ID: 1174240463

View in Genome Browser
Species Human (GRCh38)
Location 20:49130308-49130330
Sequence GGGGAGAGACTGACTGCAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 517
Summary {0: 1, 1: 0, 2: 16, 3: 81, 4: 419}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174240460_1174240463 -5 Left 1174240460 20:49130290-49130312 CCAGAGCCTGAGGACAGAGGGGA 0: 1
1: 0
2: 1
3: 57
4: 533
Right 1174240463 20:49130308-49130330 GGGGAGAGACTGACTGCAAAGGG 0: 1
1: 0
2: 16
3: 81
4: 419

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174240463 Original CRISPR GGGGAGAGACTGACTGCAAA GGG Intronic
900695506 1:4007003-4007025 GGGGAGAGAGAGACAGAAAAAGG + Intergenic
901247400 1:7743470-7743492 GGGCAGAGACGGACTGCAGATGG - Intronic
901535756 1:9882126-9882148 GGGGAGAGGCTGGCTGCCAATGG + Intronic
902175454 1:14646825-14646847 GGAGAGAGACAGAAAGCAAAGGG - Intronic
903142602 1:21348064-21348086 GGGGAGGGAATGACTGGAAAGGG + Intergenic
903302208 1:22387114-22387136 GGGGAGGGACTGATTGCAAAAGG + Intergenic
903725712 1:25442313-25442335 TGGCAGATACTGAATGCAAAAGG + Intronic
904652035 1:32013349-32013371 GGAGTGAGACAGACTGCACAGGG - Intergenic
905091724 1:35435642-35435664 TGGGAGAGCCTGACTGAAATGGG + Intronic
905483416 1:38277177-38277199 GGGAAGTGAGTGACTACAAAGGG - Intergenic
905713767 1:40130382-40130404 GGGGAGTGACTGACTGATAATGG - Intergenic
905722595 1:40218403-40218425 GGGGAAAGACAGACTGAATAAGG - Intronic
906268491 1:44454818-44454840 GAGAAGAGGCTGACTACAAAGGG - Intronic
907036982 1:51225178-51225200 GGGGTGGGACTGACTGTAGACGG - Intergenic
907098416 1:51803552-51803574 GTGGAGAAACTGACAGCAAAGGG + Intronic
907382574 1:54103395-54103417 GGGGAGAGAGAGAGTGCAAAGGG + Intronic
907502276 1:54889873-54889895 GGGGAGAGTATGACTACAAAGGG - Intergenic
907727155 1:57030239-57030261 GGGGAGAGGCAGAAGGCAAAGGG - Intronic
907898767 1:58718247-58718269 AGGCTGAGGCTGACTGCAAAGGG - Intergenic
908223290 1:62030664-62030686 AAGGAGAGAGTGACTGTAAAGGG - Intronic
908497937 1:64713740-64713762 GGGTTGAGAGTGACTGCAAATGG + Intergenic
909173161 1:72320232-72320254 AAGGAGATACTGACTGGAAAGGG - Intergenic
909583022 1:77259402-77259424 GGGGAGAGTCAGAATGCAGATGG + Intergenic
910795544 1:91094114-91094136 GAGCAGAGACTGATTGCAAATGG - Intergenic
910912382 1:92250973-92250995 GGGAGGAAACTGACTACAAAGGG - Intronic
910976056 1:92907362-92907384 GGAGAGTGACTGACTGGGAAGGG + Intronic
910985445 1:93000516-93000538 GGGCAGAGACAGACTGCAGGAGG + Intergenic
911073790 1:93853190-93853212 GTGAAGTGACTGACTGCTAATGG + Intergenic
911131397 1:94391965-94391987 GGGGAGGGAGTGGTTGCAAAGGG + Intergenic
913111492 1:115661320-115661342 GGGCAGAGATTGACTAGAAAGGG - Intronic
914198583 1:145464817-145464839 AGGGCGGAACTGACTGCAAAGGG - Intergenic
914386677 1:147175963-147175985 GGGGAGTGATTGACTACAAAAGG + Intronic
914477690 1:148037952-148037974 AGGGCGGAACTGACTGCAAAGGG - Intergenic
914511175 1:148333799-148333821 AGGGCGGGACTGACTGCAAAGGG - Intergenic
914785664 1:150827315-150827337 GAGCAGAGATTGACTGCAGATGG - Intronic
914991748 1:152504917-152504939 AGGGAGAGGCTGGCTGCAAAGGG - Intergenic
915951442 1:160192219-160192241 GGAGAGAGACTGACAGCGACCGG - Intronic
916243449 1:162662494-162662516 AGAGAGAGACAGACTGCAAATGG - Intronic
916659568 1:166909267-166909289 GAGGATAGACTTACTCCAAAAGG - Exonic
918298668 1:183182199-183182221 GGACAGGGACTGACTGCAATGGG - Intergenic
920191161 1:204194800-204194822 GGGCAGGGGCTGAGTGCAAAGGG + Intronic
920875547 1:209831707-209831729 GGTGGGGAACTGACTGCAAAAGG - Intronic
921861127 1:220043126-220043148 GGGAAAGGAATGACTGCAAAGGG + Intronic
922112041 1:222569082-222569104 GGGGACAGACAGGCTGCAAAGGG + Intronic
922203439 1:223426374-223426396 GGGGTCAGACTGGCTGCAAAGGG - Intergenic
922382643 1:225048055-225048077 GGAGAGAGTGTGACTACAAAAGG - Intronic
923393880 1:233541724-233541746 GGGTAGAAATTGACTGTAAAGGG + Intergenic
923558312 1:235019424-235019446 AGGGAGAGACTGCATCCAAAGGG + Intergenic
923838101 1:237637032-237637054 GGGGAGAAAGGGACTGCAAAGGG + Intronic
923921688 1:238572867-238572889 GGGTAGAGACTGACTTCAGAAGG + Intergenic
1062848060 10:723124-723146 GGCGAGAGACAGACAGCAACAGG + Intergenic
1063338750 10:5243295-5243317 GAGGAGAGATTGCCTGCAGATGG + Intergenic
1064097693 10:12436103-12436125 GGTGGGAGACTGAGTGCCAATGG + Intronic
1065149451 10:22807359-22807381 GGGTAGAGACTTACTGCAGAGGG - Intergenic
1065159146 10:22901048-22901070 GGGGAGAGAGAGAGTTCAAATGG + Intergenic
1065412740 10:25447936-25447958 GGTGTGGGACTGACTGCCAAGGG - Intronic
1065421281 10:25547179-25547201 GGGGAGAGACTGAAGGCGAGAGG - Intronic
1065820300 10:29518973-29518995 GGGGAGAGACTGACACAACAAGG + Intronic
