ID: 1174246877

View in Genome Browser
Species Human (GRCh38)
Location 20:49188229-49188251
Sequence CGGAGTGGCCGTGGAGGAGG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 534
Summary {0: 1, 1: 0, 2: 3, 3: 44, 4: 486}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174246877 Original CRISPR CGGAGTGGCCGTGGAGGAGG CGG Exonic
900179862 1:1306328-1306350 CGGAGGGGCCAGGGAGAAGGTGG + Intronic
900394415 1:2447290-2447312 CAGAGTGGTCCTGGAGGATGCGG - Intronic
900430831 1:2602498-2602520 GGGGGTGCCCGTGGTGGAGGTGG - Intronic
900573044 1:3368943-3368965 CGGAGAGGCCGTGGGGTTGGCGG + Intronic
900796720 1:4712532-4712554 GGGGGTGGCCGTGGTGGTGGTGG - Exonic
901000771 1:6147834-6147856 CCGAGAGGCAGAGGAGGAGGAGG + Intronic
901024435 1:6271675-6271697 CTGGGTGGGTGTGGAGGAGGAGG - Intronic
901062022 1:6475959-6475981 CGCAGTGGACTTGGAGGAGGAGG - Exonic
902234014 1:15046398-15046420 CTGAGTGGCTGAGGAGGAGGAGG + Intronic
903177004 1:21587317-21587339 GGGGGTGGCGGTGGAGGTGGGGG + Intergenic
903961262 1:27059182-27059204 CTGAGTTGCAGAGGAGGAGGAGG + Intergenic
904239618 1:29135242-29135264 GGCAGTGGCAGTGGAGGAGCTGG + Intergenic
904569224 1:31448656-31448678 GGTAGTGGTCGTGGAGGAAGAGG + Intergenic
904824941 1:33268276-33268298 TGGAGGGGACTTGGAGGAGGGGG + Intronic
904905902 1:33896992-33897014 CACAGAGGCCGTGGTGGAGGGGG + Intronic
905584526 1:39106017-39106039 GGGAGTTGCTGGGGAGGAGGAGG + Intronic
905922684 1:41729880-41729902 CAGAGTGGTAGTGGAGGAGAGGG - Intronic
906532292 1:46530718-46530740 TGGTGTGCCCGTGGAGGAAGCGG + Intergenic
906934324 1:50198760-50198782 GGGTGGGGCAGTGGAGGAGGTGG - Intronic
908300497 1:62757349-62757371 CATAGTGGACGTGGACGAGGGGG - Intergenic
910646936 1:89524706-89524728 AGCAGTGGCGGAGGAGGAGGAGG - Intergenic
911071493 1:93835420-93835442 GGGAGTGACCGAAGAGGAGGAGG - Intronic
913300847 1:117367310-117367332 CGGAGAGGAGGAGGAGGAGGAGG + Intergenic
914730412 1:150364749-150364771 CGAAGAGGCCGACGAGGAGGAGG - Exonic
915146819 1:153800407-153800429 TGGAGTGGCCCTAGAGGAGGAGG - Intergenic
915313279 1:155015222-155015244 CGAGGTGGCGGTGGCGGAGGTGG - Exonic
915355666 1:155254262-155254284 CGAAGTGTCTGTGAAGGAGGGGG - Intronic
915472892 1:156136370-156136392 GCGCGTGGCCGTGGAGGAGGTGG + Exonic
915545103 1:156592487-156592509 GGGAGGGGCTGTGGGGGAGGAGG + Intronic
915568214 1:156728595-156728617 GGCAGTGGCGGCGGAGGAGGGGG + Exonic
918239896 1:182611876-182611898 CAGAGTGGCGGCGGGGGAGGAGG + Intergenic
918569299 1:185969809-185969831 AGGAGATGCCCTGGAGGAGGAGG + Intronic
919806556 1:201384190-201384212 TGGGGTGGGGGTGGAGGAGGAGG - Intronic
920110341 1:203582978-203583000 CAGAGTGCCTGTGGTGGAGGCGG + Intergenic
920688862 1:208130695-208130717 GAGAGTGGCCGGGGAGGAGTAGG - Intronic
921019783 1:211225274-211225296 CGTAGTGGACATGGACGAGGGGG - Intergenic
922213136 1:223500555-223500577 CGTCGAGGCCTTGGAGGAGGGGG - Intergenic
922764653 1:228150652-228150674 CGGCGTGGCTGAGGAGGGGGAGG + Intronic
923330400 1:232918464-232918486 AGGAGTGGCAGAGGAGGAAGAGG + Intergenic
923340951 1:233006551-233006573 CAGAGTAGCAGTGGAGGAGAAGG + Intronic
923503390 1:234584956-234584978 AGGACTGGCCCTAGAGGAGGGGG + Intergenic
924482654 1:244451405-244451427 TGGGGTGGCCCTGGAGGAAGAGG - Intronic
924520622 1:244803043-244803065 GGGAGAGGACGTGGTGGAGGAGG - Intergenic
924717897 1:246595092-246595114 CGGGCTGGCCATGGACGAGGCGG + Intronic
1063082697 10:2783427-2783449 GGGAGAGGCTGTGTAGGAGGAGG + Intergenic
1067068763 10:43117978-43118000 GGGAGAGGCCCTGGAGAAGGTGG - Intronic
1067095768 10:43298669-43298691 AGGAGGGGCTGTGGAGGAGGAGG - Intergenic
1067441528 10:46311552-46311574 GGGAGTGGAGGTGGTGGAGGCGG - Exonic
1068790570 10:61026480-61026502 GAGAGTGACCGTGGTGGAGGTGG + Intergenic
1069307723 10:66992398-66992420 AGGAGTGGAGGAGGAGGAGGAGG - Intronic
1069957879 10:72062801-72062823 CGAGGAGGCCGAGGAGGAGGAGG - Exonic
1070305002 10:75234687-75234709 CGACGTGGCCGTGGTGGATGCGG - Exonic
1071618175 10:87094977-87094999 CGGGGAGGCCGCGGCGGAGGCGG - Intronic
1071877777 10:89861378-89861400 AGGAGTGGAAGAGGAGGAGGAGG - Intergenic
1071968048 10:90872564-90872586 CGGAGTGGAGGTGGAGGAGGAGG + Intronic
1072312583 10:94170956-94170978 TGGAGTGGCGGTGGTGGTGGTGG - Intronic
1072611245 10:97018951-97018973 GGCAGAGGCCGGGGAGGAGGAGG - Intronic
1072755320 10:98016864-98016886 GGGAGTGTCAGAGGAGGAGGGGG + Intronic
1073513468 10:104057124-104057146 GGTGGTGGCAGTGGAGGAGGTGG - Exonic
1073579455 10:104651126-104651148 CAGAGTGGTGGTGGAAGAGGAGG + Intronic
1073727653 10:106252914-106252936 AGGACTGGCAGTGGAGGAGCAGG + Intergenic
1074410612 10:113225424-113225446 CGGAGTGCAGGTGGAGGTGGTGG + Intergenic
1074794490 10:116927816-116927838 GGAAGTGGTGGTGGAGGAGGAGG + Exonic
