ID: 1174245032

View in Genome Browser
Species Human (GRCh38)
Location 20:49172822-49172844
Sequence CTCAGTGATTGCTACAAGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 201
Summary {0: 1, 1: 0, 2: 2, 3: 34, 4: 164}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174245032_1174245033 -8 Left 1174245032 20:49172822-49172844 CCTCACTTGTAGCAATCACTGAG 0: 1
1: 0
2: 2
3: 34
4: 164
Right 1174245033 20:49172837-49172859 TCACTGAGTCAAAACACTAAAGG 0: 1
1: 0
2: 0
3: 13
4: 155
1174245032_1174245034 2 Left 1174245032 20:49172822-49172844 CCTCACTTGTAGCAATCACTGAG 0: 1
1: 0
2: 2
3: 34
4: 164
Right 1174245034 20:49172847-49172869 AAAACACTAAAGGAATCCTGAGG 0: 1
1: 0
2: 0
3: 19
4: 313

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174245032 Original CRISPR CTCAGTGATTGCTACAAGTG AGG (reversed) Intronic
904553303 1:31339709-31339731 CCCAGTGATTTCTGCAGGTGGGG + Intronic
904942068 1:34170862-34170884 CTCAGTGATGGCTTGATGTGGGG - Intronic
905215666 1:36405718-36405740 CTGAGTGATTGTGACAGGTGTGG - Intergenic
908188207 1:61672976-61672998 ATCAGTGATTGCCAGGAGTGGGG + Intergenic
908964417 1:69740689-69740711 CTCAGCGATTGGCACAGGTGTGG + Intronic
909388276 1:75086159-75086181 ATTAGTGATTGCTACAAGCCAGG + Intergenic
911280602 1:95922697-95922719 CTCAATAATTGCTACAAATTTGG - Intergenic
912968009 1:114253255-114253277 CTGAGTGATGGCTGCATGTGGGG + Intergenic
916147423 1:161752052-161752074 CTCAGGGATTGCTGGAAGTAAGG - Intronic
918493113 1:185104268-185104290 CTCAGGGTCTGCTACAGGTGAGG - Intergenic
919085575 1:192917093-192917115 CTCAGTGATTGGTATAGGTGTGG + Intergenic
919319587 1:196018585-196018607 CTCAGTGATTGCTAACATTATGG + Intergenic
919336467 1:196243084-196243106 ATCAGTGATTGCTAGAAGTTGGG - Intronic
919795760 1:201320517-201320539 CTCAGTGGTGGCTACAGGAGTGG + Intronic
920057712 1:203205033-203205055 CTCAGTGGTTGCTGCAGATGTGG + Intergenic
920356972 1:205380924-205380946 TTGAGTGCTTGCTACAAGTCAGG + Intergenic
923650689 1:235870311-235870333 CTCAGGGATTGACACAGGTGTGG - Intronic
924146130 1:241076452-241076474 TTCAGAGATTGCTCCGAGTGAGG - Intronic
924469234 1:244325272-244325294 CTCAGCAATTGGCACAAGTGTGG + Intergenic
1063718408 10:8553502-8553524 CACAGTGATTCCTCCAAGAGTGG + Intergenic
1064885019 10:20102143-20102165 CTCAGTGACTGCTACCATTGTGG + Intronic
1066117234 10:32251636-32251658 CTCAGAGTTTGCTAGAAATGCGG + Intergenic
1066668938 10:37816759-37816781 CTCAGAGATTTCACCAAGTGGGG - Intronic
1067422214 10:46161960-46161982 CTCAGTGATTGGTACAGATGTGG - Intergenic
1067507520 10:46868057-46868079 CTCAGTGATTGGTACAGATGTGG - Intergenic
1068348153 10:55811299-55811321 CTCAGTAATTGGCACAGGTGCGG + Intergenic
1069777831 10:70937141-70937163 CTCAGGGAATGCTAGAAATGTGG + Intergenic
1070859645 10:79640784-79640806 CTCAGTGATTGGTACAGGTGTGG - Intergenic
1071053145 10:81475213-81475235 ATCAGTGATTGCTAAAGGTTGGG + Intergenic
1075217623 10:120552046-120552068 CTCAGTTCCTGCTACAAGTCTGG - Intronic
1075346419 10:121685390-121685412 CTCAGTGAATGCTCCTATTGTGG + Intergenic
