ID: 1174272797

View in Genome Browser
Species Human (GRCh38)
Location 20:49381716-49381738
Sequence GCCTGTCCAGGCCTGAGCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 429
Summary {0: 1, 1: 0, 2: 1, 3: 42, 4: 385}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174272797_1174272801 -9 Left 1174272797 20:49381716-49381738 CCCCAGCTCAGGCCTGGACAGGC 0: 1
1: 0
2: 1
3: 42
4: 385
Right 1174272801 20:49381730-49381752 TGGACAGGCCTCTGCTTTTCTGG 0: 1
1: 0
2: 2
3: 28
4: 289
1174272797_1174272809 26 Left 1174272797 20:49381716-49381738 CCCCAGCTCAGGCCTGGACAGGC 0: 1
1: 0
2: 1
3: 42
4: 385
Right 1174272809 20:49381765-49381787 GTTGGGCTTGGCAGAACTCCAGG No data
1174272797_1174272802 -8 Left 1174272797 20:49381716-49381738 CCCCAGCTCAGGCCTGGACAGGC 0: 1
1: 0
2: 1
3: 42
4: 385
Right 1174272802 20:49381731-49381753 GGACAGGCCTCTGCTTTTCTGGG 0: 1
1: 0
2: 2
3: 22
4: 210
1174272797_1174272806 14 Left 1174272797 20:49381716-49381738 CCCCAGCTCAGGCCTGGACAGGC 0: 1
1: 0
2: 1
3: 42
4: 385
Right 1174272806 20:49381753-49381775 GATCTGAGCCCAGTTGGGCTTGG 0: 1
1: 0
2: 1
3: 13
4: 194
1174272797_1174272805 9 Left 1174272797 20:49381716-49381738 CCCCAGCTCAGGCCTGGACAGGC 0: 1
1: 0
2: 1
3: 42
4: 385
Right 1174272805 20:49381748-49381770 TCTGGGATCTGAGCCCAGTTGGG 0: 1
1: 0
2: 0
3: 25
4: 268
1174272797_1174272804 8 Left 1174272797 20:49381716-49381738 CCCCAGCTCAGGCCTGGACAGGC 0: 1
1: 0
2: 1
3: 42
4: 385
Right 1174272804 20:49381747-49381769 TTCTGGGATCTGAGCCCAGTTGG 0: 1
1: 0
2: 1
3: 19
4: 297

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174272797 Original CRISPR GCCTGTCCAGGCCTGAGCTG GGG (reversed) Intronic
900031925 1:378660-378682 GCCTCCCCAGGGCTGGGCTGTGG + Intergenic
900052473 1:606846-606868 GCCTCCCCAGGGCTGGGCTGTGG + Intergenic
900127368 1:1074475-1074497 GCCTGGGCAGGTCTGGGCTGGGG + Intergenic
900143943 1:1150031-1150053 GCCAGTGGAGGCCTGAGCTCAGG + Intergenic
900181566 1:1313287-1313309 GACTGTCCAGGGCTGGGCTGGGG + Intronic
900375650 1:2353418-2353440 ACCCTTCCAGGCCTGAGCAGGGG + Intronic
900387688 1:2417968-2417990 GCCTGCAAAGCCCTGAGCTGGGG - Intergenic
900995850 1:6123286-6123308 GGCTGCCCAGGCCTGGGGTGGGG + Intronic
901416588 1:9120727-9120749 GGCTGCCCATCCCTGAGCTGAGG - Intronic
901643532 1:10704951-10704973 GCCTGTCCTGGCCTCGGCCGTGG + Intronic
901868753 1:12125316-12125338 GCCTGGCCTGGCCTGGGCTGGGG + Intronic
902205737 1:14866873-14866895 ATCTGTGCTGGCCTGAGCTGTGG + Intronic
