGAGATGGG + Intergenic
1108833958 13:54517009-54517031 GTGCATTAGGAGGCCAAGGCAGG - Intergenic
1109149412 13:58825593-58825615 GTGCATTAGGAAAGAGAGCCAGG + Intergenic
1109327272 13:60882988-60883010 GTGCTTTAGGAGGCTGAGGCAGG + Intergenic
1110471208 13:75862236-75862258 GTGCTTTGGGAGGACGAGGCAGG - Intergenic
1111120201 13:83838461-83838483 GCTCATTAGGAAAAAGAGGCTGG - Intergenic
1112455577 13:99559218-99559240 GTTCAATAGGAGAAAGAGCCTGG + Intronic
1112505248 13:99971153-99971175 GGGCAGGAGGAGGAGGAGGCGGG + Exonic
1114070931 14:19106095-19106117 GTACTTTAGGAGACGGAGGCGGG + Intergenic
1114091330 14:19293910-19293932 GTACTTTAGGAGACGGAGGCGGG - Intergenic
1114199651 14:20507994-20508016 GTGCTTTGGGAGACCGAGGCAGG - Intronic
1114252680 14:20974789-20974811 GTACTTTGGGAGAACGAGGCGGG + Intergenic
1114330457 14:21632162-21632184 GTACTTTGGGAGATGGAGGCGGG + Intergenic
1114457109 14:22862919-22862941 GTGCTTTAGGAGGCTGAGGCAGG - Intergenic
1114828047 14:26105406-26105428 GTGCTTTGGGAGGCGGAGGCAGG + Intergenic
1115025244 14:28737300-28737322 GTCCACTATGAAAAGGAGGCTGG - Intergenic
1115685090 14:35788536-35788558 GTGCTTTAGGAGACTAAGGCAGG + Intronic
1116008567 14:39324311-39324333 GCTCATTAGAAGAAGAAGGCTGG - Intronic
1116868064 14:50047371-50047393 GTGAATCAGGGGAAGGAAGCTGG + Intergenic
1116922990 14:50600853-50600875 GTACTTTGGGAGGAGGAGGCAGG + Intronic
1117187091 14:53251017-53251039 GAGCAGGAGGAGAAGGAGGGAGG - Intergenic
1117846995 14:59921604-59921626 ATACATTAGGAGAAGGAGGCTGG + Intronic
1118183528 14:63518185-63518207 GTGCTTTGGGAGACTGAGGCAGG - Intronic
1118500882 14:66361597-66361619 GTGGATTAGGAGAGAGAGGAAGG - Intergenic
1118687412 14:68304759-68304781 TTGCATTAGGTGAAGCTGGCAGG + Intronic
1118976143 14:70678392-70678414 GCACTTTAGGAGAACGAGGCAGG + Intergenic
1119391776 14:74295863-74295885 GTGCATCAGGAGAAGCTGGAGGG - Exonic
1119400354 14:74358503-74358525 GAGAAGCAGGAGAAGGAGGCTGG + Exonic
1121270794 14:92636801-92636823 GCACTTTGGGAGAAGGAGGCAGG + Intronic
1121365012 14:93301106-93301128 GTGCTTTGGGAGACTGAGGCAGG + Intronic
1122420348 14:101572516-101572538 GTGCATATGGAGCAGGAGCCTGG - Intergenic
1122420371 14:101572672-101572694 GTGCATATGGAGCAGGAGCCGGG - Intergenic
1122519895 14:102335930-102335952 GTGCTTTGGGAGACTGAGGCAGG + Intronic
1122769652 14:104092312-104092334 AAGCATTTGGAGAAGGAGGTGGG + Intronic
1122903876 14:104793113-104793135 GTGCATCAGGTTAGGGAGGCTGG - Exonic
1123091792 14:105745254-105745276 GTGCAGGAGGAGCAGGGGGCAGG - Intergenic
1124005359 15:25791631-25791653 GTGCTTTGGGAGACTGAGGCGGG - Intronic
1124236741 15:27995634-27995656 GTGCTTTAGGAGGTTGAGGCAGG - Intronic
1125525408 15:40370931-40370953 GTGCAGCAGGAGAAGGAGGATGG + Exonic
1125966741 15:43880891-43880913 CTGCAATGGGAGGAGGAGGCTGG + Intronic
1126795036 15:52253784-52253806 CTGCATTAGGCCAAAGAGGCTGG - Intronic
1126820601 15:52499934-52499956 GTGCTTTGGGAGAACAAGGCAGG + Intronic
1127494401 15:59496358-59496380 GTGCATTGGGAGGCCGAGGCGGG + Intronic
1128478306 15:68016158-68016180 GCACTTTAGGAGATGGAGGCAGG + Intergenic
1128741482 15:70086867-70086889 GTGCAAAAGGGGAAGAAGGCAGG - Intronic
1129109992 15:73331689-73331711 GTGCTTTAGGAGGCCGAGGCAGG - Intronic
1129442664 15:75593170-75593192 GTGCTTTGGGAGGACGAGGCGGG - Intergenic
1131473528 15:92716620-92716642 GCCCATTAGGAGAGGGTGGCAGG - Intronic
1133122355 16:3617634-3617656 GTGCATAAGGATAAGGATGGAGG + Intronic
1133370790 16:5244269-5244291 GTGCATGAGGGGATGGAGGATGG - Intergenic
1133827266 16:9289362-9289384 GTGCTTTGGGAGGATGAGGCAGG + Intergenic
1133979700 16:10624025-10624047 GTGCTTTGGGAGACTGAGGCGGG + Intergenic
1134191057 16:12121497-12121519 GTGCAGCAGGAGACGAAGGCAGG + Intronic
1134593250 16:15474624-15474646 GTGCTTTAGGAGGCTGAGGCAGG - Intronic
1134684223 16:16147470-16147492 GTGCTTTGGGAGGCGGAGGCAGG - Intergenic
1135020856 16:18961854-18961876 GAGCATGAGAAGGAGGAGGCAGG - Intergenic
1135228801 16:20685573-20685595 GTACTTTAGGAGGTGGAGGCAGG + Intronic
1135630485 16:24032533-24032555 GTGGATTAGCAGATGGAGGTGGG + Intronic
1135775755 16:25256745-25256767 GTGCATTTGGAGAAAGAGACTGG - Exonic
