ID: 1174257786

View in Genome Browser
Species Human (GRCh38)
Location 20:49271132-49271154
Sequence TGCCTGCCTGCTTATGTGGT AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 173
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 153}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174257786_1174257788 -6 Left 1174257786 20:49271132-49271154 CCTACCACATAAGCAGGCAGGCA 0: 1
1: 0
2: 1
3: 18
4: 153
Right 1174257788 20:49271149-49271171 CAGGCAGACTTTGAGAAATTTGG 0: 1
1: 0
2: 2
3: 21
4: 182
1174257786_1174257789 20 Left 1174257786 20:49271132-49271154 CCTACCACATAAGCAGGCAGGCA 0: 1
1: 0
2: 1
3: 18
4: 153
Right 1174257789 20:49271175-49271197 TTTTCAATATGCCCAGTACATGG 0: 1
1: 0
2: 0
3: 9
4: 185

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174257786 Original CRISPR TGCCTGCCTGCTTATGTGGT AGG (reversed) Exonic
901145814 1:7064028-7064050 TGGCTGCCTTCTCATATGGTGGG + Intronic
902240848 1:15088386-15088408 TGCATGCGTGCATATGTGTTGGG + Intronic
902513402 1:16978009-16978031 TGCCTGCCTGCTGCTGTGGAAGG + Intronic
902579899 1:17401779-17401801 TGCTGGCCTGCTTGTGTGGGGGG + Intergenic
903523106 1:23969926-23969948 TGCCTGCCTCTTTATGAGGGAGG - Intronic
910209213 1:84776425-84776447 TGTCTGCCTGCCCATCTGGTTGG + Intergenic
911488129 1:98527791-98527813 TGAATACCTGCTTTTGTGGTGGG + Intergenic
918988465 1:191664597-191664619 TATCTGCCTGGTTATGTGCTAGG + Intergenic
921491226 1:215778481-215778503 TGAATGCTTGCTTATGTGTTAGG + Intronic
921601281 1:217109463-217109485 TGTTTGCCTGCTTATGTTCTGGG + Intronic
922580095 1:226690726-226690748 TCCCTGCCTGCTTGTGAGGTAGG - Intronic
924098875 1:240583303-240583325 CGTCTGCATGTTTATGTGGTTGG - Intronic
1065345351 10:24742920-24742942 TGGCTGCCAGCTTCTGTGTTAGG - Intergenic
1067727593 10:48782433-48782455 TGACTGGCTGCTAGTGTGGTTGG + Intronic
1068694485 10:59951254-59951276 TGCCTGACTGCTTTTGAGCTAGG + Intergenic
1068981861 10:63071029-63071051 TGCCTACCTGCCCCTGTGGTGGG - Intergenic
1069556746 10:69403239-69403261 TGCCTGTCTCCTGAAGTGGTGGG - Intergenic
1071789397 10:88938419-88938441 TGCCTGCCTTCTAATGAGGAAGG + Intronic
1072015997 10:91347093-91347115 TGCCTTCCGTCTTCTGTGGTTGG - Intergenic
1074113210 10:110437255-110437277 TGCCTGCCTGCTTCAGAGGGTGG + Intergenic
1077497543 11:2893484-2893506 TGCCTGCCTGTTTACATGGCAGG - Intronic
1078515445 11:12018089-12018111 TGCCTTCCTGTGGATGTGGTTGG + Intergenic
1082802958 11:57427594-57427616 TGGCTTCCTGATTCTGTGGTTGG - Intergenic
1082957441 11:58885526-58885548 TGCCTACCTGTTTTGGTGGTTGG - Intronic
1082964093 11:58947950-58947972 TGCCTACCTGCTTTTGAGGCCGG - Exonic