1075979582 10:126724966-126724988 CACAGAGTTTGCTACTAGTGTGG - Intergenic
1081530579 11:43956234-43956256 CTCAGTGATTTGCACAGGTGTGG + Intergenic
1081703494 11:45166419-45166441 CACAGTGATTGGTGCAAGAGAGG - Intronic
1082208305 11:49466195-49466217 AGCAGTGATTCCTAAAAGTGTGG - Intergenic
1083790188 11:64979776-64979798 CTCAATGATAGCAACCAGTGTGG - Intergenic
1083850013 11:65359809-65359831 CTCAGTCATTGCTCCCAGTAAGG - Intergenic
1086641225 11:89158463-89158485 AGCAGTGATTCCTAAAAGTGTGG + Intergenic
1088220779 11:107568153-107568175 CTCAGCGATTGGCACAGGTGTGG + Intergenic
1089680365 11:120115876-120115898 CACAGTGCTTGGCACAAGTGGGG - Intronic
1092613422 12:10194801-10194823 AACAGTGATTTCTAAAAGTGAGG + Intergenic
1098315077 12:69184450-69184472 CTCAGTGATTGACACAGGTGTGG - Intergenic
1100978318 12:100144416-100144438 CTCAGTGATTGGCACAGGTGTGG - Intergenic
1101355319 12:103971851-103971873 TTCAGTGATTTCTACATATGTGG - Intronic
1102774083 12:115503838-115503860 CTGAGTGATTTCTACATGTCTGG - Intergenic
1103139927 12:118539764-118539786 CTCAGTGATTGGTTCAAGGATGG - Intergenic
1105421293 13:20254708-20254730 CACAGTGATGGCCACAAGTCTGG + Intergenic
1110804584 13:79739282-79739304 CTCAATGATTGAAACAAGTAAGG + Intergenic
1111246073 13:85543157-85543179 CTCGGGGCTTGGTACAAGTGTGG - Intergenic
1113819692 13:113204330-113204352 CACAGTGCTTGCTCCAAGTCTGG - Intronic
1115144275 14:30208201-30208223 CTCCTTTATTGCTACAGGTGAGG - Intergenic
1115553145 14:34522678-34522700 CTCAGTGTTTACTAGAACTGAGG - Intronic
1117027408 14:51635807-51635829 CTGAGTGATTACTACATGTCAGG - Intronic
1118091151 14:62480879-62480901 CTCAGTGATGGCTAAAAGCTAGG - Intergenic
1118412164 14:65492360-65492382 CTTAGTGACTGGCACAAGTGTGG - Intronic
1124820657 15:33043317-33043339 TTCAGTGATTGGCACAGGTGTGG - Intronic
1125242788 15:37595593-37595615 CACTGTGACTGCTGCAAGTGTGG + Intergenic
1130560465 15:84954231-84954253 CACAGTGATTGCTTCAGGGGTGG - Intergenic
1133550906 16:6853778-6853800 CTCGGTGGTTTCTTCAAGTGAGG - Intronic
1133807839 16:9138818-9138840 CACAGTGCTTGATACAAGAGAGG + Intergenic
1133823083 16:9254079-9254101 CTCAGTGATTGCTCCAGGAGTGG - Intergenic
1136509941 16:30731210-30731232 GTCAGTGATTGCTCTAAGTATGG - Intronic
1139448195 16:67011560-67011582 CTCAGGGATTGCTCCAGGTCTGG - Intergenic
1140892290 16:79295504-79295526 CTCAGTGATTGGCACATGTGTGG + Intergenic
1147687314 17:42294280-42294302 CTCTGTGATGGCAACAAGTCAGG - Intronic
1149292250 17:55228587-55228609 CTGAGTGCTTGCTGCAAGTCAGG + Intergenic
1149557234 17:57582169-57582191 CACAGAGATTGCTAGAAGTCTGG - Intronic
1149852392 17:60046137-60046159 CTCAATGATTTCTGCAAATGTGG + Exonic
1150697626 17:67419431-67419453 CTCCGTCATTGCTTCAAGTGTGG + Intronic
1151140165 17:71984063-71984085 CTCAGTGATTCCTACCTGTGTGG + Intergenic
1154297002 18:13160426-13160448 CCCAGTGACTGCAACAACTGGGG - Intergenic
1158192671 18:54848116-54848138 CTCAGTGACTGGCACAGGTGTGG + Intronic
1158617699 18:59003193-59003215 GTCAGCAATTGCTACAAGTCAGG + Intergenic