1135905710 16:26509979-26510001 GTGCTTTAGGAGGCTGAGGCAGG + Intergenic
1136170199 16:28484594-28484616 GTGCTTTAGGAGGCTGAGGCTGG - Intronic
1136571929 16:31103364-31103386 GTGCTTTGGGAGACTGAGGCAGG + Intergenic
1137268429 16:46886610-46886632 GGGCATTTGGGGAAGGGGGCTGG + Intronic
1139164120 16:64546017-64546039 GTGAATGAGACGAAGGAGGCAGG - Intergenic
1139439818 16:66960736-66960758 GTGCTTTAGGAGGATGGGGCAGG - Intergenic
1139569051 16:67799180-67799202 GTACTTTAGGAGACTGAGGCGGG - Intronic
1139726790 16:68906693-68906715 GTGCACTAGGAGGCTGAGGCAGG - Intronic
1139833514 16:69819991-69820013 GTGCATTAAGAGGCTGAGGCGGG + Intronic
1140194421 16:72845030-72845052 GTGCATGAGGGGAACGAGGGAGG + Intronic
1140232832 16:73132037-73132059 GTGCTTTAGGAGACCGAGGTGGG + Intronic
1140239701 16:73189845-73189867 GTGCTTTAGGAGGCTGAGGCAGG + Intergenic
1140344901 16:74203630-74203652 GTGCTTTGGGAGACCGAGGCAGG + Intergenic
1140741468 16:77945534-77945556 GTGCTTTAGGAGGCTGAGGCAGG - Intronic
1140958635 16:79891432-79891454 GTGCATTTGGGGAAGGAGCTGGG - Intergenic
1141060280 16:80860672-80860694 GTGCATTGGGAGGTGAAGGCAGG + Intergenic
1141761677 16:86032857-86032879 GTGTATTTGGAGAAGAAGCCTGG + Intergenic
1141854789 16:86673665-86673687 GTGCATGAAGGGAAGGAGGGAGG - Intergenic
1142117580 16:88367948-88367970 GGGCATTAGGATAAGAATGCGGG - Intergenic
1143250688 17:5521127-5521149 GTGCATGGGGGGAGGGAGGCAGG - Intronic
1143329380 17:6122106-6122128 CTGCATTGGGAGGAGAAGGCAGG + Exonic
1143756224 17:9069722-9069744 GTGCCTGAGGACAAGGTGGCAGG + Intronic
1144464916 17:15489483-15489505 GTGCTTTGGGAGACTGAGGCAGG - Intronic
1144705432 17:17364708-17364730 GCACAGGAGGAGAAGGAGGCTGG - Intergenic
1145898068 17:28472197-28472219 GTGTGCTAGGATAAGGAGGCGGG - Intronic
1145973850 17:28972890-28972912 GAGCACTGGGAGAAGGAGGAAGG + Intronic
1146383934 17:32352805-32352827 GGGCTTTGGGAGAACGAGGCAGG - Intronic
1146459745 17:33036652-33036674 GTGCTTTAGGAGGCAGAGGCAGG - Intronic
1146669884 17:34729769-34729791 GTGCTTTGGGAGGTGGAGGCAGG + Intergenic
1146975592 17:37108632-37108654 GCACTTTAGGAGGAGGAGGCAGG - Intronic
1147210458 17:38870027-38870049 GTTTATTAGGGGAAGGAGGGCGG + Exonic
1147344479 17:39779951-39779973 GTGCTTTGGGAGACTGAGGCAGG + Intronic
1147616631 17:41832619-41832641 GTGCTTTAGGAGGCTGAGGCAGG + Intronic
1147723020 17:42550258-42550280 GGGCACTAGGGGAAGGAGGCAGG + Exonic
1147724232 17:42556485-42556507 GGGCACTGGGGGAAGGAGGCAGG + Intergenic
1148654695 17:49274534-49274556 GCACTTTAGGAGACGGAGGCGGG - Intergenic
1148686766 17:49505454-49505476 CAGAATAAGGAGAAGGAGGCTGG - Intronic
1148746093 17:49919331-49919353 GTGCTTTGGGACAACGAGGCGGG + Intergenic
1148791747 17:50177092-50177114 GAGGAAAAGGAGAAGGAGGCTGG - Intergenic
1149371192 17:55994765-55994787 GTGCTTTGGGAGATTGAGGCAGG - Intergenic
1149818129 17:59747309-59747331 GCACATTGGGAGAGGGAGGCAGG + Intronic
1150512683 17:65773836-65773858 GTGCTTTGGGAGGACGAGGCAGG + Intronic
1150768771 17:68023849-68023871 GTGCTTTGGGAGACTGAGGCGGG - Intergenic
1151607451 17:75147750-75147772 GTGCTTTAGGAGGCCGAGGCGGG + Intronic
1151699376 17:75734837-75734859 GTGCCTCTGGGGAAGGAGGCAGG + Intronic
1151883518 17:76909733-76909755 GAGTAGTGGGAGAAGGAGGCTGG + Intronic
1152012219 17:77725612-77725634 CTGAAGTAGGAGAAGGAGGTTGG + Intergenic
1152116039 17:78387842-78387864 GTGCTTTAGGAGGCTGAGGCAGG - Intronic
1154373734 18:13791170-13791192 GTGCTTTAGGAGGCTGAGGCAGG - Intergenic
1155184819 18:23378281-23378303 GTGCTTTAGGAGGCTGAGGCAGG - Intronic
1155407997 18:25511648-25511670 GAGGAATAGGAGAAGGAGACAGG - Intergenic
1157246254 18:46057574-46057596 GTGCTTTGGGAGATGGAGGTGGG - Intronic
1157645903 18:49270902-49270924 GTTCTATAGGAGAAGGGGGCAGG - Intronic
1157652116 18:49343859-49343881 GCACATTAGGAGACTGAGGCAGG + Intronic
1157907509 18:51582757-51582779 CTGCTGTTGGAGAAGGAGGCTGG + Intergenic
1158780232 18:60640415-60640437 GTGCATTATGCAAAGTAGGCAGG - Intergenic
1159914120 18:74173548-74173570 CTCCATGAGGAAAAGGAGGCAGG - Intergenic
1161236897 19:3202688-3202710 GTGCTTTAGGAGGCTGAGGCAGG - Intronic
