ID: 1174271311

View in Genome Browser
Species Human (GRCh38)
Location 20:49371373-49371395
Sequence GGCCAACAACACCATGCTGT TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 163
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 152}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174271310_1174271311 -6 Left 1174271310 20:49371356-49371378 CCACTGTACTGAGGAATGGCCAA 0: 1
1: 0
2: 2
3: 10
4: 177
Right 1174271311 20:49371373-49371395 GGCCAACAACACCATGCTGTTGG 0: 1
1: 0
2: 0
3: 10
4: 152
1174271308_1174271311 1 Left 1174271308 20:49371349-49371371 CCTAATGCCACTGTACTGAGGAA 0: 1
1: 0
2: 1
3: 17
4: 189
Right 1174271311 20:49371373-49371395 GGCCAACAACACCATGCTGTTGG 0: 1
1: 0
2: 0
3: 10
4: 152

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174271311 Original CRISPR GGCCAACAACACCATGCTGT TGG Exonic
901622266 1:10598049-10598071 GGGCAAATATACCATGCTGTGGG + Intronic
901892206 1:12276392-12276414 CTCCAACAACACAATGCTCTGGG - Exonic
903220247 1:21865344-21865366 GGGCAACAACATCATGCTAGTGG - Exonic
903461156 1:23521838-23521860 GGCCAAGAACAACATCCAGTGGG - Exonic
904479626 1:30785757-30785779 GGCCAGCAACACCCTCCTGCGGG - Intergenic
907319089 1:53591664-53591686 GGTCCTCAACACAATGCTGTGGG - Intronic
907982675 1:59499363-59499385 GTCCAGCAAATCCATGCTGTAGG - Intronic
908878521 1:68704510-68704532 TTCCAAAAACTCCATGCTGTAGG + Intergenic
911378834 1:97086844-97086866 GACCCAGAACAGCATGCTGTGGG + Intronic
912658057 1:111505293-111505315 GTCCAAACACAGCATGCTGTAGG + Intronic
914097026 1:144552768-144552790 GGCAAACAACACTTTGCTATTGG - Intergenic
914266214 1:146040442-146040464 GGCAAACAACTCCAGGCTTTCGG - Intergenic
914301966 1:146384842-146384864 GGCAAACAACACTTTGCTATTGG + Intergenic
918316940 1:183330381-183330403 GGCCCTCAACACCAGGCTCTGGG + Intronic
919184125 1:194121763-194121785 AGACATCAACACCATGCTCTTGG - Intergenic
920442785 1:205992507-205992529 CCCCAACAACACCATGGGGTAGG + Exonic
921942195 1:220853730-220853752 GTTCAGCAGCACCATGCTGTAGG - Intergenic
923318784 1:232807399-232807421 TGTCAACAACAGCATCCTGTTGG - Exonic
923724916 1:236497395-236497417 GGTGCACAGCACCATGCTGTGGG - Intergenic
1069804693 10:71112980-71113002 GTTCAGCAGCACCATGCTGTAGG - Intergenic
1070040357 10:72772204-72772226 GTTCAGCAGCACCATGCTGTAGG + Intronic
1070358505 10:75663818-75663840 TTCCTATAACACCATGCTGTTGG - Intronic
1074760493 10:116663954-116663976 GGCCAAGTATACCATGCAGTGGG - Exonic
1075736613 10:124668314-124668336 GGCTAGAAACACCCTGCTGTGGG - Intronic
1076909624 10:133380407-133380429 GGCCACCAGGTCCATGCTGTGGG - Exonic
1076926329 10:133490001-133490023 GTTCAGCAGCACCATGCTGTAGG - Intergenic
1077362191 11:2145670-2145692 GGGCCACTACACCCTGCTGTGGG - Intronic
1082162827 11:48902167-48902189 AGCCAGCAGCACCATGCTGGTGG + Intergenic
1082862079 11:57866566-57866588 GGCCACCAAGACCAAGCAGTAGG + Intergenic
1083799468 11:65038205-65038227 GGCCACCACCACCAGGCTGAGGG - Intronic
1083821182 11:65172307-65172329 GGCCAAGAACAGGCTGCTGTGGG - Exonic
1086560851 11:88167437-88167459 GGAGAACAACACCATGATGAGGG + Intronic