1065893278 10:30138994-30139016 GGGGAGGGACAGACGGCACAGGG + Intergenic
1065952713 10:30666564-30666586 GGGGAGAGACTGACGCAACAAGG - Intergenic
1066039596 10:31534388-31534410 GGGGAGTGACTGACTACTAATGG + Intergenic
1067258673 10:44667065-44667087 GGGGACAACCTGCCTGCAAAAGG - Intergenic
1067981494 10:51091364-51091386 GAGCAGGGACTGACTGCAATTGG - Intronic
1068757892 10:60674720-60674742 TGGGGGAGATTCACTGCAAAGGG - Intronic
1069057794 10:63863029-63863051 GGGGAAGGATTGACTGCAAAAGG - Intergenic
1069688585 10:70334983-70335005 GGGGGGAGCCTGTCTGCAGAGGG - Intronic
1071768386 10:88696398-88696420 GGAGAGAGACAGAGAGCAAAGGG + Intergenic
1071913165 10:90258648-90258670 TGGGAGATAATGACTGCAAAGGG + Intergenic
1071997915 10:91164272-91164294 CGGGGGAGACTTAGTGCAAAAGG + Intronic
1072458440 10:95597725-95597747 AGGGAGAGAGTGACCTCAAATGG - Intergenic
1072981577 10:100102532-100102554 GGCTAGAAAGTGACTGCAAATGG - Intergenic
1073093015 10:100959909-100959931 GGGGAATGAATGACTGCTAATGG - Intronic
1073108527 10:101047361-101047383 GGAGAGAAGCTGACAGCAAACGG + Intergenic
1073514939 10:104067923-104067945 GGGGAGAGACATAATGTAAAAGG + Intronic
1074687438 10:115973420-115973442 GGGAAGAGGCTGAGTCCAAAGGG - Intergenic
1075472996 10:122707428-122707450 GGGGAGAGAGCGATTACAAAGGG - Intergenic
1076859302 10:133133048-133133070 GTGCAGAGACTGGCTGCAACGGG + Intergenic
1077463755 11:2723718-2723740 GAGGAGAGGCTGTCTGCCAAGGG - Intronic
1078841554 11:15080299-15080321 AAGGAGTGATTGACTGCAAAGGG - Intronic
1080057408 11:27920419-27920441 GAGTAGAGACTGACTGCAAAGGG - Intergenic
1080161589 11:29182951-29182973 GGGGAGGGGCTGACTAGAAAAGG + Intergenic
1080273447 11:30475435-30475457 GGAAAGACACAGACTGCAAAGGG - Intronic
1080451625 11:32382969-32382991 GTGGAGAGACTGCATGTAAATGG + Intergenic
1081019868 11:37931930-37931952 GGAGAAAGACGCACTGCAAAGGG + Intergenic
1081057966 11:38434425-38434447 TGGGAGGAAGTGACTGCAAAGGG - Intergenic
1081995105 11:47359083-47359105 GGGGAGAGAAGGAGTGCAGAGGG + Intronic
1082625899 11:55485126-55485148 GGTGAGACCCTGTCTGCAAATGG - Intergenic
1082806015 11:57451073-57451095 GGGCAGAGACTGAGGGCAACTGG + Intergenic
1083783723 11:64931941-64931963 GAGGAGAAACTGAGGGCAAAGGG - Intronic
1083829056 11:65219485-65219507 TGGGAAAGACTCACTGAAAAGGG + Intergenic
1084938989 11:72602312-72602334 GGGGAGAGACAGGGTGGAAAAGG - Intronic
1086265955 11:84998351-84998373 GGAGAGAGAATGAATGCAAATGG - Intronic
1087745073 11:101934607-101934629 GGGCAGAGATTGACTGCAAGAGG - Intronic
1089283540 11:117391267-117391289 GGGGAGGGACTGAGTGCACAAGG + Intronic
1089829415 11:121313097-121313119 CTGGGGAGAATGACTGCAAACGG - Intergenic
1091860615 12:3778932-3778954 GAGGAGAGACTGATGGTAAAAGG - Intergenic
1091867094 12:3849658-3849680 GGGGAGAGACTGATTAAAAGAGG + Intronic
1091891896 12:4062743-4062765 AGGGAATGACTGTCTGCAAAGGG - Intergenic
1092017887 12:5174404-5174426 GGAGAGAGTATGACTACAAAGGG - Intergenic
1093354463 12:18149151-18149173 GAGGAGTGACTCACTGCAGAGGG - Intronic
1093721432 12:22446882-22446904 GGGAGTAGACTGACTGCAGAGGG + Intergenic
1094279028 12:28714289-28714311 GGGGAGGGAATGAGTGCAATTGG - Intergenic
1094565622 12:31595837-31595859 GGTGGGAAATTGACTGCAAAAGG + Intergenic
1095490934 12:42733133-42733155 GTGGAGAGACTGACTTCAAAGGG + Intergenic
1095503436 12:42866297-42866319 GGGAAGCAACTGACTGCAAAGGG - Intergenic
1096190725 12:49616719-49616741 GGGAGGAGACTGACTGCAAAAGG + Intronic
1096418538 12:51435290-51435312 TGGGAGAGACTAAATGAAAAGGG - Intronic
1096455331 12:51780331-51780353 GGGGAGAGGCTGACAGGAGAGGG - Intronic
1098070655 12:66670823-66670845 GGGCAGAGCCTGTCTGAAAATGG - Intronic
1098281684 12:68868520-68868542 GAGGAGAGACGGACTGGAACTGG - Intronic
1098336479 12:69410236-69410258 GAGTAGGGAGTGACTGCAAATGG - Intergenic
1099661471 12:85568544-85568566 GGTGTGAGAATGACTGCAACAGG + Intergenic
1100054554 12:90492486-90492508 GGGAACATACTGACTTCAAAGGG - Intergenic
1100267453 12:92991040-92991062 GGGAGGGGACTGACTCCAAAGGG - Intergenic
1100464061 12:94829643-94829665 GAGAAGAGACTAACTGCAAGTGG + Intergenic
1101404883 12:104419442-104419464 GAAGGGAAACTGACTGCAAATGG - Intergenic
1101428330 12:104606014-104606036 GGGGAGAGACTCACAGCACAGGG + Intronic
1101750032 12:107576007-107576029 GGAGAGAGACTGATTGGAACTGG - Intronic
1102010075 12:109612821-109612843 GGACAGAGAGTGACTGCCAAGGG - Intergenic
1102852020 12:116256451-116256473 GGGGAGACCCTGACTGCAAAAGG + Intronic
1103413405 12:120728312-120728334 GCAGACAGACTGAATGCAAATGG - Intronic
1103556119 12:121767494-121767516 GCCCAGAGAGTGACTGCAAATGG + Intronic