1166067250 19:40367007-40367029 CCCAGCGCTTGCGACAAGTGAGG + Intronic
925996872 2:9300592-9300614 CCCAGTGATTGCTACACCGGTGG - Intronic
926385797 2:12334623-12334645 CTAAGTGATTGCCACAGATGAGG - Intergenic
928922244 2:36538076-36538098 CTCAGTGGTTGCGTTAAGTGTGG - Intronic
931032239 2:58190325-58190347 CTCTGTGATGGCTACACATGAGG - Intronic
931384169 2:61782283-61782305 CTCAGTGACTGGCACAGGTGCGG + Intergenic
933555553 2:83826251-83826273 CCCAGTGATTGCTAGGGGTGGGG - Intergenic
937940683 2:127283273-127283295 ATCAGTGGTTGCCAGAAGTGGGG - Intronic
944414077 2:199466414-199466436 CTCAGAGATAGCAACAACTGGGG - Intronic
945365618 2:208949574-208949596 CTCAGTGGTTGCTATAACTTTGG + Intergenic
946199684 2:218064530-218064552 CTCAGTACTTGCTACAGCTGGGG - Intronic
947622124 2:231597481-231597503 CTCAGTGATTGGTTCAGGGGAGG - Intergenic
947803861 2:232951038-232951060 CCCACTGATTGCTTCAAGTCAGG - Intronic
1169535306 20:6532589-6532611 CTCATTGTTTGCCACAAATGTGG - Intergenic
1170263948 20:14443931-14443953 CTAAGTGGTTGCTACTATTGTGG + Intronic
1170324898 20:15146931-15146953 CTCAATGATTGAAACAAGTAAGG - Intronic
1173490668 20:43477869-43477891 CTCAGTGATTGGTATGAGAGTGG + Intergenic
1174245032 20:49172822-49172844 CTCAGTGATTGCTACAAGTGAGG - Intronic
1175126693 20:56757604-56757626 CTCTGTGATTGCCACAAGCAAGG - Intergenic
1177996617 21:28107658-28107680 CTCAATGAGTGCTATAACTGTGG - Intergenic
1182724663 22:32434626-32434648 CTCAGTAATCCCTAAAAGTGAGG - Intronic
951658481 3:25035879-25035901 CTCAGTGACTGCCACAACTGAGG + Intergenic
951685485 3:25339312-25339334 CTCAGTGACTGGCACAAGTGAGG - Intronic
955151800 3:56375047-56375069 CTCAGTGCTTGCATCAAGGGAGG + Intronic
956661946 3:71607709-71607731 CTCATTAATTGCTAGAAGTGGGG + Intergenic
958045385 3:88278461-88278483 CACTGTGATTGGTATAAGTGAGG - Intergenic
958050755 3:88342328-88342350 CTCAGTGATTGGCACAGGTGTGG - Intergenic
959632324 3:108521243-108521265 CTAATTGATTGCTACAAAAGGGG + Intronic
960351324 3:116596806-116596828 CGCAGTGATTGATTCAGGTGTGG - Intronic
960984869 3:123270963-123270985 CTCAGGGCCTGCTACAAGTCAGG - Intronic
961227117 3:125260998-125261020 CTCAGTGATTGATACAGGGTGGG + Intronic
961344256 3:126252182-126252204 CTCAGTGATTGGCACAAAAGTGG - Intergenic
961885708 3:130094917-130094939 CCCATTGATTTCTCCAAGTGGGG + Intronic
961989692 3:131174952-131174974 CTCAGTGATTGCTTAAAGAGTGG - Intronic
963508734 3:146221481-146221503 CACAGTAATTGCTGCAAGGGAGG + Intronic
964692583 3:159468009-159468031 CTGATTGATTGTTCCAAGTGCGG + Intronic
966112068 3:176414972-176414994 CTCAGTGACTCCTACAATTGTGG + Intergenic
968550118 4:1217881-1217903 CTCAGAGATGACAACAAGTGTGG + Intronic
969819065 4:9707213-9707235 CCCATTGATTCCTCCAAGTGGGG - Intergenic
970274470 4:14383230-14383252 CTCAGTGATAGCTCCAAGGCAGG - Intergenic
970324706 4:14911378-14911400 CTCAGGGATTGGTTCAAGTATGG + Intergenic
971005143 4:22365059-22365081 TTCAGGGATTGCTGCATGTGAGG + Intronic
971031712 4:22644240-22644262 CTCGGTGATTGGTGCAAGTGTGG + Intergenic