1090241006 11:125181808-125181830 GGCCAGTAACCCCATGCTATGGG + Intronic
1090416135 11:126541756-126541778 GGCCCACAAGCCCGTGCTGTGGG - Intronic
1092205718 12:6613373-6613395 GGCCACCACCACCCTGCTTTAGG + Intergenic
1095777632 12:46026740-46026762 GTTCAGCAGCACCATGCTGTAGG - Intergenic
1100353376 12:93806127-93806149 GGCCAACTACACCAGGCTCATGG - Intronic
1105415969 13:20211532-20211554 GGCCACCCCCACCATGGTGTTGG + Intergenic
1105431487 13:20341132-20341154 GGAAAACAGCACCAGGCTGTGGG - Intergenic
1106582827 13:31032408-31032430 CTCCAACAACACCATGTTGAAGG + Intergenic
1106774820 13:32998782-32998804 AGACAACACCACCATGCTGATGG - Intergenic
1108689382 13:52847786-52847808 GGCCACCAGCTCCAGGCTGTAGG + Exonic
1108727683 13:53200626-53200648 GGCCACCAGCTCCAGGCTGTCGG - Intergenic
1110090796 13:71445131-71445153 TGCAAACAACACCATGCTGAAGG - Intronic
1110712674 13:78666484-78666506 GGCCAAAAACCCCATGCTTCTGG - Intergenic
1112691911 13:101905945-101905967 TACCAACAACACCCTGTTGTTGG + Intronic
1113927852 13:113951292-113951314 GGCCAACAGCACCACCCCGTGGG - Intergenic
1122272506 14:100574486-100574508 GGCCAAATACAACATGCTGGTGG - Intronic
1124268821 15:28262244-28262266 GGCCATCAAAACTATGATGTTGG - Intronic
1130259919 15:82346748-82346770 GGGCAACAAGCCCCTGCTGTGGG + Intronic
1130268806 15:82432688-82432710 GGGCAACAAGCCCCTGCTGTGGG - Intronic
1130281310 15:82522261-82522283 GGGCAACAAGCCCCTGCTGTGGG - Intergenic
1130472685 15:84238444-84238466 GGGCAACAAGCCCCTGCTGTGGG - Intronic
1130480176 15:84353015-84353037 GGGCAACAAGCCCCTGCTGTGGG - Intergenic
1130484405 15:84390586-84390608 GGGCAACAAGCCCCTGCTGTGGG - Intergenic
1130491593 15:84435114-84435136 GGGCAACAAGCCCCTGCTGTGGG + Intergenic
1130503208 15:84514154-84514176 GGGCAACAAGCCCCTGCTGTGGG + Intergenic
1130594979 15:85243078-85243100 GGGCAACAAGCCCCTGCTGTGGG - Intergenic
1135736465 16:24935496-24935518 GGCCAACCTCACAATGCTGCAGG - Exonic
1138626496 16:58255997-58256019 AGCCAACAACGTCATCCTGTGGG - Intronic
1138711593 16:58976569-58976591 AGCCAACAAAATCAGGCTGTAGG + Intergenic
1142188882 16:88708154-88708176 TGCCAAGAACACCAGGCTGCCGG + Intronic
1142534028 17:601209-601231 AACCAAAAACACCATTCTGTAGG + Intronic
1144668119 17:17115827-17115849 GGCCACCAAGTCCATGGTGTTGG - Intronic
1145844402 17:28025446-28025468 GGCCAACAACCCCTGGTTGTAGG + Intergenic
1149636273 17:58172488-58172510 GTCCAGCAGCACCATGCTGTAGG + Intergenic
1152921761 17:83069391-83069413 TGCCCACCACCCCATGCTGTCGG + Intergenic
1155512492 18:26592425-26592447 GGCTACCATCACCAAGCTGTGGG + Intronic
1156971016 18:43156048-43156070 GACCACCATGACCATGCTGTCGG + Intergenic
1157073718 18:44440867-44440889 GGCCAACAACAACAAGCAATGGG + Intergenic
1159520777 18:69519047-69519069 AGCCAACTACAATATGCTGTTGG - Intronic
1160903630 19:1441458-1441480 GGCCCACAACAGCCTCCTGTGGG + Intergenic
1162062650 19:8106290-8106312 GGGCACCCACACCATGCTCTGGG + Intronic
1164726507 19:30469072-30469094 GGTCAACAGCACCATGTTGCAGG - Intronic
1165369628 19:35396615-35396637 GGTGACCAAAACCATGCTGTTGG - Intergenic