1103603512 12:122069777-122069799 AGAGAGGGACTGACTACAAAGGG + Intergenic
1103820136 12:123691286-123691308 GGGTAGGGAGTGACTGCTAATGG - Intronic
1103872858 12:124103236-124103258 AGGGGCAAACTGACTGCAAAAGG - Intronic
1105752439 13:23433717-23433739 GGGGAGCGACTGACTGCGGCAGG - Exonic
1106324781 13:28677872-28677894 GTGGGGTGACTGACTGAAAAGGG - Intronic
1106854678 13:33837211-33837233 AGGGATGAACTGACTGCAAAGGG - Exonic
1106864578 13:33949235-33949257 GGAGAGAGAATGAGTGCAAGTGG - Intronic
1107330852 13:39297498-39297520 GGAGAGAGAGAGACAGCAAAGGG - Intergenic
1107675484 13:42792388-42792410 GGGAGGAGATTGACTGCAAAAGG - Intergenic
1108321945 13:49298289-49298311 GGGGAGTGGCTGGCTGCAGAAGG - Intergenic
1108539015 13:51418948-51418970 TTTGGGAGACTGACTGCAAATGG - Intronic
1108994130 13:56703461-56703483 GGGTAAGGAATGACTGCAAATGG - Intergenic
1109994596 13:70107579-70107601 GGGGGGAGGCTGCCTGCAACAGG - Exonic
1112693951 13:101926870-101926892 AGGTTGACACTGACTGCAAATGG + Intronic
1112986205 13:105453158-105453180 TGAGAGAGACTGACAGGAAAAGG - Intergenic
1114403183 14:22429182-22429204 AGGGAGAGACTCAAGGCAAAGGG - Intergenic
1114728066 14:24960193-24960215 GGGCTGAGACTGAGTCCAAAGGG + Intronic
1115194643 14:30783162-30783184 GGTTGGAGATTGACTGCAAATGG + Intergenic
1115202911 14:30873468-30873490 GAGAAGAGACTGACTGACAATGG + Intergenic
1115746388 14:36442115-36442137 GGGAGGGGATTGACTGCAAAGGG + Intergenic
1116549335 14:46215631-46215653 GGTCAGAGTTTGACTGCAAAAGG + Intergenic
1117169445 14:53077782-53077804 GGATAGAGAGTGACTGCTAATGG - Intronic
1117445060 14:55796309-55796331 GAGTAGAGAGTGACTGCTAATGG + Intergenic
1118035529 14:61862256-61862278 GAGAGGAGACTGACTGCAATGGG - Intergenic
1118369855 14:65128792-65128814 GTGGGGAGACTGAGAGCAAAGGG + Intergenic
1118407018 14:65434965-65434987 GGGGAGAGGTTAACTACAAATGG - Intronic
1118714606 14:68550075-68550097 GGGCAGAGCCTGCCTGCAGAGGG - Intronic
1118961238 14:70535395-70535417 GGGAAGAAACTGACTGGGAAGGG + Intergenic
1119794809 14:77386296-77386318 AGGGATGGGCTGACTGCAAAGGG - Intronic
1122010982 14:98746749-98746771 GACGAGAGAGTGACTGCACAAGG - Intergenic
1122230670 14:100305159-100305181 GGGGAGAGACTCGTTGAAAAGGG - Intronic
1122828677 14:104384780-104384802 GGGGACAGAGTGACTACAACTGG - Intergenic
1122888583 14:104722545-104722567 GGGAAGAGGCAGACTGCAACAGG - Intergenic
1122981480 14:105194156-105194178 GGGGAGAGACTGACGGCGGCTGG - Intergenic
1123002160 14:105301338-105301360 GTGGAGAGACGGCCTGCGAAGGG + Exonic
1125159653 15:36628201-36628223 GGGGAAAAACTGACCACAAAAGG - Intronic
1125963745 15:43855001-43855023 GGGAGGAGAATGACTACAAAAGG - Intronic
1126136270 15:45395165-45395187 GGATAGAGATTGTCTGCAAATGG - Intronic
1126752806 15:51894561-51894583 GGTCAGAGAATGACTACAAAGGG - Intronic
1128257994 15:66212402-66212424 GTGGGGGGACTGGCTGCAAAAGG + Intronic
1129506982 15:76089565-76089587 GGGGAGAGATAAATTGCAAAAGG + Intronic
1129619113 15:77127700-77127722 GGAGAGAGACGAACTGAAAAAGG + Intronic
1129820778 15:78600399-78600421 AGGGAGACACTGACTGGCAAGGG + Intronic
1130244166 15:82228210-82228232 GGGTAGCCACTGACTGCAAATGG + Exonic
1130297446 15:82657100-82657122 GGGGAGAGTATGACTGCAGAAGG - Intergenic
1130456285 15:84112929-84112951 GGGTAGCCACTGACTGCAAATGG - Intergenic
1130611456 15:85364926-85364948 GGGGAGAGACAGATTCCTAACGG + Intergenic
1130616216 15:85410524-85410546 GGGAAGAAAATAACTGCAAAGGG - Intronic
1130921103 15:88345274-88345296 GGGGAGAGAATGACTGGGATGGG - Intergenic
1131087422 15:89588643-89588665 GGGGAGAGAGTGACTGAAGGAGG + Intronic
1131518192 15:93093449-93093471 GTGGAGATATTGACTGCAAGGGG + Intergenic
1131627381 15:94135739-94135761 AGGGGGAGACTGAATACAAAGGG - Intergenic
1131852292 15:96555856-96555878 AGGGAGGGAATGACTGCTAATGG + Intergenic
1133101474 16:3482663-3482685 GGGAAGAGACTGGGTGCAGATGG - Intronic
1133520695 16:6553722-6553744 GAGGAGAGAAGGACAGCAAAAGG + Intronic
1136287460 16:29252895-29252917 GGGGAGAAGATGAATGCAAAGGG + Intergenic
1136749420 16:32619865-32619887 AGAGAGAGACAGACTGCAGAAGG - Intergenic
1137431361 16:48420428-48420450 GGGTGGAGACTGACTGTGAAGGG + Intronic
1137433934 16:48440409-48440431 GGGAGGAGAGGGACTGCAAAAGG + Intronic
1137755998 16:50902739-50902761 GTGGAGACACAGAATGCAAAGGG + Intergenic
1137756071 16:50903402-50903424 GGGGAGAACCTGCCTGAAAATGG - Intergenic
1137994268 16:53192632-53192654 GGGGAAAGACTGAGTGCAAACGG - Intronic
1138452980 16:57104871-57104893 GGAGAGAGCCTGACAGCAAAGGG + Intronic
1139130605 16:64138767-64138789 GTGAAGAAACTGCCTGCAAAGGG - Intergenic
1139789946 16:69425711-69425733 TGGGAGAGAATGACTGCAAAGGG - Intronic
