ID: 1174242366

View in Genome Browser
Species Human (GRCh38)
Location 20:49147502-49147524
Sequence GTGGACAGACGGGCTGCTTA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 90
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 85}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174242363_1174242366 -7 Left 1174242363 20:49147486-49147508 CCAATGCTGGCAGGCTGTGGACA 0: 1
1: 0
2: 1
3: 27
4: 201
Right 1174242366 20:49147502-49147524 GTGGACAGACGGGCTGCTTATGG 0: 1
1: 0
2: 0
3: 4
4: 85

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174242366 Original CRISPR GTGGACAGACGGGCTGCTTA TGG Intronic
900237192 1:1598474-1598496 GTGGAAGGTCGGGCTGCTCAAGG + Exonic
901183328 1:7356618-7356640 GGGGACAGACAGCCTGCTGATGG - Intronic
901679714 1:10906079-10906101 CTGGCCAGAGGGGCTGCTTCTGG - Intergenic
902632434 1:17713134-17713156 GTGGAAAGACTGTCAGCTTAGGG - Intergenic
905798825 1:40830678-40830700 GGGCACAGACAGGCTGCTGAGGG - Intronic
915291105 1:154883944-154883966 GTGGGCACACGGGGGGCTTAAGG + Intergenic
915497417 1:156291836-156291858 GTGGACAGCCGTGTTTCTTAAGG + Exonic
915895807 1:159809816-159809838 GTGGACAGATGGACTAATTAGGG - Intronic
918209637 1:182339522-182339544 GAGGACAGACAGGCTGATTTTGG - Intergenic
920244329 1:204576469-204576491 GTGGACAGACAGGTTGGTTTGGG + Intergenic
920602093 1:207337238-207337260 GTGGACTTACGTGCTGCTGAAGG - Intronic
921260342 1:213380817-213380839 GTGGACAGACGCTCTGCCCAGGG - Intergenic
922112041 1:222569082-222569104 GGGGACAGACAGGCTGCAAAGGG + Intronic
1064280576 10:13947509-13947531 GTGGTCATACGGGATGCCTAGGG + Intronic
1067738671 10:48878866-48878888 GTTGACTGACTGGCTGCTTCAGG - Intronic
1069998558 10:72358899-72358921 GTGGAGAAGCGGGCTGCTTGTGG + Intergenic
1073355462 10:102850376-102850398 GTGGACAGACTGGCCGCTCAGGG - Intergenic
1075427324 10:122352024-122352046 ATGGACAGACTGCCTGTTTAAGG + Intergenic
1083764597 11:64835889-64835911 GTGGGCAGAGGGGCTGCCGAGGG - Intronic
1085388083 11:76168506-76168528 GTGGACATAAGGGCTGCGTGTGG - Intergenic
1096652023 12:53066535-53066557 GTGGCCAGCCAGGCTGCTTGGGG - Intronic
1101660906 12:106764836-106764858 GAGGATGGACGGGCCGCTTAGGG + Intronic
1104697992 12:130879198-130879220 GTGGACAGTCGGGAAGCTTGCGG + Intergenic
1105244000 13:18631526-18631548 ATGGACAGACTGCCTCCTTAAGG + Intergenic
1108709476 13:53018316-53018338 GGGGTCAGAAGGGCTGCTTCAGG - Intergenic
1122073439 14:99220323-99220345 ATGGACAGTTGGGCTGCTTTTGG - Intronic
1122328386 14:100896597-100896619 GGGGACAGAGGGGCTTCTGACGG + Intergenic
1123002160 14:105301338-105301360 GTGGAGAGACGGCCTGCGAAGGG + Exonic
1126878916 15:53073398-53073420 GAGGAAAGACAGGCTCCTTAGGG + Intergenic
1128498502 15:68211383-68211405 GTGGTCAGAGGGGATGCTTGGGG - Intronic
1129661997 15:77558091-77558113 GTGGACAGAGGGGCTGTGAATGG + Intergenic
1130896570 15:88174695-88174717 GTTGGCAGACAGCCTGCTTATGG - Intronic
1132164082 15:99566860-99566882 GGGGACAGAGGGGCTGCACAGGG + Intronic
1140278115 16:73529229-73529251 GTGGACCGAGTGGCTGCTGAGGG + Intergenic
1154444942 18:14428375-14428397 ATGGACAGACTGCCTCCTTAAGG - Intergenic
1154504930 18:15027480-15027502 GTTGATAGATGGGCAGCTTAAGG - Intergenic
1156848109 18:41693197-41693219 TTAGCCAGACGGGCTGCCTAAGG + Intergenic
1160796295 19:947243-947265 GCAGATAGAGGGGCTGCTTAAGG + Intronic
1161576596 19:5057983-5058005 AGGGACTGATGGGCTGCTTAGGG + Intronic
1165061405 19:33206924-33206946 GGGGGCAGACAGGCTGCTCAGGG - Intronic