1075064426 10:119279903-119279925 TGGGGTGGTGGTGGAGGAGGAGG + Intronic
1075598357 10:123748837-123748859 GGGAGGGCACGTGGAGGAGGTGG - Intronic
1076187539 10:128460935-128460957 GGGAGGGGCCTTGGAAGAGGAGG + Intergenic
1076255688 10:129022745-129022767 GGGAGGGGGCGGGGAGGAGGAGG - Intergenic
1076697242 10:132252873-132252895 CAGAGTGACCTGGGAGGAGGCGG - Intronic
1076767178 10:132642584-132642606 CGGAGTGACAGGGGAGGAGAGGG - Intronic
1077094873 11:795058-795080 CGGGGTGGAGGTGGAGGTGGAGG + Exonic
1077187623 11:1242549-1242571 GGGCGTGGCCGTGGAGCTGGTGG - Exonic
1077299533 11:1840660-1840682 CGGGGTGGCCGGGGAGGGGCTGG - Intronic
1077889792 11:6410864-6410886 CGGGGAGGCCGAGGAGGAGGAGG - Exonic
1077923058 11:6655767-6655789 CGGGGCGGCTGTGCAGGAGGCGG - Exonic
1079344643 11:19641353-19641375 GGGAGTAGCAGTGGAGGGGGAGG - Intronic
1083902542 11:65650580-65650602 CAGGGCGGCCCTGGAGGAGGAGG + Exonic
1084359403 11:68659848-68659870 AGGAGGGGCCTTGGAGGTGGAGG + Intergenic
1084431049 11:69111460-69111482 TGAAGAGGCTGTGGAGGAGGCGG + Intergenic
1084706819 11:70820534-70820556 CGAGGTGGCCGTGGAGCAGACGG + Intronic
1084849591 11:71928311-71928333 GGGAGTGGCCGAGAGGGAGGAGG - Intronic
1084858807 11:72005116-72005138 CTGACTGGCCGAGGAGGGGGAGG - Intronic
1084931657 11:72561104-72561126 AGGAATGGCAGGGGAGGAGGGGG + Intergenic
1087387331 11:97488460-97488482 AGGAGTGGAGGTGGATGAGGTGG - Intergenic
1087743425 11:101915197-101915219 GGGAGGGGCCGAGCAGGAGGAGG + Exonic
1088810199 11:113387140-113387162 CGGGGTGGCCACGGGGGAGGTGG - Intergenic
1089122356 11:116146275-116146297 CGGGGTGGACCTGGAGGAGCAGG - Intergenic
1089310623 11:117555943-117555965 AGGAGGGGCGGGGGAGGAGGGGG + Intronic
1089565268 11:119367962-119367984 TGGAGTGGGGGTGGAGGAGGAGG + Intronic
1089781133 11:120874041-120874063 GGGAGAGGCCGGGGAGCAGGCGG - Intronic
1090228556 11:125085853-125085875 TGGACTGGCAGTGGAGAAGGGGG - Intronic
1090246779 11:125221806-125221828 CGGGGTGGTCGGGGAGGAGGAGG - Intronic
1092253537 12:6914566-6914588 GGGAGTGGCAGTGGCGGCGGCGG - Intronic
1092389019 12:8059036-8059058 TCGAGTGGCCGTGGTGGTGGTGG - Exonic
1092793915 12:12092191-12092213 CGGAGTGGGGGTGCTGGAGGTGG + Intronic
1093953935 12:25195250-25195272 CGGGGTGGCGTTGGGGGAGGTGG - Exonic
1094023788 12:25941558-25941580 CAGAGAGGGAGTGGAGGAGGTGG - Intergenic
1094569888 12:31632375-31632397 GGGAGTTGCAGTGGAGGAGTTGG - Intergenic
1096180944 12:49550024-49550046 GGGAGTGGCAGAAGAGGAGGTGG - Intronic
1096647611 12:53047260-53047282 CCGAGCGGACGCGGAGGAGGAGG - Intronic
1096668119 12:53180663-53180685 CGGAGAGGACGAGGGGGAGGGGG + Intronic
1097074591 12:56383583-56383605 GAGGGTGGCCTTGGAGGAGGTGG - Intergenic
1097191148 12:57220255-57220277 GGGAGTGGGCGGGGTGGAGGTGG - Intronic
1097245362 12:57604944-57604966 GGGAGGGGAGGTGGAGGAGGGGG - Intronic
1097707482 12:62882906-62882928 GGGAGTGGCGGTGGGGGTGGAGG - Intronic
1098758010 12:74389569-74389591 CGGGGTGGACCTGGAGGAGTGGG + Intergenic
1099989876 12:89709737-89709759 GGGAGCGGCGGGGGAGGAGGGGG + Intergenic
1100404701 12:94263186-94263208 CGGGGAGGCGGTGGGGGAGGAGG - Intronic
1100611374 12:96194300-96194322 CGGGGTGGCCGCGCAGGAAGCGG + Intergenic
1101008445 12:100425774-100425796 TGGAGTGGGGTTGGAGGAGGAGG + Intergenic
1101697260 12:107138440-107138462 CGCAGTGGCAGTGGAGGTTGGGG + Intergenic
1102247151 12:111362799-111362821 CGGCGAGGCGGTGGTGGAGGGGG + Exonic
1102301956 12:111777648-111777670 CGGGGTGCCCGTGGAGGAGAAGG - Intronic
1102394287 12:112574332-112574354 CGGAGAGGGGGTGGTGGAGGAGG + Intronic
1102451228 12:113043514-113043536 CCCAGTGGCAGTGGAGGAAGTGG - Intergenic
1102854054 12:116277795-116277817 CGGAGTGGCGGCGGCGGCGGCGG + Intergenic
1103213897 12:119187114-119187136 CAGGGTGGGAGTGGAGGAGGGGG + Intronic
1103321899 12:120097013-120097035 CGCCTTGGCCGGGGAGGAGGGGG + Exonic
1103571762 12:121849605-121849627 CGCAGTGGACATGGAGGAAGGGG + Intronic
1103604865 12:122078978-122079000 CGGGGTGGCCGCGCCGGAGGCGG - Exonic
1103947102 12:124532729-124532751 CAGAGAGGCAGAGGAGGAGGAGG + Intronic
1104882784 12:132084182-132084204 CGGAGGGGGCGGGGCGGAGGGGG - Intergenic
1104891779 12:132143754-132143776 TGGACCGGCCCTGGAGGAGGCGG - Exonic
1104899494 12:132180996-132181018 CGGCGTGGCCGTCGGGGATGGGG - Intergenic
1104957745 12:132474670-132474692 CGGGGTCACCGCGGAGGAGGGGG - Intergenic
1104957755 12:132474693-132474715 CGGGGTCACCGCGGAGGAGGGGG - Intergenic
1104957843 12:132474902-132474924 CGGGGTCACCGCGGAGGAGGGGG - Intergenic
1104957892 12:132475015-132475037 CGGGGTCACCGCGGAGGAGGGGG - Intergenic
1104958066 12:132475410-132475432 CGGGGTCACCGCGGAGGAGGGGG - Intergenic
1105512447 13:21061650-21061672 CGGAGCGGCCGCGGAGGAGCAGG - Intergenic