1139838113 16:69856301-69856323 GAGGAGGGATTGACTGCAAAGGG + Intronic
1141397223 16:83715921-83715943 GGAGAGAAAATTACTGCAAAAGG - Intronic
1142310980 16:89313405-89313427 GGTGAGAGACCGTCTGCAGAAGG + Intronic
1143085127 17:4410369-4410391 AGGTAGAGAGTGACTGCTAATGG + Intergenic
1143204947 17:5134839-5134861 GGGGAGAGGCTGGGTGCATAGGG + Intronic
1143888253 17:10082994-10083016 GGAGAGAAACTGACTGCAAAGGG + Intronic
1144186613 17:12802553-12802575 GAGGAGAGGCAGAGTGCAAAAGG + Intronic
1144233901 17:13237853-13237875 GGGGAGAGTGTGACTACTAATGG - Intergenic
1144710304 17:17397353-17397375 GAGGAGAGACTGGCTGGGAAAGG + Intergenic
1144875990 17:18397521-18397543 GGGGAGAGGCTGGGTGCATAGGG + Intergenic
1145156238 17:20546899-20546921 GGGGAGAGGCTGGGTGCATAGGG - Intergenic
1145798411 17:27668782-27668804 AGGGAGAGGCTGGCTGCATAGGG - Intergenic
1146160677 17:30557829-30557851 GGGGAGAGGCTGGGTGCATAGGG + Exonic
1146523325 17:33544014-33544036 AGGAACAGATTGACTGCAAAGGG - Intronic
1146641338 17:34543970-34543992 GTGGAGAGAGTGATTCCAAAGGG - Intergenic
1146738779 17:35262889-35262911 GGGGAGAGTTTGACTAAAAAGGG - Intronic
1146856020 17:36258920-36258942 GGGGAGAGGCTGGTTGCATAGGG - Intronic
1146864600 17:36329455-36329477 GGGGAGAGGCTGGTTGCATAGGG + Intronic
1146871926 17:36382831-36382853 GGGGAGAGGCTGGTTGCATAGGG - Intronic
1146879287 17:36433916-36433938 GGGGAGAGGCTGGGTGCATAGGG - Intronic
1146883217 17:36455061-36455083 GGGGAGAGGCTGGGTGCATAGGG - Intergenic
1147067460 17:37930043-37930065 GGGGAGAGGCTGGGTGCATAGGG + Intronic
1147074812 17:37983455-37983477 GGGGAGAGGCTGGGTGCATAGGG - Intronic
1147078991 17:38009604-38009626 GGGGAGAGGCTGGGTGCATAGGG + Intronic
1147086335 17:38063001-38063023 GGGGAGAGGCTGGGTGCATAGGG - Intronic
1147094928 17:38133539-38133561 GGGGAGAGGCTGGGTGCATAGGG + Intergenic
1147102281 17:38186964-38186986 GGGGAGAGGCTGGGTGCATAGGG - Intergenic
1147275634 17:39314070-39314092 GGATAGAGAGTGACTGCTAATGG - Intronic
1148944547 17:51248529-51248551 GGGGAGAGATTGAGTGGGAAAGG - Intronic
1149123751 17:53202663-53202685 GGGAAGAGTTTGACCGCAAAGGG + Intergenic
1149668152 17:58380924-58380946 GGGCAGATACTGTCTCCAAATGG + Intronic
1149846869 17:60013471-60013493 GGGGAGAGGCTGGGTGCATAGGG - Intergenic
1150085217 17:62270048-62270070 GGGGAGAGGCTGGGTGCATAGGG - Intergenic
1150138258 17:62707515-62707537 GTGGGAACACTGACTGCAAAGGG + Intronic
1150451949 17:65276545-65276567 GGGTTGAGAGTGACTGCTAATGG + Intergenic
1150601365 17:66653681-66653703 GGGGAGATGCAGAATGCAAACGG - Intronic
1151050141 17:70969034-70969056 GGAGAGGGATTAACTGCAAAGGG + Intergenic
1152494604 17:80662187-80662209 CAGGAGAAACTGACTGGAAAGGG - Intronic
1152838049 17:82547769-82547791 GGGATGAGGCTGACTGCCAAGGG - Intronic
1153031370 18:716331-716353 TGGAAGAGATTGACTGTAAAAGG + Intergenic
1155362074 18:25013499-25013521 GTGGGGAGACAGACTACAAAGGG - Intergenic
1155567692 18:27154381-27154403 GGGTGGAGACAGACTGCAGAGGG + Intronic
1156581293 18:38379544-38379566 AGGGAGAGACAGACTATAAATGG + Intergenic
1157847975 18:51021442-51021464 GAGGTGGCACTGACTGCAAAGGG + Intronic
1158214301 18:55083345-55083367 GGGGAGGGTGTGACTTCAAAGGG + Intergenic
1158854096 18:61525097-61525119 GGGGAGAGGTTGACTACAAAGGG + Intronic
1158922168 18:62205361-62205383 GGGTAGGAACTGACTGGAAAGGG - Intronic
1158939153 18:62391000-62391022 GGGAAGGGATTGACTGAAAAGGG - Exonic
1159839308 18:73378145-73378167 GGTGAAAGATTGAATGCAAAAGG + Intergenic
1160791377 19:925302-925324 GGGGAGGGACGGGCTGCAGACGG - Intergenic
1161088271 19:2344879-2344901 GGGGTGAGGCTGTCTGCAATCGG - Intronic
1161686259 19:5704134-5704156 GGTGAGAGACTGACTGGAAGAGG + Intronic
1161745328 19:6056036-6056058 TGGGCGAGAGTGACTGGAAAGGG + Intronic
1161773844 19:6246631-6246653 GGAGGGGGACTGACTTCAAAGGG + Intronic
1162364372 19:10239121-10239143 CAGGAGAGGTTGACTGCAAAAGG + Intergenic
1164546427 19:29168456-29168478 GGGAAGAGATTGACTGGCAAGGG + Intergenic
1165567359 19:36742415-36742437 AGGGAAGGACCGACTGCAAAGGG + Intronic
1165889798 19:39104514-39104536 GGGCAGAGCCTGGCTGCCAAGGG - Intronic
1166985745 19:46659369-46659391 GGGGAGAGACCGAGGGCAGAGGG + Intronic
1167025222 19:46911105-46911127 TGGGACAGATTGACTGGAAAAGG - Intergenic
1168038252 19:53737696-53737718 GGGTGGGAACTGACTGCAAATGG - Intergenic
1168190133 19:54732153-54732175 GGGCAGAGAATGAATGCACAAGG + Intronic
1168401146 19:56086978-56087000 GGGGAGACTCTGACTGCAAAGGG - Intergenic
925121362 2:1421160-1421182 GGCCAGAGACTGAAAGCAAAAGG + Intronic
925242485 2:2344123-2344145 AGGAAGAGACAGACTGCAAAGGG + Intergenic
925359298 2:3266503-3266525 GGGCAGAGACTGATTGCAGAAGG + Intronic