1082967258 11:58979408-58979430 TGCCTACCTGCTTTTGAGGCTGG - Intronic
1082973041 11:59043592-59043614 TGCCTACCTGTTTTTGAGGTCGG - Intergenic
1082977435 11:59087156-59087178 TGCCTACCTGTTTTTGAGGTCGG - Intergenic
1085237311 11:75025142-75025164 TGCCTGCCTGCTCTTCTAGTGGG - Intergenic
1085302403 11:75466282-75466304 TGCCTGCCTCCCTCTGTGCTGGG - Intronic
1085773699 11:79347173-79347195 GGCCTGCATGTTTATTTGGTGGG - Intronic
1085803561 11:79613615-79613637 TGCCTGACTGCCTTTGAGGTGGG - Intergenic
1087020801 11:93601132-93601154 TGCTAAACTGCTTATGTGGTGGG - Intergenic
1088481278 11:110298046-110298068 TGCCTGCAACCTGATGTGGTAGG - Intergenic
1089018870 11:115190464-115190486 TGACTGCCTACTTCTGTGGAGGG - Intronic
1092763617 12:11832178-11832200 TGTCAGCCTGCTGATGGGGTTGG + Intronic
1095652569 12:44629752-44629774 TGCAAGCCAGCTTCTGTGGTTGG - Intronic
1104039254 12:125118843-125118865 TGCCTGCCTTCTACCGTGGTCGG + Intronic
1105652163 13:22390937-22390959 TGCTTCCCTGCCTATGTTGTAGG - Intergenic
1109788403 13:67213466-67213488 TCCATGTCTGCCTATGTGGTGGG + Intronic
1110596463 13:77326221-77326243 TGTCTGCCTGCCTATGTGGGGGG - Intronic
1113523404 13:110955949-110955971 TGCCTGCCTGCGTGTTTGATGGG - Intergenic
1113630017 13:111875935-111875957 TGCCTTCCTGCTTTTGAGCTTGG + Intergenic
1113701900 13:112394547-112394569 TGCCTGCCTGCGTGTTTGATGGG + Intronic
1115712134 14:36062177-36062199 TGCCTTCCTGCATGTGTGGAGGG + Intergenic
1117625356 14:57631552-57631574 TGCCTGCCTCGTTATGAGGGAGG + Intronic
1118760610 14:68878511-68878533 TGCCTGTCTTCTTCTGTGGGGGG + Exonic
1122179312 14:99943924-99943946 TCCCTGACTGCTTCTCTGGTGGG + Intergenic
1125521258 15:40348957-40348979 TGCCTGACTGCTGCTGTAGTGGG + Intergenic
1128470275 15:67945996-67946018 GGCCTGCATGCATATGTGGGTGG + Intergenic
1128565443 15:68697945-68697967 TCCCTGCCTGCTGAGGTGCTGGG + Intronic
1134123967 16:11603665-11603687 TGCATGCCTGCTGAGGTGGCCGG - Intronic
1135472890 16:22747629-22747651 TGCTTGCTTGCTTGTTTGGTTGG - Intergenic
1139716324 16:68816260-68816282 TGCCTGCCTCCTAAAGTGCTGGG + Intronic
1143598585 17:7929849-7929871 TGCCTGCATGCTGATGAGCTGGG - Intronic
1145264207 17:21371762-21371784 TGCCTGCCTCCTGATGGGGCAGG + Intergenic
1146280977 17:31544307-31544329 TACCTTCCTGATTCTGTGGTAGG + Intergenic
1147168575 17:38605632-38605654 TGCCTCCATGCTTAAGTGGAAGG - Intronic
1153968510 18:10203427-10203449 TGCCTGCCTGATTATCTGGATGG - Intergenic
1155560306 18:27068984-27069006 TGCCTGCCATTTTATGTGTTTGG + Intronic
1156111393 18:33731640-33731662 TGGCTGGCTTCTTATGTAGTTGG - Intronic