1165277881 19:34770700-34770722 CAGGACAGACGTGGTGCTTAAGG - Intronic
1165594743 19:37003229-37003251 GTGGAAAAATGGGCTGCATATGG - Intergenic
928825177 2:35412232-35412254 GTCAACAGAGAGGCTGCTTATGG - Intergenic
929453181 2:42049531-42049553 GTGGACAGACTGGCGGCCTGAGG + Intronic
932494654 2:72140355-72140377 GTGGGCACAGGGGCTGCTGAGGG - Intronic
936944131 2:117915279-117915301 TGGGACAGACGGGCTGCTGCAGG - Intergenic
938504124 2:131857682-131857704 GTTGATAGATGGGCAGCTTAAGG - Intergenic
948249327 2:236513062-236513084 GTAGACAGATGAGCTGCTTTGGG - Intergenic
1174242366 20:49147502-49147524 GTGGACAGACGGGCTGCTTATGG + Intronic
1174365350 20:50053283-50053305 CTGGAGCGACGGGCTGTTTATGG - Intergenic
1174556468 20:51398993-51399015 GTGGACAAAAGGGCTGCTGTGGG + Intronic
1175458652 20:59134257-59134279 GTGGATAGAGGGACTGCTTTGGG - Intergenic
1176451043 21:6861497-6861519 ATGGACAGACTGCCTCCTTAAGG + Intergenic
1176792927 21:13341654-13341676 GTTGATAGATGGGCAGCTTAAGG + Intergenic
1176829212 21:13726548-13726570 ATGGACAGACTGCCTCCTTAAGG + Intergenic
1177992314 21:28052484-28052506 GTTGATAGATGGGCAGCTTAAGG + Intergenic
1180143853 21:45909046-45909068 GTGGACAGACAGGCTGATACAGG - Intronic
1181002701 22:19995307-19995329 GTGGGCAGATGGGATGCTGAAGG + Intronic
949897200 3:8776765-8776787 GAGGAGAGATGGGCTGCCTAAGG - Intronic
960620026 3:119628533-119628555 GTGGGCAGAGGGGCTGGTGAAGG + Intronic
962181730 3:133213190-133213212 GTGTACAGACATGCTGCTTTTGG - Intronic
968722823 4:2220302-2220324 GTGGCCAGTGGGGCTGCTCATGG - Intronic
969305194 4:6322305-6322327 GTGGACAGAGGGGATCCTAAGGG + Exonic
992203039 5:74402671-74402693 GTGGCCAGACTGGCTGATGAAGG - Intergenic
992485392 5:77189717-77189739 GTGGAGAGCCAGGCTGCTCAGGG + Intergenic
993502467 5:88678734-88678756 GTGGAGAGAGGGTCTGCTGAGGG + Intergenic
993616726 5:90122241-90122263 GAGGAAAGACTGGCTGCTTTGGG + Intergenic
995180495 5:109226266-109226288 GTGGGCAGAGGGGATGCTCAAGG + Intergenic
1000505349 5:162109854-162109876 GTGGACAAATGGGTTTCTTACGG + Intronic
1001506245 5:172283308-172283330 GTGGCCAGAAGGGCAGCTTCGGG + Intronic
1002488910 5:179559913-179559935 GAGGCCAGGCGGTCTGCTTAGGG - Intronic
1007227652 6:40326158-40326180 GTGGACAGAAGGGATCCTCAAGG + Intergenic
1019446117 7:1072187-1072209 GTGGGCAGCCAGGATGCTTACGG - Intronic
1019513520 7:1429909-1429931 GGGGACAGAGGGGCTGCTCCTGG - Intronic
1020915889 7:14192081-14192103 GTGGACAGGAAGGCTGCTGATGG + Intronic
1029863771 7:103603434-103603456 GTGGACGGAAGGGCAGCTTCTGG + Exonic
1032265507 7:130367569-130367591 TTGGTGAGACTGGCTGCTTAGGG + Exonic
1035315030 7:157992301-157992323 CTGGAAAGAGGGGCTGCTCATGG + Intronic
1036401335 8:8411232-8411254 GTGGACAGATGAGTTGTTTATGG + Intergenic
1036687503 8:10921675-10921697 GTAGACAGATGGGCTCCTGATGG - Intronic
1038447305 8:27612908-27612930 GTGGACAAAGGGGCTGCTCAGGG + Intronic
1043039094 8:75237934-75237956 GTGGACAGGTGAGCTGCTTATGG + Intergenic
1049731081 8:144178889-144178911 GTCGACAGGAGAGCTGCTTAGGG + Intronic
1049743632 8:144253318-144253340 GTGGACGGAGCGGCTGCTTCCGG - Intronic
1057566296 9:96168768-96168790 GGGGATAGACGGGCTGCATAGGG + Intergenic
1061406829 9:130396933-130396955 ATGGAGAGAAGGGCTGCTTTGGG - Intronic
1062186345 9:135220585-135220607 GTGGACAGCAGGGCTGCTGGGGG + Intergenic
1203518138 Un_GL000213v1:23020-23042 ATGGACAGACTGCCTCCTTAAGG - Intergenic
1191768836 X:64733083-64733105 GTGGCCAGACTGCCTTCTTAGGG - Intergenic
1197708341 X:129649601-129649623 GTGCACAGACATGCTGCTGAAGG - Intronic