925455783 2:4015575-4015597 AGGGAAACACTGACTCCAAATGG - Intergenic
926355117 2:12034390-12034412 GAGCAGAGACTGACTCTAAATGG - Intergenic
927599671 2:24430063-24430085 GGGGAAGGATTGATTGCAAACGG - Intergenic
928417731 2:31110548-31110570 GGGAAGAGAATGGCAGCAAATGG + Intronic
928688474 2:33775007-33775029 GAGGAGAAACAGAATGCAAAAGG - Intergenic
929244468 2:39686632-39686654 GGGGAGAGCCTGAGTGCAGTAGG + Intronic
929599072 2:43193837-43193859 GGGAAGAGACAGAGAGCAAAGGG - Intergenic
930491858 2:52083728-52083750 AGGGAAATACAGACTGCAAATGG - Intergenic
930521202 2:52469873-52469895 GGAGAGAGAATGAGTGCAAATGG - Intergenic
931355970 2:61537977-61537999 GGGGGGAGTCGGACTGCAACTGG - Exonic
931844844 2:66192992-66193014 GGGGAGAGAATCACTGTAATGGG + Intergenic
932638224 2:73412237-73412259 GGGAAGTGACTGACTACAAAGGG - Intronic
933482553 2:82875835-82875857 GGGTGGAGACTGCCTGTAAAAGG + Intergenic
933625787 2:84597070-84597092 AGGGAAAGGCTGACTACAAAGGG - Intronic
933787169 2:85852578-85852600 GGGTGGGGACTGACTGCAGAGGG + Intronic
934914150 2:98285182-98285204 GAACAGAGAGTGACTGCAAATGG - Intronic
935254534 2:101297833-101297855 AGGGAGAGAGTGACTGCCAGTGG - Intronic
935684768 2:105673533-105673555 GGCGAGAGACTGGCTGAGAATGG + Intergenic
938226035 2:129617388-129617410 GGGGAGAGCCTGAGATCAAAAGG - Intergenic
938618697 2:133027028-133027050 GGTGAGAGACTCACTTCCAAGGG + Intronic
941484880 2:166067757-166067779 GGGCAGAGATTTACTCCAAAAGG - Intronic
942179614 2:173367386-173367408 GGGTGGAGACTGACTGGAACGGG + Intronic
942686785 2:178541090-178541112 GGGAAGGGACTGATTACAAACGG + Intronic
945158864 2:206867772-206867794 GAGGAGAGACTGATTTCCAAAGG - Intergenic
946072872 2:217049429-217049451 CGAGACAGACTGATTGCAAAAGG - Intergenic
946082203 2:217130798-217130820 GGGGAGTGACTGACTGATAATGG - Intergenic
946187938 2:217991749-217991771 GGGGAGAGAATGAGGGGAAATGG - Intronic
946383967 2:219370400-219370422 AGAGAGAGATTGATTGCAAAGGG + Intergenic
947285604 2:228511165-228511187 GGAGAGACAAAGACTGCAAATGG + Intergenic
947809500 2:232993927-232993949 GCAGAGTGAGTGACTGCAAATGG + Intronic
948292712 2:236838146-236838168 GGAGAGAGAATGAGTGCAAGCGG - Intergenic
948386651 2:237584924-237584946 GGTGAGAGGCTGTCTGCAGAGGG - Intronic
1168944989 20:1746062-1746084 CTGGGGAGAATGACTGCAAAGGG + Intergenic
1169157851 20:3348919-3348941 GGATGGAGACTGACTGCAAGTGG + Intronic
1169246061 20:4025877-4025899 GGCAAGAGGCTGACTGCAAAGGG - Intergenic
1169561891 20:6810514-6810536 GGGTAAAGACTGACTGAAAATGG + Intergenic
1169701880 20:8455794-8455816 GGGGAGTGAGTGGCTACAAAAGG - Intronic
1169727702 20:8753832-8753854 GGAGAGAGACAGCCTGTAAATGG - Intronic
1169771144 20:9202222-9202244 GAAGAGAGACTGACTGTCAAAGG + Intronic
1172784883 20:37461546-37461568 GGTGAGAGATTGACTTCAAAGGG - Intergenic
1173849097 20:46206750-46206772 GCAGAGAGACAGACAGCAAATGG - Intronic
1174065409 20:47861075-47861097 GAGAAGAGATTGACTGCCAAGGG + Intergenic
1174192781 20:48751976-48751998 GGGGAGGCACAGACTGGAAACGG + Intronic
1174240463 20:49130308-49130330 GGGGAGAGACTGACTGCAAAGGG + Intronic
1174314726 20:49689835-49689857 GGGTAGGGATTGACTGGAAAGGG - Intronic
1174876113 20:54227929-54227951 TAGGAGAGACAGACAGCAAAGGG - Intronic
1175049202 20:56137653-56137675 GGGTAAAGACTGACTGCAAAAGG - Intergenic
1176087236 20:63303727-63303749 GGGGAGCCACTCACTGCACAGGG + Intronic
1176141897 20:63548535-63548557 GAGGAGAGAGAGACTGCAGATGG - Intronic
1176795615 21:13369119-13369141 GCAGAGAGACTGCCTGCATATGG + Intergenic
1177719297 21:24883751-24883773 GGAGAGAGAATGAGTGCAAGCGG - Intergenic
1178796523 21:35749918-35749940 GGTGAGGGAGTGACTGCCAAAGG - Intronic
1179058783 21:37960310-37960332 GAGTAGGGACTGACTGCAGAAGG + Intronic
1180989574 22:19926884-19926906 GGGAAGAGACTGACTGCCAATGG + Intronic
1184200477 22:42965276-42965298 GGTGGGGGACTGACTTCAAAGGG + Intronic
949109304 3:239389-239411 AGGGACAGACAGACTGAAAACGG - Intronic
949116660 3:334424-334446 GAACAGAGAGTGACTGCAAATGG - Intronic
950680423 3:14581388-14581410 CAGGAGAGACTGACTGCAGAGGG + Intergenic
952282895 3:31940411-31940433 GGTGGGTGACTGACTGGAAATGG + Intronic
952879587 3:37975121-37975143 GGGGAGAGAATGCATGCAGAGGG + Intronic
953112025 3:39952041-39952063 GGGAAGAGGCTGAATGCAAATGG - Intronic
953937516 3:47058766-47058788 TGGAAGGGACTGACTACAAAGGG + Intronic
954762308 3:52884553-52884575 GGAATGGGACTGACTGCAAAAGG - Intronic
954932172 3:54293794-54293816 GGGGAGTGATTGATTGCAAAGGG + Intronic
955121431 3:56063220-56063242 GGAGAGAGATTGACCACAAAGGG + Intronic
956087192 3:65624639-65624661 AGGCAAAAACTGACTGCAAAGGG + Intronic
958078063 3:88709814-88709836 GGGGAGAGATTAACTACAAAGGG + Intergenic