1161545280 19:4876813-4876835 GTGCTTTCGGAGACAGAGGCAGG + Intergenic
1161987193 19:7662484-7662506 GTGCTTTAGGAGACCGAGGTGGG - Intergenic
1162555844 19:11384968-11384990 GCACATTGGGAGATGGAGGCTGG - Intronic
1163134754 19:15301918-15301940 GCACATTAGGAGGATGAGGCAGG + Intronic
1163522847 19:17802172-17802194 GTGCTTTAGGAGGCTGAGGCAGG - Intronic
1163758470 19:19120540-19120562 GTGCAATCTGAGCAGGAGGCGGG - Intronic
1164646171 19:29860070-29860092 GTGCTTTGGGAGACCGAGGCAGG - Intergenic
1164945295 19:32288254-32288276 GTGGATCAGGAGAAGGAAGAAGG - Intergenic
1165416639 19:35698195-35698217 GCGCTTTGGGAGAACGAGGCAGG - Intergenic
1165472803 19:36013305-36013327 GTGCAGAGGGTGAAGGAGGCAGG - Intronic
1166356011 19:42227819-42227841 GTGCTTTGGGAGACTGAGGCAGG + Exonic
1167036150 19:46996058-46996080 GTGCATATGCAGAAGGAGGCTGG + Intronic
1167785492 19:51632457-51632479 GTGCAGCAGGTGAGGGAGGCTGG - Intronic
1168666443 19:58208521-58208543 GGCCCTTAGGAGAGGGAGGCTGG + Intronic
925073547 2:990491-990513 CTGTAATAGGAGAAAGAGGCAGG - Intronic
927500611 2:23580427-23580449 GTGCTTTAGGAGGCCGAGGCAGG + Intronic
927500656 2:23580730-23580752 GTGCTTTAGGAGGCCGAGGCAGG + Intronic
927672067 2:25076974-25076996 ATGAATTTGGGGAAGGAGGCAGG - Intronic
927814940 2:26206949-26206971 GTGCTTTGGGAGGATGAGGCAGG + Intronic
927991999 2:27454441-27454463 GTGCATGATGAGAAGGAGACTGG + Intronic
928344871 2:30482687-30482709 GTGCTTTAGGAGGCTGAGGCAGG + Intronic
928579738 2:32695472-32695494 GTGCTTTGGGAGACCGAGGCGGG + Intronic
928994488 2:37272739-37272761 GTGCATTAGGACGCTGAGGCAGG + Intronic
929490518 2:42392190-42392212 ATGCATTAGAGGAAGGTGGCAGG - Intronic
929691892 2:44081884-44081906 GTGCTTTAGGAGACAGAGGTGGG - Intergenic
930789558 2:55310333-55310355 GTGCTTTGGGAGGTGGAGGCAGG + Intronic
931409450 2:62015033-62015055 GTGCTTTGGGAGGTGGAGGCAGG - Intronic
932578225 2:72974422-72974444 CTGGATGAGGGGAAGGAGGCTGG - Intronic
933088121 2:78082637-78082659 GGGCTTTGGGAGAAGGAGGAGGG - Intergenic
935272649 2:101448434-101448456 GTGGTGTCGGAGAAGGAGGCAGG - Intronic
936092898 2:109512327-109512349 GGGCATCAGAAGAAGGAGGAAGG - Intergenic
936582142 2:113710060-113710082 GTGCTTTGGGAGACTGAGGCAGG - Intronic
938315843 2:130327534-130327556 ATGCAGTAAGGGAAGGAGGCAGG + Intergenic
938639178 2:133262588-133262610 GTTTATTAGGAGAAAGAGGATGG + Intronic
938882281 2:135603234-135603256 GTGCATTAGGAGGCTGAGGCAGG - Intronic
939348441 2:140999878-140999900 GTGCATCTGGAGAAGGTGACAGG + Intronic
940803340 2:158156889-158156911 GAACATTAGAAGAGGGAGGCAGG + Intergenic
942066499 2:172276717-172276739 GTCCAATAGGAGAAGCAGGCTGG + Intergenic
942256838 2:174110826-174110848 GTGCTTTGGGAGACCGAGGCAGG - Intronic
943298617 2:186169403-186169425 GAGCATTTGAAGAATGAGGCGGG + Intergenic
944087856 2:195870108-195870130 GTGCATAAAGAGAGGAAGGCAGG - Intronic
944494767 2:200295574-200295596 GTGCTTTGGGAGACTGAGGCAGG - Intergenic
944562673 2:200956574-200956596 GTACATTGGGAGACTGAGGCAGG - Intronic
946028291 2:216685721-216685743 GTGCATTTGCAGAAGGAGAAAGG + Intronic
946393741 2:219432611-219432633 GTGCTTTAGGAGGCTGAGGCAGG + Intergenic
946894632 2:224310731-224310753 GTGCATTTGGGGAAGGAGAAAGG - Intergenic
947021822 2:225686421-225686443 TTGCATTAGGAGAAAAAGCCAGG - Intergenic
947398447 2:229709957-229709979 GTTCATTTGGGGAAGCAGGCAGG - Intronic
947537832 2:230952073-230952095 GTACATTTGGAGAGGGAGGGGGG + Intronic
948024391 2:234765285-234765307 GTGCAGCAGGTGGAGGAGGCTGG - Intergenic
948197512 2:236106633-236106655 ATGCATTTGGAGAAGGTGGCTGG + Intronic
948782268 2:240329221-240329243 GAGCATGGGGAGGAGGAGGCTGG + Intergenic
1169006194 20:2209123-2209145 GGGTAGTAGGAGAAGGTGGCAGG + Intergenic
1169018876 20:2313780-2313802 GTGCTTTGGGAGATGGAGGTGGG + Intronic
1170635605 20:18101528-18101550 GGGCCTTTGGAGAAGGAGGATGG + Intergenic
1170842222 20:19933295-19933317 GTGCAGGAGGAGAGGCAGGCAGG - Intronic
1171001595 20:21421603-21421625 GTGCTTTGGGAGACTGAGGCAGG - Intergenic
1172212895 20:33213507-33213529 GTCCAGTGGGACAAGGAGGCAGG - Intergenic
