ID: 1174266853

View in Genome Browser
Species Human (GRCh38)
Location 20:49338169-49338191
Sequence CAGGAAGGACTGGCGGAGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174266840_1174266853 27 Left 1174266840 20:49338119-49338141 CCAGGCTGGCAGAGCAGGTGACG No data
Right 1174266853 20:49338169-49338191 CAGGAAGGACTGGCGGAGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174266853 Original CRISPR CAGGAAGGACTGGCGGAGCA GGG Intergenic
No off target data available for this crispr