1106871319 13:34025225-34025247 TGGAGTGGCTGTGGGGCAGGAGG + Intergenic
1106897231 13:34316843-34316865 GGGGGAGGCGGTGGAGGAGGTGG + Intergenic
1108192773 13:47959467-47959489 AGGAGGGGCGGAGGAGGAGGGGG + Intronic
1108787463 13:53921717-53921739 CGGAGTGGCTGTGGCGGCTGTGG - Intergenic
1110162326 13:72393302-72393324 GGAAATGGCAGTGGAGGAGGTGG - Intergenic
1111295706 13:86275574-86275596 ATTAGTGGCCCTGGAGGAGGGGG + Intergenic
1112507110 13:99981830-99981852 CGGAGAGGAAGAGGAGGAGGAGG - Exonic
1113501216 13:110775915-110775937 CAGAGATGCCGTGGTGGAGGTGG - Intergenic
1113779757 13:112969278-112969300 CGGAGGGGGCGCGGCGGAGGCGG - Exonic
1114566291 14:23635673-23635695 CAGAGTGGATGTGGAGGACGAGG - Intronic
1114615776 14:24067612-24067634 TGGGTTGGCCTTGGAGGAGGAGG - Intronic
1118111054 14:62720239-62720261 TGGAGAGGACGTGGAAGAGGTGG + Intronic
1118761925 14:68885328-68885350 GGGTGTGGCCGTGGAAGATGGGG - Intronic
1119836489 14:77754597-77754619 CGGAGGGGAGGAGGAGGAGGAGG + Intronic
1121956012 14:98214063-98214085 TGGAGTGGCTGTGGAGCAGAAGG - Intergenic
1122009276 14:98732442-98732464 AAGAGTGGCTGTGGAGGTGGGGG - Intergenic
1122123141 14:99565261-99565283 CGCAGGGGTGGTGGAGGAGGAGG - Intronic
1122201829 14:100127501-100127523 CAGACTGGCCGGGGAGCAGGAGG - Intronic
1122264153 14:100538937-100538959 CAGCGCGGCCGAGGAGGAGGAGG - Exonic
1122271167 14:100568994-100569016 CGGCGGGGCGGTGGGGGAGGCGG - Intronic
1122298834 14:100720350-100720372 GGGAAAGGCCTTGGAGGAGGAGG + Intergenic
1122316242 14:100827460-100827482 CGGAGTGGCCGCAGAGGCCGGGG + Intergenic
1122703905 14:103608290-103608312 CGGGGTGGGGGTGGAGAAGGTGG + Intronic
1122835089 14:104426944-104426966 AGGGGTGGGCGGGGAGGAGGAGG - Intergenic
1122840913 14:104462128-104462150 CGGGGTGGCCGTGGCGGGAGGGG - Intergenic
1123849745 15:24342859-24342881 CGGAGTGGGGGTGGTGGTGGGGG - Intergenic
1124073234 15:26415088-26415110 GGAAGTGGTCGTGGAGGAAGTGG + Intergenic
1124109507 15:26773086-26773108 CGGAGGGGGAGGGGAGGAGGGGG + Intronic
1124420753 15:29519379-29519401 CGGGGTGGCAGAGGAGGAAGAGG - Intronic
1124813906 15:32968963-32968985 AGAGGTGGCGGTGGAGGAGGCGG + Exonic
1124835616 15:33193976-33193998 GGTAGTGGCCTTGGAGGTGGTGG + Exonic
1124922288 15:34038838-34038860 CGCGGAGGCCGAGGAGGAGGAGG - Exonic
1124971138 15:34490522-34490544 GGCGGTGGCGGTGGAGGAGGCGG - Intergenic
1125510182 15:40288560-40288582 TGGCCTGGCCGTTGAGGAGGGGG + Exonic
1125557065 15:40594616-40594638 CGGAGGGGCCGAGGTGCAGGCGG - Intronic
1128067737 15:64775232-64775254 CGGCGGCGCCCTGGAGGAGGAGG - Exonic
1128078382 15:64842007-64842029 CGGACTCGCCATGGAGGAGGAGG + Exonic
1128139751 15:65290765-65290787 AGGAGTGGCAGAGGAGGAAGAGG - Intronic
1128568428 15:68716189-68716211 AGGAGTGACAGTGAAGGAGGTGG - Intronic
1129414609 15:75368340-75368362 GGCAGGGGCCGGGGAGGAGGGGG - Intronic
1129608908 15:77038030-77038052 GGGAGTGGGTGTGGAGGAGAGGG + Intergenic
1130997844 15:88913545-88913567 CGGTGTGGCAGTGGCGGAAGAGG - Intergenic
1131132833 15:89911035-89911057 CCCAGTGGCCTTGTAGGAGGGGG - Intronic
1131229021 15:90646999-90647021 GGGAGTGGGTGTGGAGGAGTTGG - Intergenic
1131511304 15:93050927-93050949 TGCAGGGGCCGTGGGGGAGGTGG + Intronic
1132840369 16:1975927-1975949 CCGTGTGGCCGTGGAGGATCTGG - Exonic
1132892898 16:2213213-2213235 CAGGGTGGGAGTGGAGGAGGCGG - Exonic
1133058344 16:3158596-3158618 CCGAGTGGCCCTCGGGGAGGCGG + Intergenic
1133613003 16:7450745-7450767 CTGAGTGGGTGTTGAGGAGGAGG + Intronic
1135304054 16:21353951-21353973 CGGAGGGGCCACGGAAGAGGCGG - Intergenic
1135745705 16:25014952-25014974 CGGTGTGGCGGAGGAGGCGGCGG + Intronic
1136300788 16:29333088-29333110 CGGAGGGGCCACGGAAGAGGCGG - Intergenic
1136454458 16:30372365-30372387 CGGCATGGGCCTGGAGGAGGGGG + Intronic
1137396564 16:48119599-48119621 CGGCATGGCCGGGGAAGAGGAGG + Intronic
1138561338 16:57802458-57802480 CGGGCTGGCCGAGGAGGAGGCGG - Exonic
1138635040 16:58331480-58331502 TGGTGAGGCGGTGGAGGAGGGGG + Intronic
1139504594 16:67392656-67392678 GGAGGTGGCAGTGGAGGAGGGGG - Intronic
1139691085 16:68642622-68642644 CTGAGTGCCCGAGAAGGAGGCGG + Intronic
1139806168 16:69566530-69566552 CGGGGTGACGGTGGAGGGGGCGG + Intronic
1140832442 16:78764371-78764393 CCAAGTGGGCCTGGAGGAGGAGG - Intronic
1141839633 16:86566660-86566682 CGGAGTCGCCGCGGAGGCCGGGG + Intergenic
1141842863 16:86585324-86585346 TGGAGTGGACCTGGAAGAGGTGG - Intergenic
1142228779 16:88889716-88889738 TGAAGTGTCCCTGGAGGAGGAGG - Intronic
1142228798 16:88889795-88889817 TGAAGTGTCCCTGGAGGAGGAGG - Intronic
1142228810 16:88889843-88889865 TGAAGTGTCCCTGGAGGAGGAGG - Intronic
1142412219 16:89922714-89922736 CGCAGTGGGCGGGGAGGGGGTGG - Intronic
1142427940 16:90010771-90010793 CGGCGTGGCCCTGGATGAGAGGG - Intronic