903741232 1:25559856-25559878 GTCTGTCCTGGCCTGAGCCATGG + Intronic
904259537 1:29280393-29280415 GACTGTCCAGGCCTGTCCAGGGG + Intronic
904376474 1:30085397-30085419 GCCTGGCCAGTGCTGAGATGGGG + Intergenic
904557470 1:31374586-31374608 TCCTGTCCTGTCCTGACCTGAGG + Intronic
904609701 1:31718713-31718735 GCCTGTGCAGGCCTGGGAAGGGG - Intergenic
904915882 1:33970479-33970501 GGGTGCCCAGGCCTGAGCTCAGG - Intronic
905887945 1:41501796-41501818 GCCAGCTCAGGCCTGGGCTGTGG + Intergenic
905942260 1:41873427-41873449 GCTTGTCCTGGCCTTAGCTGAGG - Intronic
906606292 1:47174749-47174771 TCCTGTCCTGGCTTGGGCTGGGG - Intergenic
911144571 1:94540679-94540701 GCCAGTCCAGGACTCAGCTCAGG + Intronic
911975291 1:104487355-104487377 GCCTGTCCTGGGGTGGGCTGGGG - Intergenic
912476072 1:109935766-109935788 GGTTGTCCAGGCCTGGGCTGGGG + Intergenic
912515264 1:110212830-110212852 GGATGTCCTGGCCTCAGCTGGGG + Intronic
912564948 1:110580748-110580770 GCCAGCCCAGGCCTGACTTGGGG + Intergenic
912771079 1:112464832-112464854 TCTTGTCCATGCCTGACCTGAGG - Intergenic
915724966 1:158010984-158011006 GGCTGACCAGAGCTGAGCTGTGG + Intronic
917843896 1:179004350-179004372 TCCTCTCCAGGCCTCAGCTTAGG + Intergenic
918684413 1:187397142-187397164 GCCTGTTCAAGCCTCAGCAGTGG - Intergenic
921939885 1:220828414-220828436 GCCTGTCCATGCCTCAGCTGTGG + Intergenic
924255570 1:242179547-242179569 GCCTGTGCTGCCCTGGGCTGTGG + Intronic
1063061990 10:2565418-2565440 GCCGGTCCAAGCCTTGGCTGGGG + Intergenic
1067067738 10:43113161-43113183 GACTGTCCAGGCCCCTGCTGAGG + Intronic
1067494259 10:46747888-46747910 GCATGACCAGGCATGAGCTCTGG + Intergenic
1067600400 10:47592509-47592531 GCGTGACCAGGCATGAGCTCTGG - Intergenic
1067968726 10:50944209-50944231 GCCTGGCCAGGTCAGAGCTTTGG + Intergenic
1068986684 10:63114117-63114139 GCCTGGCCAGGCTTCAGCTTTGG - Intergenic
1069676338 10:70251388-70251410 GTCTGCCCAGCCCTGTGCTGAGG - Exonic
1070663558 10:78327903-78327925 GCATGTGCAGGCATGAGCAGTGG + Intergenic
1070791174 10:79190254-79190276 GCCTGCCCAGGCCAGGCCTGTGG - Intronic
1070948656 10:80413424-80413446 GACTTTCCAGGCCTGGGGTGAGG + Intronic
1071240079 10:83695775-83695797 CCCTGCCCAGTCCTTAGCTGTGG + Intergenic
1071289998 10:84181807-84181829 GGCTGCCCAGGCTTAAGCTGGGG + Intronic
1071489295 10:86125085-86125107 GCCTGTCCATGCCAGTGCTCAGG - Intronic
1071500534 10:86200490-86200512 GCCTGGCCAGGCCATAGCTGTGG + Intronic
1072506413 10:96072001-96072023 GCCTGTCAAAGCCTGAGATAAGG + Intergenic
1073516345 10:104078884-104078906 TCCAGTCCAGGCCTGGTCTGAGG + Intronic