1168656956 19:58136882-58136904 AGCCAACAAGACCATTCTGAGGG - Intronic
925418675 2:3692707-3692729 GTTCAGCAACACCATGTTGTAGG - Intronic
927349705 2:22094684-22094706 GGGCCAAAACACCAGGCTGTGGG - Intergenic
929114934 2:38436045-38436067 GGGCAACAAAATCATGCTTTGGG + Intergenic
932451885 2:71816043-71816065 CTCCAACAGCACCATTCTGTTGG - Intergenic
936454495 2:112661847-112661869 GGCAAAGAACATAATGCTGTCGG - Intronic
941477870 2:165970774-165970796 GCTCACCAGCACCATGCTGTAGG + Intergenic
941589913 2:167406761-167406783 ACTCAGCAACACCATGCTGTCGG + Intergenic
948242742 2:236451662-236451684 GGCCAAGGACGCCACGCTGTGGG + Intronic
948739962 2:240039849-240039871 GTTCAGCAGCACCATGCTGTAGG - Intergenic
948889242 2:240898808-240898830 GCCACACAACACCATGCTCTTGG - Intergenic
1171508347 20:25658171-25658193 GTTCACCAGCACCATGCTGTAGG - Intergenic
1173227445 20:41170154-41170176 GGCCACCGACGCCATGCTGATGG - Exonic
1174271311 20:49371373-49371395 GGCCAACAACACCATGCTGTTGG + Exonic
1174353669 20:49984613-49984635 TGCAACCAACACCTTGCTGTGGG + Intronic
1176086770 20:63298971-63298993 GGCAAACTAGTCCATGCTGTTGG - Intronic
952884899 3:38006296-38006318 GCCCATCAGGACCATGCTGTCGG - Intronic
955395226 3:58552470-58552492 GTTCAGCAGCACCATGCTGTAGG - Intergenic
961567206 3:127772332-127772354 GGCTAACAATACCAGCCTGTGGG - Intronic
965988871 3:174791202-174791224 GGCAAACAGGACCATGCTGTGGG + Intronic
966456092 3:180117925-180117947 TGGCAGCCACACCATGCTGTGGG - Intergenic
967011588 3:185439894-185439916 GGCCCATTACACCATGCTCTTGG + Intronic
968205341 3:196794734-196794756 GTTCAGCAACACCATGTTGTAGG + Intronic
969473823 4:7409399-7409421 GTTCAGCAGCACCATGCTGTTGG - Intronic
971357398 4:25907445-25907467 GGGCAAGGGCACCATGCTGTGGG - Intronic
984647070 4:182231705-182231727 TGCCAACAACATCATGCTCTTGG + Intronic
985347861 4:189025741-189025763 GGACATTAACACCATGCTGTGGG + Intergenic
986665312 5:10097561-10097583 GTCCAACAACCTTATGCTGTGGG + Intergenic
986721627 5:10564460-10564482 GGCCAGCAGCACCATGCCGGCGG - Exonic
991597171 5:68317455-68317477 GGCAAACTACACCATACTGCTGG - Intergenic
995553124 5:113300016-113300038 GTGCACCAACACCATGCTGTGGG + Intronic
995714059 5:115064543-115064565 GGCCAACAAAAGCTTGCTGATGG - Intergenic
995827534 5:116317395-116317417 GTTCAACAGCAACATGCTGTAGG - Intronic
996899642 5:128529621-128529643 GGCAAAAAACACAATGCTGGAGG - Intronic
1000404343 5:160870837-160870859 GGGAAAAAACACCATACTGTAGG + Intergenic
1001097191 5:168784766-168784788 GGCCCACAAACCCATGCTGTGGG + Intronic
1001768073 5:174270499-174270521 AGACACCAACACCATGCTCTTGG - Intergenic
1002386142 5:178868672-178868694 GGCCACAAACACCATTCTTTAGG - Intronic
1002857250 6:1048930-1048952 GGTCATCAACACCTTGTTGTGGG + Intergenic
1002934085 6:1656958-1656980 CGCCAAGAGCACCATGCTGGAGG + Intronic
1003561174 6:7181956-7181978 TTCCATCAACACCATGATGTCGG + Exonic
1004347183 6:14859171-14859193 TCCCAACACCACCATGCGGTAGG - Intergenic
1004548201 6:16619990-16620012 GGCTAATAACACTATGCTGTTGG + Intronic
1004769627 6:18767441-18767463 GGCTAACAGCAGCCTGCTGTTGG + Intergenic