1160335207 18:78032705-78032727 CGCCTGCCTGATTATGAGGCGGG + Intergenic
1160990426 19:1858103-1858125 TGCCTGCCTGCGTGTTTGGCGGG - Intronic
1162645701 19:12048581-12048603 TGCCTGCCTCCTAAAGTGCTGGG - Intronic
1162776862 19:12985006-12985028 TGCCTGGCTGCTTGTGTGGACGG + Intergenic
1164541909 19:29127875-29127897 TGCCTGCCTGGTGTTGTGGTGGG - Intergenic
925131040 2:1494284-1494306 TGCCTGCTTGCTCGTGTGGTTGG - Intronic
925731972 2:6925547-6925569 TTCCTGCCTGCTTCTGTCCTTGG - Intronic
926594102 2:14771255-14771277 TGGCTGCCTGCTGAGGTGGATGG + Intergenic
928700281 2:33891955-33891977 TGCCTGCCTTCCCAGGTGGTTGG + Intergenic
929325907 2:40610332-40610354 TTGCAGCCTGGTTATGTGGTAGG - Intronic
933036792 2:77410293-77410315 TGGCTCCCTACTCATGTGGTTGG - Intronic
936147712 2:109992224-109992246 TGCTTGCTTGCTTGTTTGGTTGG - Intergenic
936196980 2:110379217-110379239 TGCTTGCTTGCTTGTTTGGTTGG + Intergenic
936984760 2:118298343-118298365 TGCCTGGCTGCTTAGGATGTTGG + Intergenic
942095391 2:172532381-172532403 TGCCTGCCTCCCAATGTGCTGGG - Intergenic
942923680 2:181407696-181407718 AGCCTGCCTTATTATGTGGTTGG - Intergenic
946112880 2:217435761-217435783 TGCCATCCTGCTCATGTGATGGG + Intronic
948673835 2:239585344-239585366 TCCTTGCCTGCTTCTGTGGGGGG - Exonic
1174257786 20:49271132-49271154 TGCCTGCCTGCTTATGTGGTAGG - Exonic
1176290576 21:5042389-5042411 TCCCTGCCTGCTTACCTGGCCGG - Intergenic
1178470984 21:32892527-32892549 TACCTGAATGCTGATGTGGTAGG + Intergenic
1178508852 21:33185328-33185350 GGCCTGCTTGCTCATGTGGCTGG - Intergenic
1179866679 21:44221252-44221274 TCCCTGCCTGCTTACCTGGCCGG + Intergenic
1181166717 22:20987850-20987872 TGCCTGTCTGCCTCTGTGCTGGG - Intronic
1182990389 22:34762002-34762024 GCCCAGCCTGCTTATGAGGTTGG + Intergenic
1183078634 22:35442253-35442275 TGCCTGCCTGCTTGCGTGGTGGG + Intergenic
1183102370 22:35591872-35591894 AGCCTGCCTGTGTGTGTGGTAGG + Intergenic
1183415747 22:37680941-37680963 TGCCAGCCCGTTTCTGTGGTAGG + Intergenic
950490167 3:13299756-13299778 TGCCAGCCTGCCCATGTGGCGGG - Intergenic
950805887 3:15602815-15602837 TGCCTCCCTGCATATGTGGACGG + Intronic
950858402 3:16126574-16126596 TGGCTGACTGCCCATGTGGTGGG + Intergenic
952983363 3:38756267-38756289 TGGCTGCCTGCTTCTGGGATAGG + Intronic
952998254 3:38906154-38906176 TGTATGCCTGATAATGTGGTGGG - Intronic
954039070 3:47870714-47870736 TGACTGCCTGCTTCTTTGGTGGG + Intronic
955549898 3:60072503-60072525 TGCATGCTTACTTATGTGCTGGG + Intronic
958638419 3:96775813-96775835 TGCCTGCTTTCTAATGTGTTTGG - Intergenic
960846214 3:122006624-122006646 TGCCTGCATTCTAAGGTGGTGGG + Intronic
961066461 3:123881121-123881143 TGTCTGCCTGCTTGTAAGGTAGG + Intronic