1073858898 10:107713348-107713370 GCCTGTTGAGGCTTCAGCTGAGG - Intergenic
1074591865 10:114821695-114821717 GCCCGGCCAGGCCTGCCCTGCGG - Intergenic
1075328416 10:121553922-121553944 ACCTATGCAGGCCTGACCTGTGG + Intronic
1075572462 10:123556176-123556198 GCCTGTCCAGGGCTGGGGTCAGG + Intergenic
1075790655 10:125082144-125082166 GGCTGGCCACGCCGGAGCTGGGG + Intronic
1076313057 10:129521802-129521824 GGCTGCACAGGCCTCAGCTGCGG - Intronic
1076605918 10:131689788-131689810 GACTGTGCGGGGCTGAGCTGGGG - Intergenic
1076853007 10:133102329-133102351 ACCTATCCAGGTCTGAGCTCAGG + Intronic
1076903275 10:133350312-133350334 GCCTGTGCAGGCATGAGGAGGGG + Intronic
1077060300 11:614995-615017 CCCTCTTCAGGCCTGGGCTGTGG - Exonic
1077224689 11:1434896-1434918 GCCCCACCTGGCCTGAGCTGTGG - Intronic
1077385069 11:2265451-2265473 GCCTGTCCTGGGCTCTGCTGTGG - Intergenic
1077496789 11:2890525-2890547 TCCTGTCCAGGGCTGGTCTGAGG - Intronic
1077526256 11:3067584-3067606 TCCTGCACAGGCCTGACCTGGGG - Intergenic
1077914339 11:6601423-6601445 GCCAGACCAGGCCCCAGCTGAGG - Exonic
1078015535 11:7610444-7610466 GCCTTCCCAGGTCTGAGCTTAGG - Intronic
1078360708 11:10665548-10665570 GCCTATCCAGCTCTGAGCTGAGG - Intronic
1079101287 11:17543901-17543923 GCCTCAACAGCCCTGAGCTGGGG + Intronic
1080400775 11:31933663-31933685 GACTCTCCAGAACTGAGCTGGGG + Intronic
1081675137 11:44964181-44964203 GCCTGGCCAGGCCTCAGGAGAGG - Intergenic
1081751212 11:45512522-45512544 GCCTGTACATGACAGAGCTGGGG - Intergenic
1083641037 11:64145459-64145481 GCCTGTCCAGCCCTGGGCCCAGG - Intronic
1083675289 11:64321732-64321754 ACCTGCCCAGCCCTGTGCTGGGG + Exonic
1084229892 11:67743950-67743972 GAGAGTCCAGGCCTGAGCTTGGG - Intergenic
1084485928 11:69448276-69448298 GCCTCTCTAGACCTAAGCTGGGG - Intergenic
1084491054 11:69478469-69478491 GCCAGCCCAGCCCTGAGCAGAGG - Intergenic
1084526338 11:69700765-69700787 GCCTGGCCTGGCCTGGCCTGGGG - Intronic
1084748724 11:71189843-71189865 GCTTCCCCAGGCCTCAGCTGCGG - Intronic
1084893623 11:72249942-72249964 GGCTGTACAGGGCTGAGTTGTGG + Intergenic
1084964227 11:72735876-72735898 GCCAGTCCAGGTCTGAGGTCTGG - Intronic
1085040830 11:73325321-73325343 GTGTGGCCAGGCCTGGGCTGTGG + Intronic
1088598444 11:111456473-111456495 GCCTGCTCAGCCCTGGGCTGGGG - Intronic
1089339842 11:117749868-117749890 GCCTGTGCAGACTTGAGCTCTGG + Intronic
1089442434 11:118528682-118528704 ACCTCTCCAGGGCTGTGCTGAGG - Exonic
1089523035 11:119078329-119078351 CCCTGGCCAGGCCTCACCTGTGG - Exonic