971071724 4:23101823-23101845 CTCAGTGGTTGGCACAGGTGTGG - Intergenic
973133691 4:46679247-46679269 CTGAGTGCTTGCTACAAATCAGG - Intergenic
975423238 4:74194711-74194733 CTCAGTGATTGGCACAGGTGTGG - Intronic
976162102 4:82213370-82213392 CTCTTTGATTGCTCCAAGTGTGG - Intergenic
978339663 4:107708892-107708914 CTCAGTCATTGGCACAAGGGTGG - Intronic
979217720 4:118185780-118185802 CTCAGTGATTGACACAAGAATGG + Intronic
979679201 4:123441077-123441099 CACAGTGATTGGTCCAAGGGAGG + Intergenic
980009100 4:127576669-127576691 CTCAGTGATTGCTTGAATTTTGG - Intergenic
983807474 4:172012970-172012992 ATCAGTAATTGCTAGGAGTGAGG - Intronic
983976877 4:173945380-173945402 TTCAGTGTTTGCTCCAAATGAGG + Intergenic
986439456 5:7766910-7766932 CTCAGGGATTGATACCAGAGAGG - Intronic
986924197 5:12726686-12726708 CTAAGTGATAGCTACAAGTTGGG + Intergenic
987170152 5:15247056-15247078 ATCAGCAAATGCTACAAGTGAGG + Intergenic
988367018 5:30313333-30313355 CTCAGTGACTGGCACAGGTGTGG + Intergenic
988718815 5:33855291-33855313 CTGTGTGAATGCTACAAATGAGG - Intronic
991117124 5:62967287-62967309 CTCAGTGATTGGCACAAGAGTGG - Intergenic
992569273 5:78038124-78038146 CTCATTGGTTGCTGCATGTGGGG + Intronic
993542721 5:89172423-89172445 CTCAATGATGGCAACAACTGGGG - Intergenic
995326515 5:110894915-110894937 CTCGGTGACTGGCACAAGTGTGG - Intergenic
995857367 5:116607625-116607647 TACAGTGATTGCTTCAAGCGTGG - Intergenic
998781878 5:145666280-145666302 CACAGTGATTGTTTCAAGGGTGG - Intronic
999904826 5:156129034-156129056 CTCAGTGCTTGCTTCTGGTGAGG + Intronic
1003695087 6:8397417-8397439 CTCAGTGGTTGCTACAATAGTGG + Intergenic
1004063718 6:12222761-12222783 CTGATTGATTTATACAAGTGTGG + Intergenic
1007218337 6:40258960-40258982 CTCAGGGATGGCTGTAAGTGTGG - Intergenic
1007404432 6:41625852-41625874 CTCAGTGAGTGCCCCAAGAGAGG - Intergenic
1008747213 6:54686677-54686699 CTCACTCATTGCTGCAAGTATGG - Intergenic
1008756402 6:54799582-54799604 ATCAGTGTTTATTACAAGTGAGG - Intergenic
1010146113 6:72671420-72671442 CTCAGTAATTGCAACTACTGAGG + Intronic
1012347573 6:98209807-98209829 CTCATAGATTGCTACAGGAGTGG - Intergenic
1013083181 6:106830827-106830849 CCCAGTGACTGCAACAACTGTGG - Intergenic
1016275670 6:142349448-142349470 TCCAGTGATTGCTCAAAGTGGGG - Intronic
1016597377 6:145816528-145816550 CTCAATGATTGACAGAAGTGTGG - Intergenic
1016850584 6:148614708-148614730 CTCCATGATTGGCACAAGTGTGG - Intergenic
1018178710 6:161201669-161201691 CCCTGGAATTGCTACAAGTGGGG - Intronic
1018793524 6:167168813-167168835 CTCAGTCATCTCTACAAGTTGGG - Intronic
1018823191 6:167389565-167389587 CTCAGTCATCTCTACAAGTTGGG + Intergenic
1018918556 6:168154458-168154480 CTCTGTGATTGGTACAAGAGTGG + Intergenic
1021183509 7:17535872-17535894 CTCAATGATTGATACAATTTTGG + Intergenic
1023197858 7:37661867-37661889 CTCAGTGATTGGCACAGGTGTGG + Intergenic
1024139664 7:46449072-46449094 GACTGTGATTGCTGCAAGTGTGG - Intergenic
1030463477 7:109870536-109870558 CTCTGTGTTTGTTACGAGTGTGG + Intergenic
1030873432 7:114785203-114785225 CTAAGTGATTGCAACAATGGTGG + Intergenic