1172732083 20:37096451-37096473 TTGAGTTAGGAGATGGAGGCTGG + Intergenic
1172868449 20:38119268-38119290 GTGCTTTAGGAGGCTGAGGCAGG - Intronic
1172969872 20:38865535-38865557 GTGCTTTAGGAGGCCGAGGCAGG - Intronic
1174230848 20:49044634-49044656 GTGCTTTAGGAGGCGGAGGTGGG + Intergenic
1174239114 20:49118579-49118601 GTGCATTAGGAGAAGGAGGCAGG - Intronic
1174367101 20:50063126-50063148 GTGCTTTGGGAGACAGAGGCAGG + Intergenic
1174419786 20:50391906-50391928 GGGCCTTATGAGAGGGAGGCGGG + Intergenic
1174945424 20:54980117-54980139 CTCCACTAGGAGAAGGAGACAGG - Intergenic
1175081060 20:56420639-56420661 GTGCTTTAGGAGGCTGAGGCAGG - Intronic
1175187050 20:57185721-57185743 GTGCATTAAGTGACAGAGGCAGG - Intronic
1175301842 20:57948530-57948552 GTGTATACTGAGAAGGAGGCTGG - Intergenic
1175953618 20:62596760-62596782 GTGCATGGCGGGAAGGAGGCCGG - Intergenic
1176025190 20:62982080-62982102 GGGCATTGGGAGAAGGGGGCAGG + Intergenic
1176191477 20:63812528-63812550 GTGCTTTGGGAGGTGGAGGCGGG + Intronic
1176215623 20:63946366-63946388 GTGGAGCAGGAGAAGGAAGCCGG - Intronic
1176699515 21:10026917-10026939 GTGCATTAGGAGACTGAAGAAGG - Intergenic
1176714033 21:10334588-10334610 GTACATTGGGAGACCGAGGCAGG - Intergenic
1178299756 21:31442477-31442499 GTGCCTTGGGAGGCGGAGGCAGG - Intronic
1179040389 21:37797295-37797317 GTGCTTTGGGAGACCGAGGCGGG - Intronic
1179487296 21:41718583-41718605 GTGCTTTAGGAGGCTGAGGCGGG - Intergenic
1179536861 21:42058570-42058592 GTGCTTTAGGAGGCTGAGGCAGG - Intergenic
1180278467 22:10668690-10668712 GTACTTTAGGAGACTGAGGCAGG + Intergenic
1180394181 22:12314402-12314424 GTGGGTTAGGGGAAGGGGGCAGG - Intergenic
1180405565 22:12550347-12550369 GTGGGTTAGGGGAAGGGGGCAGG + Intergenic
1180489397 22:15828561-15828583 GTACTTTAGGAGACGGAGGCGGG + Intergenic
1181450962 22:23020394-23020416 ATGCATCAGGAGTAGGAGGCAGG + Intergenic
1181720671 22:24771989-24772011 GTTCATTAAGAGAAATAGGCCGG - Intronic
1181781390 22:25196118-25196140 GTGCAAAAGGAGACGCAGGCTGG - Exonic
1182040961 22:27238763-27238785 GTGCATTAAGAGAATGTGCCGGG + Intergenic
1182738381 22:32547494-32547516 GACCATGAGGGGAAGGAGGCAGG - Intronic
1183040359 22:35173193-35173215 GTGCTCTAGGAGAAGCAGGCTGG - Intergenic
1183296882 22:37035060-37035082 GAGGATTCAGAGAAGGAGGCAGG - Intergenic
1183322263 22:37172338-37172360 GTGCATTAGGAGGTGCAGCCAGG - Intronic
1183507001 22:38214861-38214883 GGGCACTAGGAGCAGGAGGCCGG - Exonic
1183754129 22:39743326-39743348 GAGCTTTTGGATAAGGAGGCAGG - Exonic
1184296586 22:43529014-43529036 GTGCCCTAGGTTAAGGAGGCAGG + Intronic
1184364357 22:44040482-44040504 GGTCCTTATGAGAAGGAGGCAGG + Intronic
1184536289 22:45089443-45089465 GAGCTTTAGGAGACAGAGGCAGG + Intergenic
1185188413 22:49417384-49417406 GTGCATCAGAAGCTGGAGGCAGG - Intronic
950020128 3:9781197-9781219 GCGCTTTGGGAGATGGAGGCAGG + Intronic
950286164 3:11746880-11746902 GTGCATTGGGAGGTCGAGGCAGG - Intergenic
950390274 3:12691054-12691076 GTGCTTTGGGAGACTGAGGCGGG + Intergenic
950675241 3:14550601-14550623 ATGCATGAGGAGATTGAGGCCGG - Intergenic
950774945 3:15341307-15341329 GTGGATGATGAGAAGGAGTCAGG - Intronic
951129211 3:19022011-19022033 GTGTATTTGGAGAAGCAGGTAGG - Intergenic
952169503 3:30791432-30791454 GTGCATGAGGAAGTGGAGGCAGG - Intronic
952266623 3:31793180-31793202 TGCCATCAGGAGAAGGAGGCAGG - Intronic
952920114 3:38278182-38278204 GAGCATGAGCAGGAGGAGGCGGG - Exonic
953236820 3:41114155-41114177 TGGCATAGGGAGAAGGAGGCTGG + Intergenic
954073124 3:48157800-48157822 GGGCATTAGGAGAAGGGAGTGGG - Exonic
954261739 3:49444118-49444140 GTGCTTTGGGAGACAGAGGCAGG - Intergenic
954594743 3:51814708-51814730 CTGCTTTAGGAGGAGGAGGAGGG - Intergenic
955514067 3:59709256-59709278 GGGCATTATAAGAGGGAGGCAGG + Intergenic
955554674 3:60124162-60124184 GTGCTTTAGGAGGGTGAGGCAGG - Intronic
955789229 3:62571434-62571456 GAGCTTTTGGAGAAGGAGGAAGG - Intronic
956130257 3:66046646-66046668 GTACTTTGGGAGGAGGAGGCGGG - Intergenic
958868255 3:99526346-99526368 GGGTATTAGGAGTAGGAGGTGGG - Intergenic
959351951 3:105276852-105276874 GTGCATTTGGACAATGATGCTGG + Intergenic
960365167 3:116762239-116762261 GAACATTATGAGAAGGAGGAAGG + Intronic