1089650114 11:119907470-119907492 CCCAGTCCAGGCCAGAGCTCTGG - Intergenic
1089773616 11:120820675-120820697 ACCTGTCCAGGGCTTACCTGGGG + Intronic
1090395190 11:126414177-126414199 GCCTGGCCAGGTCTGAGATGAGG + Exonic
1090593918 11:128299905-128299927 GACTGTCCAGGCCTGAGTGCTGG - Intergenic
1091001967 11:131917420-131917442 GTCTGTCCAGGCCACAGATGAGG + Intronic
1095945176 12:47749583-47749605 GTCTGTCCTGGCAAGAGCTGGGG - Intronic
1096105658 12:48995841-48995863 GCCTGTGGTGGTCTGAGCTGGGG - Exonic
1096498663 12:52052801-52052823 GCCTGGCCAGGGATGGGCTGGGG - Intronic
1096542971 12:52318520-52318542 TCCCCTCCTGGCCTGAGCTGTGG + Intronic
1096649018 12:53052925-53052947 GCCTTTCCAGGTATAAGCTGTGG + Intronic
1097191417 12:57221301-57221323 GACAGTCCAGGCCTGGGCTGGGG - Intronic
1100391634 12:94149612-94149634 GCCTGGCCACGCAGGAGCTGGGG + Exonic
1100548001 12:95621662-95621684 GACTGTCAAGGCCTGACCTGAGG + Intergenic
1102458183 12:113084029-113084051 ACCCGTCCAGGGCTGAGATGAGG - Intronic
1103001188 12:117386512-117386534 GACTGCCCTGGTCTGAGCTGGGG + Intronic
1103518107 12:121520576-121520598 GCCTGTCCTGGTCTGAGGTCAGG - Intronic
1103565389 12:121812659-121812681 CTCTGTCCAGGACTGATCTGGGG + Intronic
1103583207 12:121931688-121931710 GCGTGTTCAGCCCAGAGCTGGGG - Intronic
1104035802 12:125096461-125096483 GCCTGTCCAGACCTTGGCTGTGG - Intronic
1104361952 12:128141690-128141712 GCCAGTGCAGGGCAGAGCTGTGG - Intergenic
1104441528 12:128797320-128797342 GCCTGTCCTGTGCTGGGCTGTGG - Intronic
1104853315 12:131889362-131889384 GTCCTTCCAGGGCTGAGCTGTGG - Intergenic
1105284195 13:18991497-18991519 GGCTGTCAAGACCAGAGCTGGGG - Intergenic
1105805037 13:23947623-23947645 CCCTATTCAGGCCTGGGCTGGGG + Intergenic
1106242082 13:27920512-27920534 GCCTTTCCACGCGTGAGCTTTGG - Exonic
1109487390 13:63044900-63044922 GCCTGAGCAGGCCTGAACTACGG - Intergenic
1112751708 13:102589959-102589981 GCCTTCCCAGGCCAGAGATGGGG - Intergenic
1113906520 13:113821874-113821896 GCCTGTCCAGGTTAGATCTGGGG + Intronic
1113948980 13:114060702-114060724 GACAGTCCTGGCCTGAGCTCCGG - Intronic
1114484662 14:23055644-23055666 CCCTGCCCAGGCCCGGGCTGGGG + Exonic
1114524311 14:23358915-23358937 CCCTGTGCAGGCCTGATCCGGGG + Exonic
1114670371 14:24407882-24407904 GCCTGTGCAGCCCAGAGCTGTGG + Exonic
1115858756 14:37660380-37660402 GCCTGTCCAGGGGTGAGGTGTGG - Intronic
1116973388 14:51092516-51092538 TAGTGTCCAGGCCTCAGCTGTGG - Intronic
1118607888 14:67516343-67516365 GCATGCCGAGGCCTGATCTGAGG + Intronic