1142747567 17:1967528-1967550 GGGAGAGGCCAGGGAGGAGGCGG - Intronic
1143471223 17:7177302-7177324 AGGAGGGGCTGGGGAGGAGGTGG + Exonic
1143585527 17:7848561-7848583 CTGGGTGGCCGTGGTGGTGGTGG - Exonic
1143592577 17:7894428-7894450 TGCAGTGGCCGGGGAGGAGGAGG + Exonic
1143760842 17:9102967-9102989 GGTAGTGACTGTGGAGGAGGTGG + Intronic
1144725328 17:17498999-17499021 CAGAGTGGCCGGGGAGGACTGGG + Intergenic
1144810973 17:17998674-17998696 GGGGGTGGCCGTTGGGGAGGCGG - Intronic
1145886321 17:28384737-28384759 TGGAGATGGCGTGGAGGAGGCGG - Intronic
1145936356 17:28717150-28717172 GGGTGTGGGCGAGGAGGAGGCGG - Intronic
1146259765 17:31413668-31413690 TGGAAGGGCCTTGGAGGAGGAGG - Intronic
1146655448 17:34632208-34632230 CAGAGAGGCCGTGGAGGACATGG + Intronic
1147123979 17:38352818-38352840 CGGAGGGGCCCGGGAGGAGGCGG - Exonic
1147413828 17:40273933-40273955 CTCAGGGGCGGTGGAGGAGGAGG - Exonic
1147486755 17:40822521-40822543 CGCAGTGGAGGAGGAGGAGGAGG - Exonic
1147745635 17:42692763-42692785 GCGAGTGGCCTTGGAGGATGGGG - Intronic
1147760626 17:42795467-42795489 GGGAGGGGCCGAGCAGGAGGTGG - Exonic
1147952429 17:44114570-44114592 CAGCGGGGCCATGGAGGAGGCGG - Intronic
1147971538 17:44220993-44221015 CGGGGTGGCCCGGGAGGCGGCGG - Intronic
1148212093 17:45814740-45814762 CGGAGTGGCAGTGGAAGCAGTGG - Intronic
1148386636 17:47238788-47238810 GGGAGTGGCAGTGGCGGCGGTGG - Intergenic
1148437165 17:47693964-47693986 CGGAGCAGCCGGGGAGGAGGAGG + Intergenic
1149490888 17:57084828-57084850 CGGAGGGGCCGGTGAGGAGCAGG - Intergenic
1150133209 17:62680315-62680337 CGGAGTGGCGCTGGGGGACGCGG + Intronic
1150149106 17:62794285-62794307 GGGAGTGGCAGTGGTGGTGGAGG - Intronic
1150283510 17:63943110-63943132 GGGAGTGGATGTGGAGGAGTTGG + Intronic
1150428923 17:65100583-65100605 GGGAGAGGGGGTGGAGGAGGAGG - Intergenic
1150433742 17:65138944-65138966 AGGGGTGGCTGGGGAGGAGGAGG - Intronic
1150627231 17:66849336-66849358 GGGAGGGGCAGAGGAGGAGGAGG + Intronic
1151218373 17:72592867-72592889 CGGGGTGGGCGGGGAGGGGGTGG + Intergenic
1151805271 17:76401007-76401029 CCGAGTGGTGGTGGAAGAGGTGG - Exonic
1152058173 17:78049162-78049184 CAGAGTGCCCTTGGAGCAGGGGG + Exonic
1152226980 17:79097255-79097277 CGGGGGAGGCGTGGAGGAGGGGG - Intronic
1152269727 17:79317116-79317138 GGGGGTGGCCGTGGGGGAGATGG - Intronic
1152362488 17:79839129-79839151 CGGAGCGGCCCGCGAGGAGGCGG - Intronic
1152627814 17:81396298-81396320 AGAAGTGGGGGTGGAGGAGGGGG + Intronic
1152758322 17:82096433-82096455 CAGAGCAGCCATGGAGGAGGTGG - Exonic
1152774409 17:82191539-82191561 TGGAGTGGCAGAGGTGGAGGAGG - Intronic
1152783329 17:82236011-82236033 GGGAGGGGCCGTGGTGGACGAGG + Exonic
1152801719 17:82333779-82333801 GGGAGGGGCCAGGGAGGAGGCGG + Exonic
1153894501 18:9546106-9546128 GGGAGTAGCCGTGGAGGGTGTGG - Intergenic
1153900605 18:9614495-9614517 CCGGGCGGCCGCGGAGGAGGGGG - Exonic
1153997447 18:10454567-10454589 AGGAGGGGCCCTGGAGGGGGCGG - Intergenic
1154354057 18:13611389-13611411 CGGGGTGGCCGTGGTGGAAAGGG - Intronic
1155505498 18:26528823-26528845 ACAAGTGGCCGGGGAGGAGGAGG - Intronic
1157166054 18:45359378-45359400 CAGAGAGGCAGAGGAGGAGGAGG - Intronic
1157447531 18:47756444-47756466 GGCTGGGGCCGTGGAGGAGGGGG - Intergenic
1158209545 18:55031913-55031935 GCCAGTGGCAGTGGAGGAGGAGG - Intergenic
1158446274 18:57524683-57524705 AGGAGTGGAGGAGGAGGAGGAGG + Intergenic
1160055314 18:75473143-75473165 CTGAGTGGACCTGGAGGAAGGGG - Intergenic
1160860255 19:1234583-1234605 CAGAGTGGCCTTGGGAGAGGTGG + Exonic
1160927894 19:1555830-1555852 CGAGGTGGCCGTGGAGAAGGCGG + Exonic
1160930934 19:1569033-1569055 AGGAGGTGGCGTGGAGGAGGTGG - Intergenic
1161051283 19:2165093-2165115 CGGCGTGGCCCCTGAGGAGGCGG + Intronic
1161068367 19:2248976-2248998 AGGTGTGGGCCTGGAGGAGGAGG - Intergenic
1161108758 19:2456862-2456884 CGGCGTGGCCATGGTGGCGGCGG + Exonic
1161201175 19:3015693-3015715 CCGAGTGGCCCTGGTGGTGGCGG - Exonic
1161381039 19:3965010-3965032 GTGAGTGGGGGTGGAGGAGGCGG + Intronic
1161399256 19:4060179-4060201 GGGAGTGGCCCGGGGGGAGGAGG - Intronic
1161650950 19:5484556-5484578 CGGATGGGCCCTGGAGGAGGGGG - Intergenic
1161857166 19:6772652-6772674 CTGAGAGGGGGTGGAGGAGGAGG - Intergenic
1161976591 19:7611038-7611060 GGGAGAGGCGGAGGAGGAGGTGG + Intronic
1162026124 19:7895087-7895109 CAGAGTGCCCCTGGAGGGGGTGG + Intronic
1162386127 19:10361648-10361670 GGGTGTGTCCGTGGAGGAGGTGG - Intronic
1162386137 19:10361679-10361701 GGGTGTGTCTGTGGAGGAGGTGG - Intronic
1162386152 19:10361723-10361745 GGGTGTGTCTGTGGAGGAGGTGG - Intronic
1162678831 19:12322687-12322709 CGCAGTGGCCTTTGAGGATGTGG - Exonic
1162779134 19:12997508-12997530 TGGAGTGGCCGTGGAACTGGAGG - Intronic
1162932225 19:13962919-13962941 CGGAGGGGCTCGGGAGGAGGAGG - Intronic
1163029807 19:14536959-14536981 AGGAGGGGCCGAGGAGGGGGCGG + Intronic