960657798 3:120025110-120025132 GTACTTTGGGAGACGGAGGCGGG + Intronic
961281975 3:125771282-125771304 GTGCATGAGGGGATGGAGGATGG - Intergenic
961386738 3:126527085-126527107 GTGGAATAGGGGAAGGGGGCTGG - Intronic
962407089 3:135109727-135109749 GTGCAGTGGGAGAAGGAAGGAGG + Intronic
962649708 3:137476201-137476223 GGGCCTTGGGAGCAGGAGGCTGG + Intergenic
963253228 3:143120577-143120599 GTTACTTAGGAGGAGGAGGCTGG + Intronic
964777825 3:160298042-160298064 GTGAATAGGGAGAAGAAGGCAGG + Intronic
967860618 3:194148671-194148693 GTGCATGGGTAGAAGGAGGTGGG - Intergenic
968075836 3:195815812-195815834 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968075848 3:195815857-195815879 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968075860 3:195815902-195815924 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968075872 3:195815947-195815969 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968075884 3:195815992-195816014 CTGCGTAGGGAGAAGGAGGCCGG - Intergenic
968075897 3:195816037-195816059 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968075909 3:195816082-195816104 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968075921 3:195816127-195816149 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968075933 3:195816172-195816194 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968075945 3:195816217-195816239 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968075957 3:195816262-195816284 CTGTGTAAGGAGAAGGAGGCCGG - Intergenic
968076095 3:195816780-195816802 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968076131 3:195816908-195816930 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968076144 3:195816953-195816975 CTGTGTAAGGAGAAGGAGGCCGG - Intergenic
968076195 3:195817125-195817147 CTGCATAAGGAGAAGGAGGCCGG - Intergenic
968076231 3:195817253-195817275 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968076318 3:195817564-195817586 CTGCTTAAGGAGAAGGAGGCCGG - Intergenic
968341309 3:197958284-197958306 GTACTTTAGGAGAACAAGGCAGG - Intronic
968673137 4:1862972-1862994 GTGCTTTGGGAGGTGGAGGCAGG + Intergenic
969455379 4:7297145-7297167 CTGCATTAGGTGGAGGGGGCTGG + Intronic
970010574 4:11454576-11454598 GTGTATCAGAAGAAGGAGGCTGG + Intergenic
970018083 4:11535052-11535074 TTGCATTTGGAGATGGAGGAGGG + Intergenic
970107943 4:12606195-12606217 GTGCATTTGGGGGAGGTGGCCGG - Intergenic
970127904 4:12834908-12834930 GAAAATTATGAGAAGGAGGCCGG - Intergenic
971425115 4:26508233-26508255 GTGCTTTAGGAGGCTGAGGCAGG - Intergenic
971618995 4:28829772-28829794 GTGCTTTGGGAGGTGGAGGCAGG + Intergenic
971661197 4:29418259-29418281 GTACTTTGGGAGAACGAGGCGGG - Intergenic
973248273 4:48034080-48034102 GAGCATTAGAGGAAGGAGGCTGG + Intronic
974440832 4:61914807-61914829 TTGCATCAGGAGAAAAAGGCAGG + Intronic
974849598 4:67388576-67388598 TGGCATTAGGAGATGGGGGCAGG - Intergenic
975167891 4:71198712-71198734 GTGCTTTAGGAGGCTGAGGCAGG + Intronic
975257441 4:72254754-72254776 GCACTTTAGGAGACGGAGGCAGG - Intergenic
976291690 4:83425031-83425053 ATGCTTTGGGAGAACGAGGCGGG + Intronic
977609849 4:99020482-99020504 GAGCCTGAGGAGGAGGAGGCGGG + Intronic
977609863 4:99020537-99020559 CTGCCTGAGGAGGAGGAGGCGGG + Intronic
980227407 4:130004523-130004545 GTGCTTTGGGAGGCGGAGGCAGG + Intergenic
980371926 4:131885551-131885573 GTGCATTAGGAGACTGAAGAAGG - Intergenic
981216624 4:142177084-142177106 CTGAATTAGGAGAAAGAGGCAGG - Intronic
981341862 4:143630764-143630786 GTATGTTAGGAGAAAGAGGCTGG + Intronic
982619311 4:157683569-157683591 GTACACTTGGAGAAGGAGCCTGG - Intergenic
982742612 4:159073625-159073647 CTGGATTAGGAGAGGGAGGATGG - Intergenic
983253169 4:165368009-165368031 GTGCATAAGGAGAGTCAGGCAGG - Intronic
983365004 4:166775219-166775241 GTGGATGAGGAGAAAGTGGCAGG + Intronic
983932990 4:173473622-173473644 GTGCATAAGGAAAAAGAGGCAGG + Intergenic
984093624 4:175407404-175407426 GTGCATTAGGGGAAGTAGTTAGG + Intergenic
985213341 4:187619492-187619514 GTGCTTTGGGAGACGGAGTCAGG + Intergenic
987121864 5:14775644-14775666 GTGCATAAAGAGCTGGAGGCAGG + Intronic