1119705297 14:76779432-76779454 GCCTTACCAGGCCTGTGATGGGG + Exonic
1119777082 14:77256186-77256208 GTCTCTCCAGACCTCAGCTGAGG + Intronic
1121649009 14:95543147-95543169 CCCTGTCCAGGGCTGAGGGGTGG - Intronic
1122165116 14:99817464-99817486 GCCTGTCCCGGCTGGTGCTGAGG + Intronic
1122294934 14:100700103-100700125 CCCTGCCCACACCTGAGCTGTGG + Intergenic
1122320217 14:100851180-100851202 GCCTATCCAGGCCATAGATGGGG - Intergenic
1122627971 14:103093950-103093972 GCCTGTCCCAACCTGGGCTGGGG - Intergenic
1122647519 14:103205204-103205226 GCCTGAGCAGGCCTGGGCTGCGG - Intergenic
1122691051 14:103532366-103532388 CCCTGTCTAGGGGTGAGCTGGGG - Intronic
1123004999 14:105316796-105316818 CCCTGTCCAGGCCAGAGCTCGGG - Intronic
1123114094 14:105886114-105886136 GGATGTCCAGGGCTGACCTGAGG + Intergenic
1123116316 14:105895723-105895745 GGATGTCCAGGGCTGACCTGAGG + Intergenic
1123120559 14:105914442-105914464 GGATGTCCAGGGCTGACCTGAGG + Intergenic
1202899829 14_GL000194v1_random:28571-28593 GCCTGCCCAGGTCTGTGTTGAGG - Intergenic
1123403273 15:20005988-20006010 GGATGTCCAGGGCTGACCTGAGG + Intergenic
1123512611 15:21012642-21012664 GGATGTCCAGGGCTGACCTGAGG + Intergenic
1124338884 15:28877022-28877044 TCCTCTCCAGGCCTGGGTTGGGG + Intergenic
1124371075 15:29105109-29105131 GACTGTCCCTGCCTAAGCTGTGG - Intronic
1125227665 15:37413177-37413199 GCCTGTCCAGGACAGCCCTGGGG + Intergenic
1125671990 15:41480441-41480463 GCCTGTCTTGGCCTGGCCTGTGG - Intronic
1125679870 15:41523843-41523865 TGCTGTCCAGACCTGAGATGTGG - Exonic
1126096385 15:45093798-45093820 GCCTGCCATGGCTTGAGCTGGGG + Exonic
1126667113 15:51085460-51085482 GCCTGTGCTGGTCTGACCTGTGG + Intronic
1127896871 15:63308642-63308664 GCCTGTCTGGGGCTGGGCTGAGG - Exonic
1128301793 15:66570602-66570624 CCCTGCCCAGCCCTGAGCTAAGG + Intergenic
1128315233 15:66655628-66655650 GCCGTTCCAGGCCGGGGCTGGGG - Intronic
1128552920 15:68609755-68609777 GGCTCTCCAGGGGTGAGCTGGGG + Intronic
1128600550 15:68991982-68992004 GCCTGAGCAGGCCTAGGCTGCGG - Intronic
1128804189 15:70518458-70518480 GTCTGTCCAGGCATGAACAGAGG - Intergenic
1129757966 15:78109994-78110016 GCCTGACACGGCCTGAGCTGAGG - Intronic
1130056877 15:80533673-80533695 TCCTTTCCATGCCTTAGCTGTGG - Intronic
1130918228 15:88322782-88322804 GCCCTCCCAGGCCTGAGCTTTGG - Intergenic
1131828944 15:96342092-96342114 GGTTGTCCAGGCCGGGGCTGGGG - Intergenic
1132058071 15:98667620-98667642 GCAGGTCCAGGCCTGAGCCCTGG - Intronic
1132603299 16:783381-783403 GCCTGCCCACCTCTGAGCTGCGG - Intergenic