1163029814 19:14536976-14536998 GGGCGGGGCCGAGGAGGAGGAGG + Intronic
1163219325 19:15903119-15903141 CGGCGTGGCCGCGCAGGTGGAGG - Intergenic
1163801779 19:19370184-19370206 TGGAGTGGCCAGAGAGGAGGGGG - Intergenic
1164563957 19:29312606-29312628 GGGAGTGGGTGTGGAGCAGGGGG + Intergenic
1164643638 19:29843523-29843545 CAGGGTGGCCCCGGAGGAGGGGG + Intergenic
1165224090 19:34342023-34342045 TGGGGTGCCCGTGGTGGAGGGGG - Exonic
1165304353 19:34994613-34994635 CAGAGTGGGCATGGAGGTGGAGG - Intergenic
1165800102 19:38544049-38544071 GGGAGGGGCAGAGGAGGAGGCGG - Intronic
1166752468 19:45170859-45170881 GGGAGGGGCCGAGGAGGAGCAGG + Intronic
1166800078 19:45451204-45451226 CGGACATGCCGGGGAGGAGGGGG - Intronic
1166820768 19:45578405-45578427 CTGGGTGGCGGTGGGGGAGGGGG - Intronic
1166851742 19:45764641-45764663 CAGAGTGGCTGGGGAGGGGGTGG - Intergenic
1166983966 19:46648996-46649018 CGGCGTGGCCGTGGAGGCCGAGG + Exonic
1167506119 19:49871952-49871974 GGCAGTGGCCGTGGCTGAGGAGG - Intronic
1167507117 19:49876689-49876711 CGGAGTGTGCGGAGAGGAGGCGG - Exonic
1167526805 19:49989328-49989350 AGGAGGGGCTGTTGAGGAGGTGG - Intronic
1167637345 19:50662508-50662530 GCGGGTGGACGTGGAGGAGGAGG + Exonic
1168167581 19:54561942-54561964 CGGAATAGTCTTGGAGGAGGCGG + Intergenic
1168232915 19:55044790-55044812 GGGAATGGCCGAGGAGGAAGGGG - Exonic
1168258325 19:55179281-55179303 CTGTGGGGCCGTGGAGGAAGAGG - Intronic
1168337071 19:55602856-55602878 AGCAGGGGCCGAGGAGGAGGAGG + Exonic
925245412 2:2378156-2378178 AGGAGTGGCAGTGGAGATGGAGG - Intergenic
927083148 2:19650201-19650223 AGCAGTGGCCGAGGAGGATGAGG + Intergenic
927195472 2:20543445-20543467 GGGAGTGTCCCTGGAGGAGCTGG - Intergenic
927448177 2:23184230-23184252 CGGGGTGGAAGTGGTGGAGGTGG - Intergenic
927494929 2:23545889-23545911 AGGACTGGCCTTGGATGAGGCGG - Intronic
928158547 2:28899342-28899364 AGAAGTTTCCGTGGAGGAGGTGG + Intronic
929037275 2:37706307-37706329 CAGAGAGGCCCTGGAGGAGGAGG - Intronic
929452731 2:42047929-42047951 CGGAGGGGCGGGGGAGGGGGCGG + Intergenic
929775516 2:44928882-44928904 CCGAGAGGCCGTGGAGGCGGAGG + Intergenic
929784623 2:44980181-44980203 CAGACTGCCCGGGGAGGAGGGGG - Intergenic
929950517 2:46406442-46406464 AGGAGTGGCAGTGGGGCAGGAGG - Intergenic
932635679 2:73385985-73386007 CGTAGTGGTCGTGGAGGAGGTGG + Exonic
933636441 2:84713555-84713577 AGGAGTGGCTGTGGACCAGGAGG - Intronic
933846030 2:86327972-86327994 CAGGGTGGCAGTGGTGGAGGTGG + Intronic
934522198 2:95026484-95026506 CGGGGTGGGGGTGGAGGAGATGG + Intronic
934562461 2:95320396-95320418 TGGAGGGGTCGGGGAGGAGGAGG + Intronic
935281083 2:101518495-101518517 AGAAGTATCCGTGGAGGAGGTGG - Intergenic
935854956 2:107263755-107263777 GGGAGTGGATGTGGGGGAGGAGG + Intergenic
936450621 2:112631209-112631231 CCCAGTGCCCCTGGAGGAGGTGG - Intergenic
937217774 2:120323580-120323602 AGGAGAGGCCGTGGAGGAGGAGG - Intergenic
937284495 2:120741610-120741632 CGGCGGGGGCGGGGAGGAGGCGG - Intronic
938088430 2:128416999-128417021 AGCAGTGGCAGTGGTGGAGGTGG - Intergenic
938141094 2:128795159-128795181 TGAAGTGGTGGTGGAGGAGGAGG + Intergenic
938342855 2:130547047-130547069 AGGAGAGGCCTTGGGGGAGGTGG - Intronic
938346978 2:130573675-130573697 AGGAGAGGCCTTGGGGGAGGTGG + Intronic
939900414 2:147844286-147844308 CGGAGTGGAGGGCGAGGAGGCGG - Intergenic
940344902 2:152619110-152619132 GGCAGTGGTGGTGGAGGAGGGGG - Exonic
941686837 2:168456295-168456317 AGCAGCGGCCGCGGAGGAGGCGG + Exonic
942446157 2:176080282-176080304 CGGGGTGGCGGTGGCGGCGGCGG - Exonic
943060503 2:183037957-183037979 CGGGGAGGCCGCGGCGGAGGCGG - Intronic
944060129 2:195563258-195563280 CGGAGGGGCCGGGGAGGTGTGGG - Intergenic
944656571 2:201881754-201881776 GGGAGTGGCCGGGGAGGAATGGG - Intronic
945042646 2:205755107-205755129 AGGACTGGACGAGGAGGAGGCGG - Intronic
945203811 2:207310721-207310743 CGGAGTGAGCATGCAGGAGGGGG - Intergenic
947838474 2:233191689-233191711 CGCAGTGTCCGTGGAAGAGCTGG + Intronic
949023691 2:241755198-241755220 TGGGCGGGCCGTGGAGGAGGAGG - Intronic
1168961712 20:1874563-1874585 CGGCCTGGCCTTGGGGGAGGGGG + Intergenic
1169118483 20:3082303-3082325 GAGAGTGGCCTTGGAGGGGGTGG - Intergenic
1170629744 20:18056845-18056867 CGGGGGGGTCGTGGAGCAGGCGG + Exonic
1170912013 20:20582071-20582093 CGGGGAGGCCATGGAGGAGCTGG - Intronic
1172474330 20:35226322-35226344 GGGAGTGGCATTGGAGGAGAGGG - Intergenic
1172518262 20:35550875-35550897 CAGAGTGGCAGTGGAAGTGGTGG + Intronic
1172768061 20:37361534-37361556 GGGTGTGGGCGGGGAGGAGGGGG + Intronic
1173602216 20:44303950-44303972 GGGAGTGGCCATGGAGTAGATGG - Exonic
1174246877 20:49188229-49188251 CGGAGTGGCCGTGGAGGAGGCGG + Exonic
1174960509 20:55151735-55151757 AGGAGCGGCAATGGAGGAGGAGG - Intergenic