987247761 5:16065696-16065718 GTGCATGAGGTGGAGAAGGCTGG - Intergenic
987875878 5:23680656-23680678 GTGTTTTAGGAGATGGAGGAGGG + Intergenic
988669205 5:33362796-33362818 CTGCAGTCTGAGAAGGAGGCAGG + Intergenic
990476542 5:56166507-56166529 GTGCTTTGGGAGACAGAGGCAGG - Intronic
990809523 5:59706784-59706806 GTGCATAAGGAGAAGGAGCTCGG - Intronic
991901091 5:71461356-71461378 GTGCTTTAGGAGTGTGAGGCAGG + Intronic
991989534 5:72323890-72323912 GTACTTTAGGAGACTGAGGCGGG - Intronic
992387552 5:76300258-76300280 GTGCTTTGGGAGGATGAGGCAGG - Intronic
993074894 5:83217105-83217127 GTGCATTGGGAGGACAAGGCGGG + Intronic
993728686 5:91397272-91397294 GAGCCTTAGGACAAGGAGTCTGG - Intergenic
993862784 5:93156757-93156779 GTTCATGAGCTGAAGGAGGCTGG - Intergenic
994433697 5:99701069-99701091 GTGCTTTAGGAGACTGAGGCAGG - Intergenic
995026308 5:107427304-107427326 GTCCATTTGGAGAGTGAGGCCGG + Exonic
995632244 5:114146627-114146649 GAGCATTAGGAGAAGGCCTCAGG + Intergenic
997014500 5:129916787-129916809 GTGCATAAGAAGGAGGAGTCAGG + Intronic
997446076 5:133941358-133941380 GTGCAGTGGGAAAAGGAGGAGGG + Intergenic
997484340 5:134216748-134216770 GTGCTTTGGGAGGCGGAGGCTGG - Intronic
997858315 5:137392945-137392967 ATGTGTTAGGAGAAAGAGGCTGG - Intronic
998016543 5:138736627-138736649 GTGCCTTGGGAGATGGAGGTGGG + Intronic
999181454 5:149672547-149672569 GAACATTGGGAGATGGAGGCGGG + Intergenic
999635864 5:153621664-153621686 GTGCTTTGGGAGAGGCAGGCTGG - Intronic
1001135564 5:169099811-169099833 CTGCATTAGGTCAAGAAGGCAGG + Intronic
1001630963 5:173175197-173175219 CTGCATTAAGAGAAGCAGGCTGG - Intergenic
1001833157 5:174806470-174806492 GTGCTTTAGGAGGCTGAGGCAGG - Intergenic
1002721606 5:181264776-181264798 GCACTTTAGGAGACGGAGGCGGG + Intergenic
1003582888 6:7358592-7358614 GTGCTTTGGGAGACGGAGGCGGG + Intronic
1003872779 6:10415113-10415135 GTGGAGGAGGAGAAGGAGGAGGG + Exonic
1003978100 6:11363284-11363306 TTGCATTGGGAGAAGTAGGTGGG + Intronic
1004118134 6:12791195-12791217 CTGCAGAAGGAGAAGGAAGCAGG + Intronic
1004359582 6:14959305-14959327 GTGCTTTGGGAGGTGGAGGCAGG - Intergenic
1004729686 6:18345634-18345656 GTGCTTTAGGAGGCTGAGGCAGG - Intergenic
1006718452 6:36135097-36135119 GTGCTTTGGGAGATGGAGGCTGG - Intronic
1006777294 6:36605241-36605263 GTGCATTGGGAGGTTGAGGCAGG + Exonic
1007479147 6:42138531-42138553 GTGCTTTGGGAGACTGAGGCAGG - Intronic
1007517812 6:42427495-42427517 GTGCTTTGGAAGATGGAGGCAGG - Intronic
1007537952 6:42611657-42611679 GTGCTTTGGGAGACTGAGGCAGG + Intronic
1007865074 6:44959134-44959156 GTGCTTTGGGAGACCGAGGCAGG - Intronic
1008331157 6:50246433-50246455 GTGGAATGGGAGAAGGAGGGAGG - Intergenic
1008445939 6:51590796-51590818 GCGCTTTGGGAGACGGAGGCAGG - Intergenic
1008507928 6:52248738-52248760 GTATATTTGGAGAAGGAGGCTGG - Intergenic
1008674037 6:53800496-53800518 GAACTTTAGGAGACGGAGGCAGG - Intronic
1009876222 6:69508633-69508655 GTGCCTTAGGGAAAGGAGGCTGG + Intergenic
1011208239 6:84924653-84924675 GCACATTAGGAGACCGAGGCAGG - Intergenic
1011726120 6:90212298-90212320 ATGCATTGGGGGAAGGGGGCAGG - Intronic
1011822915 6:91273805-91273827 ATGAATTAGGCGAAGGAGCCAGG + Intergenic
1012382118 6:98632492-98632514 GTGCATATGGAGAGGGAAGCTGG - Intergenic
1012924980 6:105258580-105258602 GGACATTAACAGAAGGAGGCAGG - Intergenic
1015096712 6:129423441-129423463 GTGCTTTAGGAGGCTGAGGCAGG + Intronic
1015402149 6:132798712-132798734 GTGGATTAAGATAATGAGGCGGG - Intergenic
1015617928 6:135098582-135098604 ATGCTTTAGGAGACTGAGGCAGG - Intronic
1015829348 6:137351092-137351114 GTGCTTTAGGAGGTTGAGGCAGG - Intergenic
1016378778 6:143451140-143451162 GGGCATTGGGAGAAGGGGGTGGG + Intronic
1016926048 6:149349172-149349194 GTGCTTTGGGAGACTGAGGCGGG + Intronic
1017537798 6:155366911-155366933 GTGCTTTGGGAGACTGAGGCAGG + Intergenic
1020156309 7:5727478-5727500 GTGCTTTAGGAGGTGGAGGTGGG + Intronic
1020453850 7:8349515-8349537 CTGCTTTAGGAGAAGTATGCTGG + Intergenic
1022308144 7:29169986-29170008 GTGCTTTAGGAGGCAGAGGCAGG - Intronic
1022395772 7:29987144-29987166 GTGCAGAGGGAGAAGGTGGCAGG - Intronic