1132690974 16:1181765-1181787 CCCTCTTCAGGCCTGAGATGAGG - Intronic
1132853621 16:2035385-2035407 GCCAGGCCAGGCCAGGGCTGGGG - Intronic
1132865882 16:2092514-2092536 ACCAGTCCAGCCCAGAGCTGGGG - Exonic
1135190195 16:20348390-20348412 GCCTTTCCAGGCCTGGGATGAGG + Intronic
1136268255 16:29133267-29133289 GCTTGTCTGAGCCTGAGCTGTGG + Intergenic
1136394197 16:29984011-29984033 GCCTGTGGAGCCCTGTGCTGGGG + Intronic
1136773379 16:32859221-32859243 GCATGTCCAGGGCAGGGCTGGGG - Intergenic
1136897235 16:34002298-34002320 GCATGTCCAGGGCAGGGCTGGGG + Intergenic
1138340850 16:56288317-56288339 GCCTGTCCTAGCCTGTGCTGAGG + Intronic
1138383038 16:56617079-56617101 CCCTGGGTAGGCCTGAGCTGGGG - Intergenic
1138460964 16:57147375-57147397 GCCTGGCCTGGGCTGAGATGAGG + Intronic
1138584442 16:57960903-57960925 CCCTCTGCAGGCCTGGGCTGCGG - Exonic
1139599315 16:67977017-67977039 GCCTGTCCTGCCCAGAGATGTGG + Intronic
1139924105 16:70476355-70476377 GCCTTTCCAGGGCTGTGCTGGGG + Intronic
1139953627 16:70683426-70683448 GCCTGGCCAGGCCTCTGCTAGGG - Intronic
1142006980 16:87694037-87694059 GCCTGTCCAGGCCACAGACGGGG + Intronic
1142071567 16:88093605-88093627 GCTTGTCTGAGCCTGAGCTGTGG + Intronic
1142195612 16:88738023-88738045 GCCAGTCCAGGCCGGTGTTGAGG + Exonic
1142373154 16:89694108-89694130 TCCTGTGGAGGCCTGGGCTGGGG + Intronic
1203075795 16_KI270728v1_random:1121331-1121353 GCATGTCCAGGGCAGGGCTGGGG - Intergenic
1142708909 17:1713021-1713043 GTCTGCACAGGCCTGAGCTGGGG + Intergenic
1142749994 17:1981644-1981666 GCCTGCTCCAGCCTGAGCTGTGG + Intronic
1143282476 17:5765218-5765240 GCTTGTTCAAGCCTGAGATGTGG + Intergenic
1144516005 17:15917872-15917894 GCCTGTCCAGGCGAGTGCTCGGG + Intergenic
1146543387 17:33717551-33717573 TCCGGTCCAGGCTGGAGCTGGGG + Intronic
1147702059 17:42402540-42402562 GCCTGAAGGGGCCTGAGCTGTGG - Exonic
1147718913 17:42526287-42526309 GGCTGACCAAGACTGAGCTGTGG + Intergenic
1148212160 17:45815122-45815144 GCCTCTTCAGGCCTGGGCCGAGG - Intronic
1149496549 17:57121959-57121981 TCCTGGCCAAGCCTGAGCTGTGG + Intergenic
1149602630 17:57903177-57903199 GCCTGCCCAGCTCAGAGCTGAGG - Intronic
1149624183 17:58067933-58067955 GCCTGTCCAGGCCTGGAGAGGGG + Intergenic
1150419429 17:65018766-65018788 GCCTGTCCATGCCTGTGGTTGGG - Intronic
1150617752 17:66785175-66785197 TCCTGTCCAGGACTGGGCAGGGG + Intronic
1150644120 17:66967520-66967542 TGCTGTCCAGGCCTCAGCTCTGG - Intronic
1151661688 17:75522300-75522322 GCCTGGCCAGGACTCAGCAGCGG - Exonic