1031217839 7:118920508-118920530 CTCAGTGATTGGCACAAGATAGG - Intergenic
1032003725 7:128283638-128283660 CTGAGTGAGGGCTACATGTGTGG - Intergenic
1032931947 7:136682497-136682519 TTCAGTGGTTGCTAGAAGTTAGG + Intergenic
1036036323 8:5023343-5023365 CTCAGTGATTGGCACAGGTCTGG - Intergenic
1036868781 8:12421549-12421571 CCCATTGATTTCTCCAAGTGGGG + Intergenic
1037304526 8:17491655-17491677 CTCAGTGACTGGCACATGTGTGG - Intergenic
1041362595 8:57068605-57068627 CACAGTGGGTGCTACAGGTGGGG + Intergenic
1041620047 8:59956123-59956145 CTAAGTGATTGCAAAAGGTGTGG + Intergenic
1043282305 8:78483418-78483440 CTCAGTGATTGGCACAGATGTGG + Intergenic
1043640539 8:82444568-82444590 CTCAGTGATTGATACAAGCGTGG + Intergenic
1043826508 8:84936033-84936055 CTCAGTGATTGGCACAGGTGTGG - Intergenic
1043853719 8:85242219-85242241 TTCAGTGATTGGCACAAGAGTGG + Intronic
1044760223 8:95510103-95510125 CTCAGTGAACTCTACAAATGTGG - Intergenic
1045107370 8:98906001-98906023 CTCAGAGATTGGCACACGTGTGG + Intronic
1046249876 8:111615635-111615657 CTGTGTGATTGTTACAAGTATGG - Intergenic
1047168885 8:122470132-122470154 CTCAGTAATTGGCACAGGTGTGG + Intergenic
1050023834 9:1312435-1312457 CTAAGTGATTGTGACAAGAGTGG + Intergenic
1052157033 9:25204619-25204641 CTCAGTGATTGACACAGGTGTGG - Intergenic
1054861675 9:69960114-69960136 TCCAGTGATTGGTACAAGAGAGG + Intergenic
1056391241 9:86143529-86143551 CTCAGTGATTGGCACAGGTGTGG - Intergenic
1057780425 9:98045424-98045446 CTCAGTAATTGGCACAGGTGTGG - Intergenic
1058196642 9:101985022-101985044 CTCAGTGATTGGCACAGGTGTGG - Intergenic
1058828573 9:108795952-108795974 CTCATTAACTGCTACAAATGTGG + Intergenic
1059825269 9:118021134-118021156 CCCAGTCATTGATAGAAGTGGGG + Intergenic
1060174156 9:121485260-121485282 CTCAGTGCTGGCTACAAGGCAGG + Intergenic
1061560156 9:131396852-131396874 CCCAGTGTTGGCCACAAGTGAGG + Intronic
1187429119 X:19205534-19205556 CTCAGTGCTTTCTACAAGCCAGG + Intergenic
1187937229 X:24347642-24347664 CTCAGTGATTGGCACAGGTGTGG + Intergenic
1191931810 X:66381945-66381967 CTCAGTGATACAGACAAGTGGGG + Intergenic
1193560681 X:83012822-83012844 TTCACTAATTGCTACCAGTGTGG - Intergenic
1194051417 X:89073801-89073823 CTCAGTGATTGGCACAGGTGTGG + Intergenic
1194052099 X:89081487-89081509 CTCAGTGATTGGCACAGGTGTGG + Intergenic
1194195611 X:90887926-90887948 CTTAGTGATTGGCACAGGTGTGG - Intergenic
1195450977 X:105012457-105012479 CTCAATTATTGCTTAAAGTGAGG - Intronic
1196258306 X:113548659-113548681 CTCAGTTATTGCTGCTACTGTGG + Intergenic
1196424513 X:115556237-115556259 CTCAGTAATTTTTACAAGTGAGG - Intergenic
1198587467 X:138138729-138138751 CTCAGTGATTGGCACGACTGTGG + Intergenic
1199234699 X:145477560-145477582 CTCAGTGATTGGCACAAGAGTGG + Intergenic
1199966295 X:152823742-152823764 GTCAGAGATTGCTTCATGTGAGG - Intergenic
1200699004 Y:6386355-6386377 CTAAGTGATGGCCAAAAGTGTGG + Intergenic
1200943157 Y:8806030-8806052 CTAAGTGATGGCTCCAAGTATGG + Intergenic
1201035108 Y:9778344-9778366 CTAAGTGATGGCCAAAAGTGTGG - Intergenic