1175224914 20:57439301-57439323 GGGAGGGGCAGTGCAGGAGGAGG - Intergenic
1175443087 20:59004341-59004363 AGGAGTGGCCAGGGAGGTGGAGG + Intronic
1176160024 20:63643037-63643059 CGGAGGGGCCCTGGGAGAGGTGG - Intronic
1176169343 20:63689953-63689975 CGGAGAGGCTCTGGAGGAGACGG - Intronic
1176382350 21:6119732-6119754 AGGACTTGCCGTGGTGGAGGGGG - Exonic
1176445191 21:6815588-6815610 CGGGGTGGGGGTGGAGGTGGGGG + Intergenic
1176548880 21:8213180-8213202 CGGTGTGGTGGTGGGGGAGGAGG + Intergenic
1176556775 21:8257393-8257415 CGGTGTGGTGGTGGGGGAGGAGG + Intergenic
1176567811 21:8396215-8396237 CGGTGTGGTGGTGGGGGAGGAGG + Intergenic
1176575714 21:8440434-8440456 CGGTGTGGTGGTGGGGGAGGAGG + Intergenic
1176823358 21:13680621-13680643 CGGGGTGGGGGTGGAGGTGGGGG + Intergenic
1178983299 21:37283212-37283234 AGGACTGGCCGTGGTGGAGCAGG + Intergenic
1179071194 21:38072698-38072720 CTGAGTGGATATGGAGGAGGGGG + Intronic
1179081819 21:38178598-38178620 GGCAGTGGCGGTGGAGGAGGAGG + Intronic
1179714613 21:43280603-43280625 TGGAGGGGCAGTGGAGGTGGAGG + Intergenic
1179741122 21:43418507-43418529 AGGACTTGCCGTGGTGGAGGGGG + Exonic
1180088760 21:45523425-45523447 TGGTGTGGCCGTGGAGGCTGTGG - Intronic
1180230411 21:46423806-46423828 GGGAGTGGGAGGGGAGGAGGGGG + Intronic
1180614926 22:17120750-17120772 GGGCGTGGAGGTGGAGGAGGAGG + Exonic
1180958348 22:19751063-19751085 TGGAGTGGCCGGGTGGGAGGTGG - Intergenic
1182358178 22:29731990-29732012 CGGGGTGGACGTTGAGGAGGAGG - Intronic
1182532317 22:30969662-30969684 TGGAGCGGCCGGGGAGGCGGGGG + Intergenic
1183597750 22:38822582-38822604 GGGAGGGGCCCTGGATGAGGTGG + Exonic
1184810001 22:46824798-46824820 AGGAGTGGCTGTTGAGGATGGGG + Intronic
1203253765 22_KI270733v1_random:129488-129510 CGGTGTGGTGGTGGGGGAGGAGG + Intergenic
1203261821 22_KI270733v1_random:174567-174589 CGGTGTGGTGGTGGGGGAGGAGG + Intergenic
949969912 3:9396440-9396462 GGGAGCTGCGGTGGAGGAGGTGG - Intergenic
950018073 3:9768217-9768239 CGGAGAGGCCGGGGAGTCGGGGG - Intronic
950136534 3:10585013-10585035 GGGTGTGGCAGGGGAGGAGGAGG - Intronic
950922186 3:16705681-16705703 CTGAGTGGTGGTGGTGGAGGTGG - Intergenic
951728407 3:25783824-25783846 GGGTGTGGGCCTGGAGGAGGGGG + Intronic
952241185 3:31532822-31532844 CGGACTGGGGGTGGAGGAAGCGG - Exonic
953561387 3:43995841-43995863 AGGTGTGGCCGCGGGGGAGGGGG + Intergenic
959527837 3:107397646-107397668 GGGTGTTGCTGTGGAGGAGGGGG - Intergenic
961408912 3:126704354-126704376 CGGAGTGGACGAGGAGGAGCGGG + Exonic
961428833 3:126865532-126865554 GCAAGTGGACGTGGAGGAGGAGG - Intronic
961481515 3:127183750-127183772 GGGAGGGGAGGTGGAGGAGGGGG - Intergenic
961491013 3:127257020-127257042 CAGGGTGGCCAGGGAGGAGGCGG - Intergenic
961495334 3:127287468-127287490 GGCAGTGGCCCTGTAGGAGGGGG - Intergenic
961554397 3:127688312-127688334 CTGAGTGGATGTGGAGGATGGGG + Intergenic
962498398 3:135965659-135965681 GGGTGGGGCCGAGGAGGAGGAGG + Exonic
964376372 3:156052221-156052243 TGGGGTGGCAGGGGAGGAGGTGG - Intronic
966998314 3:185307539-185307561 CGGGGTGGCGGGGGAGGGGGTGG - Intronic
967859292 3:194139670-194139692 GGGAGGGGCCGGGGGGGAGGAGG - Intergenic
968319195 3:197750302-197750324 AGGAGGGGCTGTGGAGGCGGGGG + Intronic
968471817 4:786056-786078 CGGAGTCCGCGTGCAGGAGGGGG + Exonic
968556220 4:1247753-1247775 TGGAGAGGCCGGGGAGGGGGGGG + Intronic
968701147 4:2058919-2058941 CCGGGCGGCCGCGGAGGAGGAGG + Intergenic
968746868 4:2364903-2364925 CGGAGGGACAGTGGAGGCGGGGG + Intronic
968753561 4:2402870-2402892 AGGAGGGGCCTTGGTGGAGGGGG - Intronic
968813413 4:2810046-2810068 AGGAGTGGCCATGGCTGAGGAGG + Intronic
969685988 4:8674598-8674620 CGGTGTGGCCGGGGAGGTGGTGG - Intergenic
972918180 4:43905457-43905479 CGGGGTGGACATGGAGGAGCAGG - Intergenic
973037152 4:45420481-45420503 CTGGGTGCCCGTGGAGCAGGGGG - Intergenic
974047358 4:56908638-56908660 GGGAGAGGCCCTGGGGGAGGGGG - Intronic
974513175 4:62872646-62872668 CACAGTGGTTGTGGAGGAGGTGG + Intergenic
975585095 4:75941002-75941024 CGGGTAAGCCGTGGAGGAGGAGG + Exonic
977915982 4:102593526-102593548 GGTAGTGGCGGTGGAGGAGGGGG + Exonic
979632855 4:122922778-122922800 GTGAGTGGCGGTGGGGGAGGAGG - Intronic
979674405 4:123396753-123396775 TGGAGTGGAGGTGGAGGTGGAGG + Intergenic
979968583 4:127106593-127106615 CTGAGTGGACCTGTAGGAGGTGG - Intergenic
984870893 4:184324133-184324155 GGGAGGGGCCGTGGAGATGGAGG - Intergenic
985196915 4:187440987-187441009 GGGAGTGGCAGTGGAGATGGAGG + Intergenic
986027934 5:3867897-3867919 GGGAGTGGAGGTGGAGGAGCTGG + Intergenic
987384650 5:17317696-17317718 CCGAGTGGGGGTGGAGGAGGGGG + Intergenic
987396531 5:17430095-17430117 CGGAAAGCCCTTGGAGGAGGTGG + Intergenic
991198509 5:63962121-63962143 CAGAGTGACCGTGGAGGATGGGG - Exonic
992090762 5:73314148-73314170 CTGTGTGGATGTGGAGGAGGAGG - Intergenic
