ID: 1174270835

View in Genome Browser
Species Human (GRCh38)
Location 20:49367224-49367246
Sequence GAGATGTCCTCCGCCCACCC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 138
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 128}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174270832_1174270835 30 Left 1174270832 20:49367171-49367193 CCTGCATGAGTTGACGGATGGAG 0: 1
1: 0
2: 0
3: 7
4: 61
Right 1174270835 20:49367224-49367246 GAGATGTCCTCCGCCCACCCAGG 0: 1
1: 0
2: 1
3: 8
4: 128

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174270835 Original CRISPR GAGATGTCCTCCGCCCACCC AGG Exonic
900411097 1:2513074-2513096 GACGTGGCCTCAGCCCACCCTGG + Intronic
901788159 1:11638255-11638277 AAAATGTCCCCCGCCCTCCCAGG - Intergenic
904722448 1:32520896-32520918 GACATGTGATCCGCCCACCTCGG + Intronic
906532941 1:46533733-46533755 AAGATGACCTCTGCCCACCCAGG - Intergenic
912601006 1:110933510-110933532 GAGATGCCCTCCACACAACCTGG - Intergenic
919799215 1:201342975-201342997 GAGCTGTCCACAGCCCAGCCAGG - Intergenic
920531746 1:206707211-206707233 GGGAAGTCCTGCTCCCACCCTGG - Intronic
923085875 1:230703401-230703423 CAGAGGTCCTGAGCCCACCCCGG - Intronic
923282022 1:232452497-232452519 AAGATGGCATCCACCCACCCAGG + Intronic
923750813 1:236744784-236744806 CAGATGCCCTCCGTCCTCCCGGG + Intronic
1067042614 10:42962973-42962995 GAGGAGTCCACCGCCCAGCCTGG + Intergenic
1069623238 10:69850791-69850813 GTGATGGCCTCAGCCCACCCAGG + Intronic
1071528619 10:86372854-86372876 CATATGTCCTCTGCCCTCCCAGG + Intergenic
1075013056 10:118891356-118891378 AGGATGGCCTCTGCCCACCCAGG - Intergenic
1075392023 10:122099051-122099073 GAGATGTGCTCAGCACAGCCAGG - Intronic
1076814032 10:132905831-132905853 GAGATGCCTGCCACCCACCCTGG - Intronic
1076843980 10:133060160-133060182 GAGGGGTCCTCCTGCCACCCAGG - Intergenic
1077489500 11:2853969-2853991 GAGCTGTGCTCAGACCACCCTGG - Intergenic
1078414689 11:11155855-11155877 GAGGTGTCCTCTGCCCAGGCTGG + Intergenic
1081673947 11:44957444-44957466 GCGCAGACCTCCGCCCACCCGGG + Intergenic
1084575187 11:69984622-69984644 GAGCTGTCCTCCTCCCCACCAGG - Intergenic
1088116840 11:106321929-106321951 GAGATGTCCCATGACCACCCTGG + Intergenic
1091567774 12:1661488-1661510 TCCCTGTCCTCCGCCCACCCTGG + Intergenic
1091993606 12:4975755-4975777 GAGAAGGACTCCGCCCAGCCTGG - Intergenic
1097806162 12:63967205-63967227 GAGAAGTGATCCTCCCACCCTGG - Intronic
1098361162 12:69655615-69655637 GAGATGACCTCAGCCCAGCCAGG - Exonic
1101469873 12:104986385-104986407 GAGTTGTTCGTCGCCCACCCGGG + Exonic
1102321918 12:111943270-111943292 GAGATGTGCTCTGTCCACTCTGG + Exonic
1102531927 12:113553099-113553121 GAGAGGTCCTGTCCCCACCCTGG + Intergenic
1112182973 13:97103499-97103521 GAGATGTCAGCTACCCACCCTGG - Intergenic
1112268669 13:97948876-97948898 GAAATGTCCTAGGCCCAGCCTGG + Intergenic
1112332519 13:98487462-98487484 GAGAAGTCTCCCTCCCACCCTGG + Intronic
1112413161 13:99180847-99180869 AAGCTGTCCTCCGACCACCTTGG - Intergenic
1112572810 13:100608958-100608980 GAAATGACCTCCGCCCACCCAGG - Intronic
1119039732 14:71262531-71262553 CAGAGGTCCTTCTCCCACCCAGG + Intergenic
1123103032 14:105818631-105818653 GAGATGTCTTCCCGCCTCCCAGG + Intergenic
1124925128 15:34063479-34063501 GCGCTGTCCTCGACCCACCCTGG + Exonic
1127863070 15:63010542-63010564 GTGCTGTCCTCCCCACACCCAGG - Intergenic
1129230829 15:74196384-74196406 GACTGCTCCTCCGCCCACCCTGG + Intronic
1132728432 16:1348802-1348824 CAGCTGCCCACCGCCCACCCAGG - Exonic