1005298200 6:24446869-24446891 GGACAACAGAACCTTGCTGTTGG - Exonic
1007703446 6:43777647-43777669 GTCCAACATCACCATGCAGGTGG + Exonic
1010064958 6:71671756-71671778 GGCCACAAACATAATGCTGTGGG + Intergenic
1011564742 6:88662915-88662937 TGCCAAGAAAGCCATGCTGTGGG - Intronic
1023101677 7:36724346-36724368 GTCCAACAAGAGCAAGCTGTGGG - Exonic
1023984722 7:45088090-45088112 GGCCAAGGGCACCTTGCTGTGGG - Intronic
1024600897 7:50980592-50980614 GGCCACCAAAACAATCCTGTAGG - Intergenic
1025040637 7:55641525-55641547 GTTCAGTAACACCATGCTGTAGG - Intergenic
1025782484 7:64614103-64614125 GGGCAACATCACCTTGCTGTTGG - Intergenic
1025809283 7:64864081-64864103 GGCCAAGAAGCCCATGCTGGTGG + Intergenic
1029539549 7:101174514-101174536 GGCCAGCACCACCGTGCGGTCGG + Exonic
1037691635 8:21185967-21185989 GGCCAACTCCAGCCTGCTGTGGG + Intergenic
1037758253 8:21725314-21725336 GGTCAGCAACAGCATGCTGAAGG + Intronic
1038488724 8:27954240-27954262 GGCAGTCAACACCATGCTGGGGG + Intronic
1039637617 8:39183147-39183169 AGCCAACAGCATCATGCTGCAGG - Intronic
1040482821 8:47841923-47841945 GGCAAAAAACCCCAGGCTGTGGG + Intronic
1041004718 8:53487010-53487032 GGCCCAGAACATGATGCTGTTGG - Intergenic
1047913838 8:129560423-129560445 TTACAACAACACCATGATGTAGG - Intergenic
1049745092 8:144259928-144259950 GGCCAACGACCTCATGCTCTTGG + Exonic
1050613398 9:7376621-7376643 TCACAATAACACCATGCTGTAGG + Intergenic
1052059547 9:23943372-23943394 GCCCAAGAACCCCATGCTCTTGG - Intergenic
1052541549 9:29817206-29817228 GGCCAACAAAACAGTCCTGTGGG + Intergenic
1054813167 9:69450964-69450986 TGCTAACAACACCTTGCTTTTGG + Intronic
1055990635 9:82102091-82102113 GGGCAAAAACCCCAAGCTGTAGG - Intergenic
1057296303 9:93845023-93845045 GTTCACCAGCACCATGCTGTAGG - Intergenic
1061304886 9:129726507-129726529 TGCCAACAACCCTATGCAGTGGG - Intergenic
1061395761 9:130342592-130342614 GGGCAATAACACCATCCTGCAGG - Intronic
1062090490 9:134675802-134675824 GGACCAAGACACCATGCTGTGGG - Intronic
1062332184 9:136049681-136049703 GGCCTACGACACCATGGTGGAGG - Exonic
1062537023 9:137025544-137025566 GGCCAGGAACATCATGCTGTGGG + Intronic
1190434613 X:50411022-50411044 TGCCAATAGCACCATGCTGCAGG + Intronic
1194530037 X:95035917-95035939 GTTCATCAGCACCATGCTGTAGG - Intergenic
1195343103 X:103924179-103924201 GCCCTACAACACAATGCAGTGGG + Intronic
1195551074 X:106171843-106171865 AGACAACAGCACCATGTTGTAGG - Intronic
1197352794 X:125398970-125398992 AGCCAAGAACATCATCCTGTGGG - Intergenic
1199554870 X:149095902-149095924 GGCCAACAAAACCAAGCAATAGG - Intergenic
1201790297 Y:17832450-17832472 GAGCAACAACGCCTTGCTGTGGG + Intergenic
1201811257 Y:18073539-18073561 GAGCAACAACGCCTTGCTGTGGG - Intergenic
1202351941 Y:24002200-24002222 GAGCAACAACGCCTTGCTGTGGG + Intergenic
1202366715 Y:24170772-24170794 GGGCAACAAGCCCCTGCTGTGGG - Intergenic
1202373690 Y:24214710-24214732 GGGCAACAAGCCCCTGCTGTGGG + Intergenic
1202497091 Y:25455410-25455432 GGGCAACAAGCCCCTGCTGTGGG - Intergenic
1202504067 Y:25499351-25499373 GGGCAACAAGCCCCTGCTGTGGG + Intergenic
1202518838 Y:25667919-25667941 GAGCAACAACGCCTTGCTGTGGG - Intergenic