996082168 5:119268612-119268634 CGGAGTGGGTGAGGAGGAGCTGG - Intergenic
996917936 5:128733407-128733429 CTGAGAGGTAGTGGAGGAGGGGG - Intronic
998445141 5:142192676-142192698 TGGGGTGGCAGTGGGGGAGGGGG - Intergenic
998600728 5:143582110-143582132 GGGAGTAGCTGTGGAGGATGTGG + Intergenic
1000052695 5:157575905-157575927 GGGAGGGGCCGGGGAGGAGCTGG + Intergenic
1001636061 5:173211266-173211288 TGGAGTGGACGGGGAGGAGCTGG + Intergenic
1002095411 5:176828076-176828098 GGGGGTGGGTGTGGAGGAGGGGG - Intronic
1002194023 5:177492626-177492648 CGGAGTGGCCGTGGGTGACTGGG - Exonic
1003097802 6:3156379-3156401 GGGAGGGGCCCTGGAGGAGGAGG + Intronic
1003101532 6:3179937-3179959 GGGAGGGGCCCTGGAGGAGGAGG + Intergenic
1003276561 6:4658890-4658912 AGGTGGTGCCGTGGAGGAGGAGG + Intergenic
1003698326 6:8435447-8435469 AGGAGTGGGCGAGGAGGAGGAGG - Exonic
1004199498 6:13534630-13534652 AGGAGAGGCCTTGGAGGAGCAGG + Intergenic
1004608816 6:17219222-17219244 AGGAGTAGCAGTGGGGGAGGAGG - Intergenic
1004906236 6:20239286-20239308 CGGAGTGGCGGGGGAGGCGCAGG - Intergenic
1005561481 6:27045564-27045586 CTGGGTGCCCGTGGAGTAGGGGG - Intergenic
1005735648 6:28743140-28743162 GGGAGAGGCGGGGGAGGAGGTGG + Intergenic
1005947033 6:30602481-30602503 CGGAATGGAGGAGGAGGAGGAGG + Exonic
1006505340 6:34485601-34485623 AGGTGGGGCCGTTGAGGAGGTGG + Intronic
1006511020 6:34521230-34521252 CGGAGAGGACAGGGAGGAGGTGG + Intronic
1007048837 6:38804910-38804932 GGGGGTGGCCGGGGGGGAGGGGG + Intronic
1007408283 6:41647208-41647230 CGCCTTGGCAGTGGAGGAGGGGG + Intronic
1008160353 6:48068730-48068752 CGGAGTGGGTGGGGAGGCGGCGG - Intergenic
1011633876 6:89352765-89352787 CGGGGGCGCAGTGGAGGAGGCGG - Exonic
1011714160 6:90086759-90086781 CGGAGTGGCAGAGCAGGAGAGGG + Intronic
1012421283 6:99068358-99068380 GGGAGAGGAGGTGGAGGAGGAGG - Intergenic
1013608528 6:111773362-111773384 GGGAGAGGCAGAGGAGGAGGGGG + Intronic
1015410461 6:132888095-132888117 AGGAGAGGCAGTGGAGGAGGTGG + Intergenic
1015496889 6:133891664-133891686 GTAAGTGGCCGTGGCGGAGGGGG - Intronic
1018015957 6:159712588-159712610 CTGAGTGGTCGTTGTGGAGGCGG - Intronic
1018861767 6:167715642-167715664 TGGGGAGGCTGTGGAGGAGGAGG + Intergenic
1018876562 6:167826987-167827009 CGGCGCGGCCGCGGAGGCGGAGG + Exonic
1019159149 6:170057773-170057795 GGGAGTGGGAGTGGGGGAGGGGG - Intergenic
1019592734 7:1843902-1843924 TGGAGTGGCCGTGGCTGAAGTGG - Intronic
1019672730 7:2290822-2290844 CAGAGAGGCCGTGGTGGAGGAGG - Intronic
1021594890 7:22304559-22304581 CCGAGTGGCGGAGAAGGAGGTGG + Intronic
1022721094 7:32942646-32942668 CGGAGGGGCCCTGGAGGCCGCGG - Intergenic
1023132179 7:37014177-37014199 GGGAGGGGCTGAGGAGGAGGAGG - Intronic
1023638829 7:42238034-42238056 GGGAGGGGCGGAGGAGGAGGAGG - Intergenic
1024255496 7:47537293-47537315 AGGAGTGGCCGTGGAGGCTGCGG - Intronic
1024569646 7:50713391-50713413 GGAGGTGGCGGTGGAGGAGGTGG - Intronic
1027124874 7:75549240-75549262 CGGAATGGCCTTGCAGGGGGAGG - Intronic
1027218861 7:76201725-76201747 CGAAGGGGGCGGGGAGGAGGGGG + Intergenic
1027222181 7:76221013-76221035 GGGAGAGGCCTGGGAGGAGGTGG - Intronic
1027814701 7:82953688-82953710 GGGGGTGGTGGTGGAGGAGGAGG + Exonic
1028394134 7:90348629-90348651 AGGGGTGGGGGTGGAGGAGGTGG + Intronic
1028762423 7:94510241-94510263 CGGGCAGGCCGTGGGGGAGGCGG + Intronic
1028773165 7:94650336-94650358 CTGAGTGGCCGTGGATGCCGAGG - Intronic
1028871272 7:95773150-95773172 CTGACTGCCCCTGGAGGAGGGGG + Intronic
1029139753 7:98401208-98401230 CGGGGTGGGCGGGGAGGAGGCGG + Intergenic
1030014370 7:105203732-105203754 GGTGGTGGCGGTGGAGGAGGAGG + Exonic
1030147717 7:106373203-106373225 TGGAGAGGCCCTGGAGGAGGAGG + Intergenic
1031101565 7:117486850-117486872 AAGAGTGGCCATGGTGGAGGTGG + Intronic
1032087259 7:128890807-128890829 CGGAGCGGGCCTGGAGGAAGGGG + Intronic
1032954680 7:136957000-136957022 CTGAGGGGCCTTGGAGTAGGGGG - Intronic
1033085358 7:138336325-138336347 CGGGGTGGCAGAGGAGGAAGAGG - Intergenic
1033137188 7:138795337-138795359 AGCAGTGGATGTGGAGGAGGGGG - Intronic
1033250391 7:139753453-139753475 GGGAGTGGACGAGGAGAAGGGGG + Intronic
1034306430 7:150048310-150048332 CGGAGGGGCCGGGGTGGAGGAGG - Intergenic
1034411703 7:150945542-150945564 CGAAGAGGCCATGGAGGAGGAGG + Intronic
1034488126 7:151379006-151379028 CGGACAGGCGGTAGAGGAGGGGG + Intronic
1034699316 7:153082934-153082956 TGAAGTCGCCATGGAGGAGGAGG + Intergenic
1034800416 7:154052332-154052354 CGGAGGGGCCGGGGTGGAGGAGG + Intronic
1035667229 8:1388246-1388268 GGCAGAGGCCGTGGATGAGGAGG + Intergenic
1035667274 8:1388500-1388522 GGCAGAGGCCGTGGATGAGGAGG + Intergenic
1035667316 8:1388703-1388725 GGCAGAGGCCGTGGATGAGGAGG + Intergenic
1035667334 8:1388805-1388827 GGCAGAGGCCGTGGATGAGGAGG + Intergenic