958136249 3:89497275-89497297 GTGGAGTGAGGGACTGCAAAAGG - Intergenic
958921340 3:100109466-100109488 GGGGAGGAACTGACTACAAAAGG - Intronic
959087906 3:101870604-101870626 AAGGAGAGATTGACTGCAAAGGG - Intergenic
959090768 3:101900278-101900300 GGGGAGAGGCTGAGGGCATACGG + Intergenic
961815087 3:129545575-129545597 GGGTGGAGAGTGACTGCTAATGG - Intronic
961831712 3:129626507-129626529 GGGGAGGGACTGACTGGGAAGGG + Intergenic
962454090 3:135549171-135549193 GGGGAGGGCTTGACTGCAAAAGG + Intergenic
962891538 3:139677249-139677271 GGGGGGAGACCGACAGCAAATGG - Intronic
963572693 3:147017027-147017049 GGAGAGAGAGAGAGTGCAAAAGG - Intergenic
964215162 3:154272118-154272140 GGTGAGGGATTGACTACAAAGGG + Intergenic
965329402 3:167351868-167351890 TGGGAGAGACTGACAGGAATGGG - Intronic
966222176 3:177561606-177561628 GTGGAGAGACTGATTCTAAAAGG - Intergenic
967138247 3:186530617-186530639 GGACAGAGATTAACTGCAAAGGG + Intergenic
967970398 3:194994933-194994955 GGGCAGGGGCTGCCTGCAAAAGG - Intergenic
968167629 3:196480013-196480035 AGGGGGACACTGACTGGAAAGGG + Intronic
968530313 4:1087541-1087563 GGGGAGAGGCTGACAGGACAGGG + Intronic
969185965 4:5474542-5474564 GGGAAGGGACTAAGTGCAAAGGG - Intronic
970017089 4:11524099-11524121 GTGGTGGGATTGACTGCAAAGGG - Intergenic
970161469 4:13193545-13193567 AGAGAGAGATTGACTGCAACAGG + Intergenic
970246963 4:14073639-14073661 GGAGAGAGAGTGAGTGCAAAGGG - Intergenic
970372475 4:15422028-15422050 TGGAGGAGACTGACTACAAAGGG + Intronic
971314483 4:25556060-25556082 GGGAAGAGATTGACTACAAAGGG - Intergenic
972598423 4:40550287-40550309 GAGGGGAGACTGACTGCAGAGGG + Intronic
972879006 4:43400331-43400353 GGCAAGAGCTTGACTGCAAATGG + Intergenic
973146050 4:46827936-46827958 AGGCAGAAATTGACTGCAAAAGG + Intronic
974049167 4:56924409-56924431 GGGGAAAGACTGGGTGGAAAGGG - Intronic
974466176 4:62259246-62259268 GAGGAGAGAGTGACTGGAGAAGG - Intergenic
975172867 4:71252749-71252771 GAACAGAGAGTGACTGCAAATGG + Intronic
975514277 4:75228267-75228289 GGGGAGAGAATGAGGGCACAGGG - Intergenic
975825832 4:78318800-78318822 GAGGAGTGACAGGCTGCAAATGG - Exonic
976079397 4:81338040-81338062 GGAGAGAGAATGAGTGCAAGCGG - Intergenic
976290083 4:83408968-83408990 GGGGAGAGAATGGGTGAAAAGGG + Intronic
976493903 4:85703919-85703941 GGGGAGCGGATGACTGCAAAGGG - Intronic
978232131 4:106412435-106412457 GAGGGGAGAGGGACTGCAAATGG - Intergenic
978592903 4:110345388-110345410 GGAGTGAAACTGATTGCAAATGG - Intergenic
979132365 4:117063329-117063351 GGGGAGAGACAGAGTGAGAAGGG - Intergenic
979559827 4:122089275-122089297 GGGGAGAGAGTGAGAGGAAAAGG - Intergenic
980143670 4:128953409-128953431 TGTGAGAGAATGACTGAAAAAGG + Intronic
980862383 4:138515170-138515192 GGAGAGTGAATGACTGCAAATGG - Intergenic
981316822 4:143348794-143348816 GGGGAGAGACTGAGTGGAGAAGG - Intronic
981694418 4:147545688-147545710 GAGGAGAGACTGGCTCCAACTGG - Intergenic
982223511 4:153144756-153144778 GGGAAGGGACTGGCTGTAAAGGG - Intergenic
982901444 4:161009149-161009171 TAGGAGAGACTGACTGCAAAAGG - Intergenic
984289269 4:177772956-177772978 TGGAAGAGGCTGACTGCAAATGG - Intronic
985070920 4:186166040-186166062 GAGGCGAGTCTGACTGCAGAAGG - Intronic
986167789 5:5290865-5290887 GGGGAGAGAATGAAAGCAAATGG - Intronic
987091542 5:14512169-14512191 AGGGAGAGATTGACTGGGAAGGG - Intronic
988861736 5:35288108-35288130 GGGAAGAGATTGACTGCAAAGGG + Intergenic
989065394 5:37455859-37455881 AAGGAGGGACTGACTGCAAAGGG - Intronic
989968486 5:50493055-50493077 AGGGAGAGAGTGACAACAAATGG + Intergenic
991957180 5:72006731-72006753 TGGGAAACACTGACTCCAAAGGG - Intergenic
991994325 5:72372138-72372160 GGGGAGAGTGTGACTACAGAAGG + Intergenic
991996572 5:72393239-72393261 GAGTAGAGATTCACTGCAAATGG - Intergenic
992071060 5:73149750-73149772 GAGGAGAGATAGGCTGCAAAGGG + Intergenic
992153076 5:73925610-73925632 GGGGAGGGGTTGACTGGAAAGGG - Intronic
992526391 5:77615051-77615073 GAGCAGGGATTGACTGCAAATGG + Intronic
993457023 5:88139203-88139225 TGGGAGGGATTGACTGCAAAGGG + Intergenic
994351550 5:98752255-98752277 TGGGAGACACTGAGTGCATAGGG + Intergenic
994419208 5:99511674-99511696 AAGGAGGGACTGACTGCAAAGGG - Intergenic
995165512 5:109035286-109035308 TGAGAAAGACTGACTGCAAAAGG - Intronic
995245530 5:109931144-109931166 CGGGAGACAGTGACTGCACAAGG + Intergenic
995664832 5:114530184-114530206 GGAGAGGAACTGGCTGCAAAGGG + Intergenic
995857231 5:116605963-116605985 TGGGAGAGATTTACTGGAAAGGG + Intergenic
995930046 5:117430319-117430341 GAGTAGGGACTGACTGCAAACGG + Intergenic
995974282 5:118012477-118012499 GGGGAAGGACTGACTGAAAACGG - Intergenic
996758816 5:126966192-126966214 GGTGGGGGACTGACTGCAAAGGG + Intronic