1023048610 7:36232551-36232573 ATGCATTAGGAGTAGGGGGAGGG - Intronic
1023119764 7:36897564-36897586 GAGGAGTAGGAGAAGGAAGCTGG + Intronic
1023322905 7:39018945-39018967 CTGCAATACAAGAAGGAGGCAGG - Intronic
1023594333 7:41812917-41812939 GCGCTCTAGGTGAAGGAGGCAGG + Intergenic
1023919882 7:44620265-44620287 GTGCTTTAGGAGGCTGAGGCAGG - Intronic
1024305676 7:47927508-47927530 GTGCTTTGGGAGACCGAGGCGGG - Intronic
1024478348 7:49838172-49838194 GTGAATTAGGAGGCAGAGGCAGG + Intronic
1024976093 7:55115113-55115135 GTGCATTGGGAGGCTGAGGCGGG - Intronic
1025005721 7:55353146-55353168 GTGCTTTGGGAGACCGAGGCAGG + Intergenic
1025121244 7:56305831-56305853 GTGCTTTGGGAGACCGAGGCAGG - Intergenic
1025244677 7:57307949-57307971 GTGCTTTAGGAGGCGGAGGTTGG + Intergenic
1026095730 7:67345091-67345113 GTGCATTAGGAGAATGGGGTGGG + Intergenic
1026105733 7:67419345-67419367 GGTCATTAGGAGAAGGACCCTGG + Intergenic
1026248198 7:68642154-68642176 GTACTTTAGGAGACGAAGGCAGG - Intergenic
1026938745 7:74274420-74274442 GTGCATCAGGAGGCTGAGGCAGG + Intergenic
1027168019 7:75849527-75849549 GTGCTTTAGGAGGCTGAGGCAGG + Intronic
1027170583 7:75869243-75869265 GTGCTTTAGGAGGCTGAGGCAGG - Intronic
1027234639 7:76291059-76291081 GTGCTTTGGGAGACTGAGGCAGG - Intergenic
1028344648 7:89764180-89764202 GTGCTTTGGGAGGATGAGGCAGG - Intergenic
1029004884 7:97198871-97198893 ATGCATTGGGAGAAGGAGGAGGG - Intergenic
1029074424 7:97924758-97924780 GTGCATGAGGGGATGGAGGATGG + Intergenic
1029447073 7:100619712-100619734 GTGCTTTGGGAGGATGAGGCGGG - Intergenic
1029638525 7:101802761-101802783 GTGCTTTGGGAGACCGAGGCAGG + Intergenic
1029990086 7:104955178-104955200 GTGCATTGGGAGGCTGAGGCAGG - Intergenic
1030930141 7:115512594-115512616 GTGCTTTAGGAGATGGAGGCAGG - Intergenic
1031825015 7:126553577-126553599 ATGCATTGGGAGACGGAGACAGG - Intronic
1031882521 7:127212827-127212849 GTGTATTAATAGAAGCAGGCTGG - Intronic
1032012730 7:128357489-128357511 GTGCCTCAGGGGAAGGATGCTGG - Intronic
1032122009 7:129163433-129163455 GAGACTTAGGAGATGGAGGCAGG - Intronic
1032816421 7:135479649-135479671 GTGCTTTGGGAGGCGGAGGCAGG + Intronic
1032954148 7:136951045-136951067 GTGCTTTTGGAGACTGAGGCAGG - Intronic
1033068526 7:138179994-138180016 GACAAGTAGGAGAAGGAGGCTGG - Intergenic
1033109698 7:138563167-138563189 GGGCCTAAGGAGAAGGAGCCTGG + Intronic
1033298531 7:140163526-140163548 GTGCTTTGGGAGACCGAGGCAGG - Intronic
1033555619 7:142486457-142486479 AAACATTAGGAGAAGGAGGAGGG - Intergenic
1033558008 7:142505947-142505969 ATCCATTAGGAGAAGGTGGAGGG - Intergenic
1033560465 7:142525985-142526007 AACCATTAGGAGAAGGAGGAGGG - Intergenic
1034400785 7:150860289-150860311 GTGCATTTGGGGAGGGGGGCGGG + Intronic
1035383739 7:158456883-158456905 GTGCTGTGGGAGATGGAGGCGGG - Intronic
1035886855 8:3300708-3300730 GTGCTTTGGGAGGACGAGGCGGG + Intronic
1036209368 8:6829761-6829783 GTGCTTTAGGAGGTGGAGGCAGG - Intronic
1036698541 8:10995266-10995288 GTGCTTTAGGAGACTGAAGCAGG + Intronic
1037863949 8:22427920-22427942 GTGCATTGGGAGATTGAGACAGG + Intronic
1038079054 8:24111580-24111602 CTGCATTAGGAAAAGGGGGAGGG - Intergenic
1038729885 8:30117239-30117261 GTGCTTTGGGAGGTGGAGGCAGG + Intronic
1038820773 8:30950098-30950120 GTGCTTTAGGAGGCCGAGGCAGG - Intergenic
1039490201 8:37941824-37941846 GTGCTTTGGGAGACTGAGGCGGG + Intergenic
1041606502 8:59788190-59788212 GAGAATTGGGAGATGGAGGCAGG - Intergenic
1041846977 8:62340465-62340487 GTGAAATAGGAGAAGGAGAAAGG + Intronic
1042107924 8:65348588-65348610 GGGCAGCAGGAGCAGGAGGCAGG + Intergenic
1042130474 8:65582718-65582740 GAGGAGAAGGAGAAGGAGGCAGG + Intergenic
1043821298 8:84868437-84868459 GTGCTTTAGGAGGCTGAGGCAGG - Intronic
1044188094 8:89280734-89280756 GTGTTTTAGGAGATGGAGGAGGG - Intergenic
1044580515 8:93821528-93821550 GTGCTTTGGGAGAATGAGGGTGG - Intergenic
1045019145 8:98026500-98026522 GTGCATTGGGAGGCTGAGGCAGG - Intronic
1045162717 8:99567005-99567027 GTGCTTTGGGAGGATGAGGCAGG - Intronic
1046447921 8:114347418-114347440 GTGCAGGGGGAGAAGGAGGAAGG - Intergenic
1047066045 8:121284314-121284336 ATGCATTAGGAGAAGGATTTAGG + Intergenic