961361561 3:126371258-126371280 TGCCTCCATGCTTGTCTGGTTGG - Intergenic
964502408 3:157362985-157363007 TTCTTGCATGATTATGTGGTTGG + Intronic
967918806 3:194599240-194599262 TGCCTGCCACCCTATGCGGTGGG + Intronic
968548695 4:1211532-1211554 TGCCGTCCTGCTGATGTGGTAGG - Exonic
969319784 4:6404737-6404759 TGCCTCCCTGCTTTTGTGCTTGG - Intronic
969680625 4:8641406-8641428 TTCCCGCCTGGTGATGTGGTTGG + Intergenic
970089625 4:12389784-12389806 TTCCTGCCTGCTTATATTCTAGG + Intergenic
971153480 4:24058508-24058530 TGGCTGCCTGGGTATGTGGTGGG - Intergenic
971761738 4:30774522-30774544 TGAGTGCCTGCTAATGTGCTAGG + Intronic
975468925 4:74742313-74742335 TGCCTGTTTGCTAATGTCGTTGG - Intergenic
975791459 4:77957106-77957128 TGCCTGCTTCTTTATGTGGGAGG - Intergenic
976330876 4:83829808-83829830 TGCCCGCCTGGTATTGTGGTGGG - Intergenic
976541404 4:86281252-86281274 TGCCTGCCTCCTAAAGTGCTGGG - Intronic
977554679 4:98476933-98476955 TGTCTGTGTGATTATGTGGTCGG - Intronic
977780067 4:100970590-100970612 TGCCTGCCAGCAACTGTGGTAGG - Intergenic
978649048 4:110978412-110978434 TGCCTGCCTGCTCCTCTAGTGGG + Intergenic
983690722 4:170465673-170465695 TGCCTGCCTGCTCCTGTGAGAGG + Intergenic
984683621 4:182640680-182640702 TGCCAGCCTGCTTCTGTATTTGG - Intronic
985689651 5:1300059-1300081 TGCCTGCCTGCTTCCCTGGGTGG - Intergenic
987706027 5:21462835-21462857 TGCCTGCCTCCTAAAGTGCTGGG + Intergenic
988429686 5:31105032-31105054 TGCCTGCTTGCTTATTGGATTGG - Intergenic
988857572 5:35244308-35244330 TGCCAGCATGGTTATGTTGTAGG + Intergenic
989057918 5:37382652-37382674 TGCCTGCCTCCTAAAGTGCTGGG + Intronic
993424327 5:87743752-87743774 TGCATGCCAGCCTAAGTGGTTGG + Intergenic
994781827 5:104098867-104098889 TGCCTTTCTGCTTATCTGGCCGG + Intergenic
995275072 5:110268472-110268494 TGTCTGCCTGCTTTTGTTGTTGG + Intergenic
995527122 5:113059010-113059032 TGCCTGCCTGCGTTCGTGTTAGG - Intronic
1001877174 5:175211597-175211619 TTCCTTCCTGCTTAGGTTGTTGG - Intergenic
1001877879 5:175216817-175216839 TGCCTCCCTGCCTGTCTGGTGGG - Intergenic
1002109184 5:176896655-176896677 AGCCTGCCTGCTTCTCTGGCAGG - Intronic
1003552947 6:7115178-7115200 TGGCTGCCAGCTGCTGTGGTTGG + Intronic
1003668728 6:8135608-8135630 TGCAATCCTGCTTATTTGGTAGG + Intergenic
1009022259 6:57958044-57958066 TGCCTGCCTCCTAAAGTGCTGGG - Intergenic
1009778281 6:68234710-68234732 TGCCTGCTTGCTTGTTTGCTTGG - Intergenic
1011696505 6:89918039-89918061 TGCCTGGCTGCCTCTGTGCTGGG + Intergenic
1012053378 6:94372380-94372402 TGCTTGCTTGCTTGTGTGCTTGG - Intergenic
1015354224 6:132258164-132258186 CTCATGACTGCTTATGTGGTAGG - Intergenic