997290839 5:132733126-132733148 TGGGAGTGACTGACTGCTAATGG + Intronic
998321121 5:141232941-141232963 GGTGAGAGATTGATTACAAATGG - Intergenic
998904136 5:146885982-146886004 GGGGTGGGAATGACTGCTAAAGG + Intronic
999087879 5:148909510-148909532 GGAGTGGGACTGACTGCAGAGGG + Intergenic
999212320 5:149900709-149900731 GGTGAGAGAGTGTCTCCAAAAGG + Intronic
999338912 5:150750076-150750098 GGGAAGAAACTGACTGCAATGGG + Intronic
999499694 5:152134402-152134424 GGGGAAAGAGAGCCTGCAAATGG + Intergenic
999550604 5:152683083-152683105 GAATAGAGACTGACTGCTAATGG + Intergenic
999880593 5:155859526-155859548 AGGAAAAGATTGACTGCAAAGGG - Intergenic
1000483868 5:161814169-161814191 GGTGAAAGACTGACTGAAACTGG - Intergenic
1000846123 5:166282475-166282497 GGAGAAACAATGACTGCAAAAGG - Intergenic
1000929181 5:167231014-167231036 GGAGAGAGAATGAGTGCAAGTGG - Intergenic
1001214575 5:169843690-169843712 GGAAAGAAAGTGACTGCAAATGG - Intronic
1001347539 5:170919806-170919828 GGAGAGGGGCTGACTGAAAAAGG - Intronic
1002724500 5:181285853-181285875 GCAGAGAGACTGCCTGCATATGG - Intergenic
1002885017 6:1285845-1285867 GGGGAGCCTCTGACTGTAAAAGG - Intergenic
1003216702 6:4119833-4119855 AGGGAGGGACTGACTACAGAAGG - Intronic
1003473927 6:6463766-6463788 GGAGAGAGAATGACTGCAGGAGG - Intergenic
1003519684 6:6847746-6847768 GGAGAGTCACTGACTGCAGATGG - Intergenic
1003772805 6:9325861-9325883 GTGCAGAGATTGACCGCAAAAGG - Intergenic
1004332368 6:14733554-14733576 GAGGAGAGACTGCCTTCTAATGG + Intergenic
1004493088 6:16136210-16136232 GGGGAGGGGTTGACTGCAGAAGG - Intronic
1004953536 6:20701961-20701983 TGGGAGAGGCTGACAGCAATGGG + Intronic
1005000120 6:21231876-21231898 GGGGAGAGTCTGCCAGCTAAAGG + Exonic
1006408463 6:33858352-33858374 TGGGGGATAGTGACTGCAAAGGG + Intergenic
1006590510 6:35151955-35151977 AGACAGATACTGACTGCAAACGG - Intergenic
1006664963 6:35687340-35687362 GGGGAGAGACAAACAGAAAATGG + Intronic
1006669228 6:35719315-35719337 CGGTAGAGACTGACTGGAAGGGG + Intronic
1012150590 6:95746018-95746040 GGGGAGAGATTTAATGCACATGG - Intergenic
1012282390 6:97344252-97344274 GAGTAGGGATTGACTGCAAATGG + Intergenic
1012448340 6:99329068-99329090 GGGAGGAGACCCACTGCAAAAGG + Intronic
1012956493 6:105576430-105576452 AGGGAGAGAAGGAATGCAAATGG - Intergenic
1013997780 6:116328219-116328241 GGGGAGAGTCTGATTGTGAAAGG + Intronic
1014160497 6:118162376-118162398 GGGAGGATACTGACTGCAAAGGG + Intronic
1014490610 6:122057223-122057245 GGGGAGAGAATAAATACAAAGGG + Intergenic
1015158627 6:130126259-130126281 GGAGAGAGAGTGGCTGCAGAAGG - Intronic
1015380875 6:132566723-132566745 GGGGTAAGATTGGCTGCAAAGGG + Intergenic
1015569413 6:134605452-134605474 GGGGAGAAGTTGACTACAAAAGG + Intergenic
1015908085 6:138138110-138138132 GCAGAGGGACTGACTCCAAAAGG + Intergenic
1019424677 7:968702-968724 GGTGCGAGCCTAACTGCAAATGG + Exonic
1019897837 7:3997074-3997096 GGGGTTAGACTGACTAGAAAGGG - Intronic
1019917958 7:4145352-4145374 GGGGAGAGCCAGACTGCAGGAGG + Intronic
1022374613 7:29801784-29801806 GCATAGGGACTGACTGCAAAGGG + Intergenic
1022474676 7:30702057-30702079 TGGGAGACCCTTACTGCAAATGG + Intronic
1023340407 7:39213546-39213568 TGGAGGGGACTGACTGCAAAGGG - Intronic
1023832868 7:44050278-44050300 GGGGTGAGTATGACTCCAAATGG + Exonic
1023993453 7:45144642-45144664 GGGAAGAGAGAGACTGCCAAGGG + Intergenic
1025922704 7:65928396-65928418 GGGGAAAGCCTGACTACAAAAGG - Intronic
1026227938 7:68459156-68459178 GGAGAGAGACAGAGAGCAAAGGG + Intergenic
1026418670 7:70210070-70210092 GGTGAGAGACAGAATGCACACGG - Intronic
1026520666 7:71115226-71115248 TGGGAAAGATTGACTGCAGAGGG + Intergenic
1027572731 7:79891174-79891196 CGGAAGAGATTGACTGCAAAGGG + Intergenic
1028353552 7:89879254-89879276 GGGGAGATAATCACTTCAAAGGG + Intergenic
1028358702 7:89940829-89940851 GAAGAGAGATTGACTACAAAGGG + Intergenic
1028620319 7:92819388-92819410 GGGAGGAGATTCACTGCAAAGGG + Intronic
1029540512 7:101179748-101179770 GGGGAGAGGGAGATTGCAAAGGG + Intronic
1029779768 7:102719690-102719712 GGTGAGGGACTGATTGTAAAGGG - Intergenic
1033274598 7:139961921-139961943 GCGGAGAGACTTCCTCCAAATGG + Exonic
1034321658 7:150189541-150189563 TGGGAGGGGCTGATTGCAAAAGG - Intergenic
1034771090 7:153777739-153777761 TGGGAGGGGCTGATTGCAAAAGG + Intergenic
1035111240 7:156483768-156483790 GGGGAGAGACACACTGAGAAGGG + Intergenic
1036106345 8:5845207-5845229 GGAGAGAGAATGACTGCCCAGGG + Intergenic
1036124263 8:6048659-6048681 GTGGAGAGGCTGAATGCAGAGGG + Intergenic
1037311797 8:17563870-17563892 TGGGAGATACTGACTTAAAAAGG - Intronic
1037767143 8:21779227-21779249 CGGGAGTGCCTGACTGCAGATGG - Intronic
1038033128 8:23662136-23662158 GGGGAGAGGATGACAGCAGAGGG + Intergenic