1035667361 8:1388957-1388979 GGCAGAGGCCGTGGATGAGGAGG + Intergenic
1035667370 8:1389007-1389029 AGCAGAGGCCGTGGATGAGGAGG + Intergenic
1035667379 8:1389057-1389079 AGCAGAGGCCGTGGATGAGGAGG + Intergenic
1035683642 8:1507598-1507620 CGGAGTGGGCGCCGAGGCGGAGG + Intronic
1036295191 8:7529178-7529200 AGGAGTGGAGGAGGAGGAGGAGG - Intergenic
1036327379 8:7791840-7791862 AGGAGTGGAGGAGGAGGAGGAGG + Intergenic
1036755408 8:11467765-11467787 CGGAGTTGCAGTGAAGGACGCGG - Intronic
1039440242 8:37590062-37590084 CGGAGTGGATGTGGAGCAGAAGG - Intergenic
1040039147 8:42897920-42897942 CGGCGCGGCCGGGGAGGGGGAGG + Intronic
1041257457 8:55991385-55991407 CTGACTGGCAGTGGAGGAAGAGG + Intronic
1042167548 8:65960189-65960211 CAGAGAGGCCCTGGGGGAGGAGG + Intergenic
1042591823 8:70403866-70403888 CGGAGACGCGGAGGAGGAGGAGG - Intergenic
1043502750 8:80873687-80873709 CCGAGGGGGCGCGGAGGAGGAGG - Intronic
1044380594 8:91528451-91528473 GGTAGTGGCCTTGGAGGTGGTGG + Intergenic
1046870955 8:119205526-119205548 GGGGGTGGCAGTGGGGGAGGCGG + Intronic
1047254818 8:123207086-123207108 GGGAGGGGAAGTGGAGGAGGAGG - Intronic
1047812382 8:128424803-128424825 AGGAGTGGAGGAGGAGGAGGAGG - Intergenic
1049104308 8:140601911-140601933 GGGAAAGACCGTGGAGGAGGAGG - Intronic
1049122846 8:140755417-140755439 CGGTGTGGCCGCGGAGTAGAGGG - Intronic
1049235521 8:141510480-141510502 AGGAGGGGGTGTGGAGGAGGAGG - Intergenic
1049412374 8:142478977-142478999 TGGGGTGGCCGTGGAGTAGCGGG + Intronic
1049446437 8:142633599-142633621 CTGAGTCACCGTGGGGGAGGAGG + Intergenic
1049989188 9:976427-976449 CGGAGAGGGCTTGGAGGAGGGGG + Intergenic
1050844401 9:10195990-10196012 TGGACTGGAAGTGGAGGAGGGGG + Intronic
1051085878 9:13348425-13348447 AGAAGTGGCGGTGGAGGAGGAGG + Intergenic
1052048531 9:23821691-23821713 CGGAGAGGCGGTGGCGGCGGCGG + Intronic
1052064440 9:23999527-23999549 AGTAGTGGTGGTGGAGGAGGTGG + Intergenic
1053313400 9:37033898-37033920 CAGGGTGACCCTGGAGGAGGAGG - Intronic
1053739219 9:41123485-41123507 AGGAGTGGGAGTGGAGGTGGTGG - Intergenic
1054689133 9:68307837-68307859 AGGAGTGGGAGTGGAGGTGGTGG + Intergenic
1055091027 9:72364935-72364957 AGGGGGGGCCGAGGAGGAGGTGG + Intronic
1055266005 9:74497188-74497210 GGGAGGGGACGTGGTGGAGGCGG - Intergenic
1056591916 9:87970996-87971018 GGGCATGGCCCTGGAGGAGGTGG - Intronic
1056905628 9:90645344-90645366 CAGAATCGCCTTGGAGGAGGGGG + Intergenic
1057300631 9:93879815-93879837 CGGAGTGGGCGCGGAGGTCGAGG - Intergenic
1059450819 9:114370525-114370547 GGGAGTGGCGGTGGGGGTGGGGG + Intronic
1060295008 9:122337465-122337487 GAGAGGGGCCTTGGAGGAGGGGG + Intergenic
1060429140 9:123533847-123533869 CACAGTGGCCGTGGAGGAGAGGG - Intronic
1060736036 9:126067065-126067087 GGGAGTGGGCATGGAGGCGGGGG + Intergenic
1061045428 9:128162440-128162462 TGGAGTGGCCGTGGAGGGGAGGG + Intronic
1061299250 9:129695276-129695298 AGGAGAGGCCATGGAGGAGAAGG + Intronic
1061539716 9:131271631-131271653 CAGACTGGGCGGGGAGGAGGGGG - Intronic
1061867131 9:133498246-133498268 GTGAGGGGCTGTGGAGGAGGTGG + Intergenic
1061903148 9:133683272-133683294 TGGAGTGGCCGTGCGGGTGGGGG + Intronic
1203524004 Un_GL000213v1:68937-68959 CGGGGTGGGGGTGGAGGTGGGGG - Intergenic
1203470165 Un_GL000220v1:112636-112658 CGGTGTGGTGGTGGGGGAGGAGG + Intergenic
1203477986 Un_GL000220v1:156608-156630 CGGTGTGGTGGTGGGGGAGGAGG + Intergenic
1185450802 X:280274-280296 AGGGGAGGCCGTGCAGGAGGAGG + Intronic
1185450865 X:280434-280456 AGGGGAGGCCGTGCAGGAGGAGG + Intronic
1186066903 X:5776175-5776197 CAGAGGGGCCTTGGAGGAGTGGG + Intergenic
1187243176 X:17531567-17531589 AGCAGTGGCAGAGGAGGAGGGGG - Intronic
1189445494 X:41076925-41076947 CGGAGCAGCCTTGGAGCAGGAGG + Intergenic
1189658986 X:43277878-43277900 CGGAGGGGCGGGGAAGGAGGGGG + Intergenic
1189659277 X:43279440-43279462 CACAGTGCCCATGGAGGAGGAGG + Intergenic
1190727431 X:53198779-53198801 GCGAGTGGCCCTGGAGGTGGAGG - Exonic
1190775305 X:53547797-53547819 GGGTGTGGGCGTGGTGGAGGCGG + Exonic
1195328180 X:103775057-103775079 CGGAATGGCCCTGGAGAAGGGGG - Intronic
1195333847 X:103830779-103830801 GGGAGTGGAGGTGGGGGAGGAGG + Intronic
1198369265 X:135974391-135974413 CCGAGGGGGCGGGGAGGAGGTGG + Intergenic
1198369297 X:135974464-135974486 CCGAGGGGGCGGGGAGGAGGTGG + Intergenic
1198932228 X:141873410-141873432 TGGGGTGGTGGTGGAGGAGGTGG - Intronic
1199091203 X:143694708-143694730 CTGTGTGGTGGTGGAGGAGGAGG - Intergenic
1200017700 X:153179177-153179199 GGGAGTGGGCGTGGGGGTGGGGG - Intergenic
1200098323 X:153674414-153674436 CAGTGTGGCCGGGGAAGAGGTGG - Intronic
1201403810 Y:13630880-13630902 CATAGTGGCCATGGATGAGGGGG - Intergenic
1201555782 Y:15263790-15263812 CATAGTGGACATGGAGGAGGGGG - Intergenic
1201964353 Y:19715630-19715652 GCGAGTGGCCTTGGAGGTGGAGG - Exonic