1047406099 8:124586936-124586958 GCCCATTAGGAGAAGGCAGCAGG - Intronic
1047935792 8:129777014-129777036 GTGCTTTGGGAGACCGAGGCGGG - Intronic
1048322432 8:133410583-133410605 GGTCCTTAGGAGAGGGAGGCAGG + Intergenic
1048468876 8:134689513-134689535 CTGAATTAGGGGAAGGAGGCTGG - Intronic
1049024265 8:139977975-139977997 TTAAATTAGGAGTAGGAGGCTGG - Intronic
1049257015 8:141619571-141619593 GGGCACTAGGACAGGGAGGCAGG + Intergenic
1049302115 8:141877032-141877054 GTGCTTTGGGAGGCGGAGGCGGG - Intergenic
1049633214 8:143670777-143670799 GTGCTTTAGGAGACTGAGGCAGG - Intergenic
1050969209 9:11847098-11847120 GTCCCTAAGGTGAAGGAGGCAGG - Intergenic
1051893879 9:21969158-21969180 GTACTTTAGGAGGAGGAGGGGGG + Intronic
1052295867 9:26895415-26895437 GTGCTTTAGGAGGCCGAGGCGGG + Intergenic
1052355964 9:27504989-27505011 GGTCCTTATGAGAAGGAGGCAGG - Intronic
1052773239 9:32708413-32708435 GTGCTTTGGGAGACCGAGGCAGG + Intergenic
1052844593 9:33323993-33324015 GTGCTTTGAGAGATGGAGGCAGG + Intronic
1052914007 9:33910058-33910080 GTGCATTAGGAGAAAATGGGAGG - Intronic
1053188057 9:36036113-36036135 GTACTTTGGGAGGAGGAGGCTGG + Intergenic
1053636630 9:40013105-40013127 GTGCATTAGGAGACTGAAGAAGG - Intergenic
1053769362 9:41451511-41451533 GTGCATTAGGAGACTGAAGAAGG + Intergenic
1054317492 9:63610179-63610201 GTGCATTAGGAGACTGAAGAAGG - Intergenic
1054548030 9:66363014-66363036 GTGCATTAGGAGACTGAAGAAGG + Intergenic
1054915263 9:70489789-70489811 GTGCTTTGGGAGATGGAGGTAGG + Intergenic
1055618305 9:78096003-78096025 GTGCTTTGGGAGGCGGAGGCAGG + Intergenic
1056508574 9:87281118-87281140 GTGCCTTATAAGAGGGAGGCAGG + Intergenic
1056587691 9:87939032-87939054 GAGGATTAGGAGAAGGAAGAGGG - Intergenic
1056598210 9:88025263-88025285 GGGCAGTAGGAGGAGGGGGCAGG + Intergenic
1056618695 9:88191729-88191751 GTGCAGTTGAGGAAGGAGGCTGG - Intergenic
1057384507 9:94595290-94595312 GTGCACTAGGAGGTGGTGGCTGG + Intergenic
1058748200 9:108012722-108012744 GTGGGTTAAGTGAAGGAGGCAGG - Intergenic
1059109250 9:111539465-111539487 GTTCAATAAGAGAATGAGGCTGG + Intronic
1060837132 9:126764641-126764663 ATGCTTTGGGAGGAGGAGGCAGG - Intergenic
1060874274 9:127069055-127069077 GTGCATATGAAGAAGGAGGCAGG - Intronic
1061143986 9:128786616-128786638 GTGCTTTGGGAGGACGAGGCAGG - Intergenic
1062402125 9:136377399-136377421 GTGTCTTAGGAGGAGGAAGCTGG - Intronic
1185699838 X:2222629-2222651 GTGCTTTGGGAGAACAAGGCAGG + Intronic
1185725726 X:2420110-2420132 GTCTATTAAGAGAATGAGGCCGG + Intronic
1186191283 X:7069522-7069544 GGGCATTCAGAGAAGGGGGCAGG + Intronic
1187675596 X:21712996-21713018 ATGCATTATGGGAAGAAGGCAGG - Intronic
1187988548 X:24842980-24843002 GTGTATTGGGGGAGGGAGGCAGG - Intronic
1188375374 X:29421996-29422018 GTGCATGAGGAGAACCAGGGTGG + Intronic
1189105496 X:38231057-38231079 GCACTTTAGGAGAACGAGGCGGG + Intronic
1190093296 X:47458866-47458888 GTGCTTTAGGAGGCTGAGGCAGG - Intronic
1194699186 X:97092936-97092958 GTGCCTTGGGAGGTGGAGGCAGG + Intronic
1194702445 X:97130778-97130800 GGGCTTTAGGAGACTGAGGCAGG + Intronic
1195029548 X:100912949-100912971 GTGCTTTGGGAGACCGAGGCGGG + Intergenic
1195519535 X:105815189-105815211 GGGGGTTAGGAAAAGGAGGCAGG - Intergenic
1196721068 X:118854357-118854379 GAGCTTTGGGAGAATGAGGCAGG + Intergenic
1196760487 X:119196712-119196734 GTGCTTTGGGAGTATGAGGCAGG - Intergenic
1196900033 X:120373895-120373917 GTGGAGCAGGAGGAGGAGGCGGG - Intronic
1197440821 X:126487655-126487677 GTGCTTTGGGAGATCGAGGCAGG + Intergenic
1198006495 X:132499852-132499874 AGCCATTATGAGAAGGAGGCAGG + Intergenic
1198142917 X:133823731-133823753 GTGCTTTGGGAGGATGAGGCGGG + Intronic
1198273432 X:135077702-135077724 GAGCAATAGGAGTTGGAGGCAGG - Intergenic
1198305247 X:135375542-135375564 GTGCTTTAGGAGACTGAGGTGGG + Intergenic
1198724462 X:139662788-139662810 GTGAATTTGGAGAAGGGGGAGGG - Intronic
1199673531 X:150166018-150166040 CTCCATCAGGAGATGGAGGCAGG - Intergenic
1199786662 X:151112256-151112278 CTGCAGTGGGAGAAGGATGCGGG + Intergenic
1199799910 X:151240323-151240345 CTGTATTAGGAAAAGGAGGGAGG - Intergenic
1201143446 Y:11047410-11047432 GAGCATAAGGAGAGGGAGGGAGG + Intergenic