1038652336 8:29416788-29416810 GGGGAGGGATTAACTGCAAAGGG + Intergenic
1039427560 8:37498632-37498654 GGGGAGAGAATGAGTGCCAGCGG - Intergenic
1039924483 8:41916561-41916583 GGGGAGAGATTAACTGCAAAGGG - Intergenic
1041497997 8:58508151-58508173 GGGTAGAGAGTGGCTGCAAATGG - Intergenic
1041553619 8:59127791-59127813 GGGGGAGGATTGACTGCAAAGGG - Intergenic
1041625962 8:60027273-60027295 GTGGAGAGACTGACTGTAGAAGG - Intergenic
1041835214 8:62204580-62204602 GGAGAGAGAGAGAGTGCAAAGGG - Intergenic
1042799990 8:72708082-72708104 GGGGAGAGACTGGCTGCAGTGGG - Intronic
1042886392 8:73556816-73556838 TGGGAGTGACAGATTGCAAAAGG + Intronic
1043969004 8:86509462-86509484 GTGGAAACACAGACTGCAAAGGG + Intronic
1044888776 8:96809588-96809610 GGGGAGAGATTGGCTGTAAGAGG + Intronic
1045233218 8:100326098-100326120 GGGTGGAGACAGACTGAAAACGG - Intronic
1045543531 8:103108260-103108282 TGAGAGAGACTGACTGCAAATGG + Intergenic
1046275414 8:111953139-111953161 GGGGAGGGGTTGACTGCAATAGG - Intergenic
1047046755 8:121062307-121062329 GGTAAGAGATTGACTTCAAAGGG + Intergenic
1047090526 8:121569848-121569870 AGAGAGAAACTGACTGCAAAGGG - Intergenic
1047726624 8:127689540-127689562 GGGAGGTGACTGACTGCATAAGG + Intergenic
1047769634 8:128020486-128020508 AGGGAGAGACTGGTTGCTAACGG + Intergenic
1050109987 9:2204966-2204988 GGTAAGAGACTGACTGCAAAGGG - Intergenic
1050306851 9:4313506-4313528 GGGGAGAGACTGGAGGCCAATGG - Intronic
1050582292 9:7072618-7072640 GTGGAGTCACTGACTACAAAGGG + Intronic
1051074461 9:13214423-13214445 GGGGAGAAGGTGACTGCTAAGGG + Intronic
1051652288 9:19340430-19340452 GGGGTGCAACTGAATGCAAATGG - Intronic
1055236608 9:74130018-74130040 GGGGAGGGTGTGACTGGAAAGGG + Intergenic
1056182606 9:84100487-84100509 GGGGAGAGAGAGACCGCAAAAGG - Intergenic
1056878112 9:90357645-90357667 AGAGAGAGGTTGACTGCAAAGGG + Intergenic
1057083867 9:92191151-92191173 GGGGAGAGGTTGGCTCCAAAGGG - Intergenic
1057135650 9:92685939-92685961 GGGTAGGGACTGACCTCAAAGGG + Intergenic
1057566296 9:96168768-96168790 GGGGATAGACGGGCTGCATAGGG + Intergenic
1057642912 9:96844591-96844613 GGGAGGGGACTCACTGCAAAGGG + Intronic
1057773903 9:97989953-97989975 GGGAACAGACTCACTCCAAAGGG - Intronic
1057847586 9:98537361-98537383 GGGGTGGAACTGACTACAAATGG + Intronic
1057900891 9:98947372-98947394 AAGCAGAGATTGACTGCAAAGGG + Intronic
1058023299 9:100114244-100114266 GGGGAGAAACTGGCTATAAAAGG - Intronic
1058066775 9:100557270-100557292 GGGGAGTGACTGACTAATAATGG - Intronic
1058288314 9:103207353-103207375 GGGAAAAGCTTGACTGCAAAAGG - Intergenic
1058474688 9:105320001-105320023 GGGCAAGGACTGACTACAAAGGG - Intronic
1058738249 9:107916849-107916871 AGGTAGAAACCGACTGCAAAGGG + Intergenic
1058786118 9:108389799-108389821 GAGGAGAAGCTGACTGCAAAAGG + Intergenic
1058839082 9:108888247-108888269 GGGAGAAGGCTGACTGCAAAAGG + Intronic
1059129628 9:111732784-111732806 GGAAGGAGAATGACTGCAAAGGG + Intronic
1059944269 9:119392145-119392167 GAGGAGAGATTTACTACAAAGGG + Intergenic
1060029296 9:120200563-120200585 AGGGAGAGGTTGACTACAAAGGG - Intergenic
1060683757 9:125589221-125589243 TGTGAGAGAATAACTGCAAAAGG - Intronic
1061617552 9:131790256-131790278 AGGGAAATACTGACTGCCAAAGG - Intergenic
1061770148 9:132913372-132913394 GGGAAGAGACTCACCACAAAGGG - Intronic
1062152274 9:135027476-135027498 GAAGAGAGATTGACTACAAAAGG + Intergenic
1187292977 X:17973108-17973130 GGGGCTATACTTACTGCAAAAGG - Intergenic
1187428266 X:19198181-19198203 GGAGAGGAACTGACTGGAAAGGG - Intergenic
1188031529 X:25269196-25269218 GAGGAGAAGCTGACTACAAATGG - Intergenic
1188299600 X:28491574-28491596 GTGGGGAGAGTGACTGCTAATGG - Intergenic
1188603662 X:32001110-32001132 GGCAGGAGACTGACTGCAACGGG + Intronic
1189506898 X:41620633-41620655 GGGAAGAGATTGGCTGCAAAGGG - Intronic
1190904294 X:54710784-54710806 GGGGAGAGAATGAGAGAAAAAGG - Intergenic
1192836021 X:74800562-74800584 GGGGAGGGATTGACTACAAAGGG - Intronic
1193667714 X:84343118-84343140 GAAGAGGGAGTGACTGCAAATGG + Intronic
1195202120 X:102562153-102562175 GGGAACAGGCTGACTGCAAGAGG + Intergenic
1195426234 X:104734635-104734657 AGGGAGAGTGTGACTACAAAGGG + Intronic
1195792929 X:108608788-108608810 GGATAGGGACTGACTGGAAAGGG - Intronic
1196276559 X:113772821-113772843 GGGGAGAGCCAGAGTGCAAAAGG + Intergenic
1196700847 X:118666404-118666426 GTGGGGAGCCTGACTGGAAATGG - Intronic
1198562693 X:137867931-137867953 GGAGAGAGACTGACAGGGAAAGG + Intergenic
1199213536 X:145242043-145242065 GGATAGAGAGTGACTGCTAATGG + Intergenic
1200828100 Y:7663699-7663721 GGGGAGAGAGTGAGAGAAAATGG + Intergenic
1201632737 Y:16087467-16087489 GGTGACAGACTGTCTACAAATGG + Intergenic