1133361914 16:5180817-5180839 GAGCTGTCCTCTGACCACCTTGG + Intergenic
1134021161 16:10922505-10922527 GAGTTGTTCTCCACCCACCAGGG - Intronic
1140213024 16:72985778-72985800 GAGCAGTCTTCCGCCCAACCAGG + Intronic
1141732637 16:85833289-85833311 GAGATATTCTCAGCTCACCCTGG + Intergenic
1142533939 17:600367-600389 GGCATGTCCTCCACCCACACAGG - Intronic
1148345197 17:46898449-46898471 CAGCTGTTCTCTGCCCACCCTGG + Intergenic
1148979727 17:51562163-51562185 GACATTTCCTCTCCCCACCCAGG + Intergenic
1149663846 17:58352251-58352273 GAGCTGGCGTCCGCCCACACCGG - Intronic
1151963704 17:77420396-77420418 GTCATGTCCTCTGGCCACCCTGG + Intronic
1152149312 17:78589091-78589113 GAGTTTGCCTCCGCCCACACAGG + Intergenic
1152354059 17:79798140-79798162 CAGATGCCCTTAGCCCACCCAGG - Intronic
1152541711 17:80979956-80979978 GAGATGACATCGGCCGACCCAGG - Intergenic
1152678379 17:81653243-81653265 GACAGGTCCCCCGGCCACCCTGG + Exonic
1157326029 18:46669320-46669342 GAGATGTCCATCACCCACCATGG + Intronic
1157329891 18:46696176-46696198 CAGCTTTCCTCCTCCCACCCTGG + Intronic
1157529678 18:48409992-48410014 GAGATGGGCTCTGCCGACCCGGG + Intronic
1160469643 18:79117547-79117569 TGGATGACCTCCTCCCACCCTGG - Intronic
1161075268 19:2282230-2282252 GAAATGTCCCCTCCCCACCCCGG - Intronic
1161152700 19:2717938-2717960 GCCATGTCCTCCTCCCTCCCCGG - Intronic
1162375011 19:10299759-10299781 GAGAGGGCCTCCACCCACCCTGG - Intergenic
1164522739 19:28991250-28991272 GAGCTGTCCTGCCACCACCCAGG - Intergenic
1165329881 19:35135446-35135468 GGGATGTCCCCAGCCCCCCCAGG - Intronic
1165399036 19:35586016-35586038 GAAGTGGGCTCCGCCCACCCTGG - Intergenic
1165897889 19:39154486-39154508 AGGATGTCCTCCTTCCACCCTGG - Intronic
1166196246 19:41207628-41207650 AACATGGCCACCGCCCACCCTGG + Intergenic
1166678312 19:44753157-44753179 GAGATGGCCTGCAACCACCCTGG - Intronic
1167350223 19:48969637-48969659 GTGAGGTCCTCAGCTCACCCTGG - Intronic
1167593554 19:50416558-50416580 GTGATCTCCTCTGCCCCCCCAGG - Intronic
1167705310 19:51078121-51078143 GAGCTGTCCTCTGCACACCAGGG + Exonic
926225073 2:10961455-10961477 GAGGCGTCCTCGGCCCAGCCGGG - Intergenic
928944872 2:36763160-36763182 GAGAATTCCACGGCCCACCCTGG + Intronic
929317541 2:40497916-40497938 GAGATATCCTACCTCCACCCTGG - Intronic
929841010 2:45463016-45463038 GAGATTTCCCCCCCCCCCCCCGG - Intronic
935595390 2:104873679-104873701 AGGATCTCCTCCGCCCATCCTGG - Intergenic
938340034 2:130529711-130529733 GAGATGCCCTCCCTCCATCCGGG - Intergenic
938349801 2:130591037-130591059 GAGATGCCCTCCCTCCATCCGGG + Intergenic
938383206 2:130848116-130848138 CAGATGGCCTGCTCCCACCCTGG - Intronic
946170801 2:217894251-217894273 GAGAAGTCCATCACCCACCCAGG + Intronic
948870619 2:240796095-240796117 CAGGCGTCCTCTGCCCACCCCGG + Intronic
1168877414 20:1181110-1181132 GAGATGTACTACGCCCGCCTAGG - Exonic
1169191324 20:3660678-3660700 GCGAAGTCATCGGCCCACCCGGG + Intronic
1170626845 20:18036686-18036708 AAGATGTCCTCTGCCCACAGAGG - Intronic
1171486544 20:25490145-25490167 GGGATGTCCCCCACCCTCCCAGG + Intronic
1172952848 20:38733041-38733063 GAGATGAGCTCTGCCCCCCCGGG + Intergenic
1174270835 20:49367224-49367246 GAGATGTCCTCCGCCCACCCAGG + Exonic
1174485968 20:50861482-50861504 GAGATGGCCTCCGTCCAGCACGG + Intronic
1175159019 20:56994326-56994348 CAGCTGTCTTCCACCCACCCAGG + Intergenic
1175405361 20:58722596-58722618 GAGATGGCCCCTGCCCTCCCAGG + Intergenic
1176105655 20:63384647-63384669 GGGATCTCCTCTGCACACCCTGG + Intergenic