1015688755 6:135896534-135896556 TGTATGCCTGCTCATGTGTTAGG + Intronic
1018338447 6:162822337-162822359 GGCAAGCCTGCTTACGTGGTTGG - Intronic
1022042732 7:26595815-26595837 TTCCTGCCTGCCTATGTCCTGGG - Intergenic
1022238802 7:28489199-28489221 CTCCTGCCTGTTTATGTGGTGGG + Intronic
1023866175 7:44239406-44239428 TGCCTCCCTGCCCTTGTGGTGGG + Intronic
1024200810 7:47103956-47103978 TGCCTGCAGGGTTGTGTGGTGGG + Intergenic
1024245683 7:47468193-47468215 TGCCTGCCTCCTAAAGTGCTGGG - Intronic
1027391578 7:77709219-77709241 TGTCTGCCTGCCTGTGTGGAGGG + Intronic
1028751919 7:94392217-94392239 TCCCTCCCTGCTGATGTGGCAGG - Intergenic
1029026979 7:97427161-97427183 TGCCTGGCTCCGTATGTGGGGGG - Intergenic
1030271953 7:107678028-107678050 TGCATGCCTCCTAATGTGTTGGG + Intronic
1031118183 7:117690919-117690941 TGCCTGCCTCCCAATGTGCTGGG - Intronic
1032113879 7:129100703-129100725 TGCTTCCCTGCTCAGGTGGTTGG - Intergenic
1032177470 7:129643296-129643318 TGCCTGGCTGCTTCAGTGGCGGG - Intronic
1034695108 7:153046386-153046408 TGCCTGCCTGCTTTTGAGCTGGG + Intergenic
1037752725 8:21693081-21693103 TGCCTGCCTGCTTGTCTGTTTGG + Exonic
1038187700 8:25290755-25290777 TGCCTCCCTGCTTAGCTGGTAGG - Intronic
1038565966 8:28620264-28620286 GCCCTGCCTGCTGAGGTGGTGGG - Intronic
1043466246 8:80510292-80510314 TGATTGCCTGCTTATGTGCCAGG + Intronic
1043697605 8:83240339-83240361 TGCCCTCCTGCTGATGGGGTGGG + Intergenic
1050846345 9:10225574-10225596 GTGCTGCCTGCTTATTTGGTTGG + Intronic
1053105914 9:35407481-35407503 TGCCTGTCTGCTTCTGGGCTTGG - Intergenic
1053143484 9:35696688-35696710 AGCCACCCTGCTTATCTGGTGGG - Intergenic
1056033985 9:82584443-82584465 TTCCTGCCTCCTATTGTGGTAGG - Intergenic
1056446903 9:86675210-86675232 AGCCAGCATGCTTAAGTGGTGGG - Intergenic
1057834208 9:98431065-98431087 TGGCTGGCTGCTTATCTGCTTGG + Intronic
1057846497 9:98530305-98530327 CACCTCCCTGCTTCTGTGGTAGG + Intronic
1061639129 9:131937542-131937564 TGCCTGCCTTCTCAGGTGGAAGG + Intronic
1061653187 9:132067661-132067683 TGCTTGCTTGCTTTTTTGGTTGG - Intronic
1187040287 X:15587752-15587774 TGCCTCCCTGCTCATTTGCTTGG - Exonic
1187917328 X:24166942-24166964 TGCCTCCCTGCTTTTGATGTTGG - Intronic
1188439408 X:30200557-30200579 TGTCTGCCTGCTTTTGTTTTAGG - Intergenic
1192177980 X:68897760-68897782 TGGCTGCCTGCTTAGCTGCTGGG - Intergenic
1192506231 X:71685328-71685350 GGCCTGCCTGGTGATGAGGTGGG + Intergenic
1192520466 X:71796220-71796242 GGCCTGCCTGGTGATGAGGTGGG - Intergenic
1192524301 X:71828348-71828370 GGCCTGCCTGGTGATGAGGTGGG + Intergenic
1197156253 X:123273153-123273175 TGCCATCGGGCTTATGTGGTGGG - Intronic