1178183463 21:30191602-30191624 AAGCTGTCCTCCGACCACCTCGG - Intergenic
1178194614 21:30329453-30329475 GAGATGTCCTCTGCTAAGCCAGG - Intergenic
1183177972 22:36238171-36238193 TGGATGCCCTCCGCCCTCCCTGG + Intronic
1184430501 22:44439383-44439405 GAGAAGTCCTCAGCCTGCCCAGG + Intergenic
1184919960 22:47599158-47599180 GAGAGGTCTTCAGCCCAACCTGG + Intergenic
1184946254 22:47806254-47806276 GGGATCTCCTTCGCACACCCGGG + Intergenic
1185279120 22:49962397-49962419 GCGCTGTCCCCCCCCCACCCAGG + Intronic
1185279417 22:49963599-49963621 GAGGTGCCCTCGGCCCACCGGGG + Exonic
950018053 3:9768161-9768183 GTGATGTCCCCGCCCCACCCTGG + Intronic
950264374 3:11563372-11563394 GAAAGGTCCACTGCCCACCCCGG + Intronic
954692009 3:52400659-52400681 GAGATGCCCAGCGCCCTCCCAGG + Intergenic
960638889 3:119809269-119809291 AAGATCTCCTCCTCCCAGCCCGG - Intronic
962240841 3:133749566-133749588 GAGATGGTCTCTGACCACCCAGG - Intronic
962905227 3:139795224-139795246 GGTGTGTCCTCTGCCCACCCAGG - Intergenic
967753338 3:193140317-193140339 CAGATGCCCTGCTCCCACCCCGG - Intergenic
968799523 4:2733069-2733091 GGGATGTCCACCGGCCACCCAGG + Intergenic
969891645 4:10265240-10265262 GAGATGACCTCGGCTCATCCTGG + Intergenic
976409492 4:84696774-84696796 GAGATGTTATCCTTCCACCCTGG - Exonic
983073361 4:163295295-163295317 TTGATGTACTCCGCCTACCCCGG + Intergenic
984710281 4:182879024-182879046 GAGCTGTCCTGCCGCCACCCAGG + Intergenic
997716426 5:136046498-136046520 GAGATGACCTCCGTCTGCCCGGG + Intronic
998175808 5:139901370-139901392 GAGCTGTCCTCCTGCCACTCTGG - Intronic
998669268 5:144335356-144335378 CAGCTGTCCTCCACCCATCCTGG - Intronic
1004154864 6:13158655-13158677 GAGATGTCCTGGTCCCACCCCGG + Intronic
1004901783 6:20201059-20201081 GAGCTGTCCTGCTGCCACCCAGG + Intronic
1006674759 6:35754540-35754562 GAGATACCCTCTCCCCACCCAGG + Intergenic
1007374038 6:41444143-41444165 TAAATGTCCTCTGCCCTCCCTGG - Intergenic
1007884660 6:45212849-45212871 GTGATGTCCTTCCCCCACCATGG + Intronic
1012910233 6:105109660-105109682 AAGATGTCCTCCCGCCTCCCAGG - Intronic
1016030527 6:139332834-139332856 GAGCTCACCTCCACCCACCCAGG - Intergenic
1020624120 7:10557553-10557575 GAGCTGACGTCCGCCCACCGCGG + Intergenic
1022467724 7:30662647-30662669 GAGAAGTCCTCCCCCCAACTAGG + Intronic
1024273362 7:47658828-47658850 GATATATCCTCCACCCACCATGG - Intronic
1032193138 7:129775704-129775726 GAGAAGTCCTGCAGCCACCCAGG + Intergenic
1033568670 7:142605405-142605427 CAAATGTCCACTGCCCACCCAGG + Intergenic
1035609218 8:948988-949010 GACAGGTCCTGCTCCCACCCCGG - Intergenic
1041645806 8:60251243-60251265 GAGACGTCCTTCTCCCACCTAGG - Intronic
1042098707 8:65248766-65248788 CAGATGGCCTCTGACCACCCGGG - Intergenic
1042747851 8:72127004-72127026 GAGGTCTCCCCCACCCACCCAGG + Intergenic
1059403461 9:114085375-114085397 GAGATGTCCTGCCTCCACCCAGG + Intergenic
1059456362 9:114402630-114402652 GGGATGTCTTCCTGCCACCCTGG + Exonic
1061285515 9:129620347-129620369 GAGGCGTCCGACGCCCACCCCGG + Exonic
1062364560 9:136202684-136202706 GAGGTCTCCTAAGCCCACCCTGG + Intronic
1185450573 X:278822-278844 AAGATGTCCTCCGACCACCTAGG - Intronic
1195162634 X:102185475-102185497 GAGCTGTCCTGCTGCCACCCAGG - Intergenic
1195166695 X:102227083-102227105 GAGCTGTCCTGCTGCCACCCAGG - Intergenic
1195192165 X:102460005-102460027 GAGCTGTCCTGCTGCCACCCAGG + Intronic
1196089745 X:111726899-111726921 GAGACCCCCTCCTCCCACCCAGG + Exonic
1199191508 X:144977203-144977225 GAAATGTCCTCCGCTACCCCAGG - Intergenic