1151905509 17:77045889-77045911 GCAGGTCCAGGCCTGCTCTGTGG - Intergenic
1151954360 17:77373190-77373212 GCCTGTCAAGGCCAGGCCTGGGG - Intronic
1152340168 17:79720071-79720093 GCCTGTCCTGGGCTCAGCCGAGG + Intergenic
1152626524 17:81390276-81390298 TCCCGACCAGGCCTGGGCTGAGG - Intergenic
1152947731 17:83207054-83207076 GCCTCCCCAGGGCTGGGCTGTGG - Intergenic
1153925459 18:9831683-9831705 GCCTGGAGTGGCCTGAGCTGGGG + Intronic
1154327430 18:13401599-13401621 GGCTGTCCAGACCTGAGCACGGG - Intronic
1154327967 18:13405812-13405834 CCCTGTCCTGCTCTGAGCTGAGG + Intronic
1154486860 18:14878996-14879018 GCCTGCCCAGGTCTGTGCTGAGG - Intergenic
1157504708 18:48218203-48218225 GACTGTGCAGGCCTGGGGTGAGG - Intronic
1157621424 18:49019243-49019265 GCCCCTCCAGGCCTGGGCTCTGG + Intergenic
1158305640 18:56102485-56102507 GCCAGTCCAGGGCAGAACTGAGG + Intergenic
1160036354 18:75305039-75305061 GCCTGGCCCGGCCTGGGGTGCGG + Intergenic
1160632186 18:80254415-80254437 TCCTGTCCAGGGCACAGCTGGGG - Intergenic
1160804861 19:988185-988207 GGCAGTCCCGGCCTGAGCTCTGG - Intronic
1160825090 19:1076037-1076059 GGCTGTGCAGGGCTCAGCTGAGG + Intronic
1161030495 19:2055962-2055984 GCCTGTCCAGGGCTGGTCTAGGG - Intergenic
1161353580 19:3806833-3806855 GCCTGCCCAGCCCTCACCTGTGG - Intronic
1161404299 19:4083065-4083087 TCCTCTCCAGCCCTCAGCTGTGG + Intergenic
1161813021 19:6481617-6481639 CCCGGGCCAGGCCTGAGCCGGGG - Intronic
1162016571 19:7849586-7849608 TCCTGTCCAACCCTGAGATGTGG - Intronic
1162129093 19:8514381-8514403 GCCTGTCCAGGGCTGATCTTGGG - Intergenic
1162496914 19:11028519-11028541 CCAGGTCCAGGCCTGACCTGTGG - Intronic
1162520507 19:11176683-11176705 GTCCCTGCAGGCCTGAGCTGGGG + Exonic
1162540823 19:11294935-11294957 CTCTGTCCAGCCCTGGGCTGGGG - Intergenic
1163005243 19:14393398-14393420 GTTTCTCCCGGCCTGAGCTGTGG - Intronic
1163144195 19:15369723-15369745 GCCTGCCCTGGGCTGTGCTGTGG - Intronic
1163237668 19:16038765-16038787 GCCAGTCCAGGTCTGTCCTGGGG + Intergenic
1164580532 19:29432509-29432531 GCCTGTCCTGGCCTAGCCTGAGG + Intergenic
1165363419 19:35350477-35350499 GCCTGTTCACACCTGCGCTGGGG - Intergenic
1166066972 19:40365856-40365878 GCCTGTCCAGACAGAAGCTGGGG + Exonic
1166293579 19:41878310-41878332 GCCTCTCCCTGCCTGGGCTGAGG - Intronic
1167146032 19:47681160-47681182 GCCAGGCCAGGGCTGGGCTGGGG - Exonic
1167569891 19:50280446-50280468 GCATGGCCATCCCTGAGCTGGGG - Intronic
1168296407 19:55379137-55379159 GCCTGGCCACACCTGAGGTGAGG - Intergenic
1168308527 19:55449761-55449783 GTCTGTCAGGTCCTGAGCTGGGG - Intergenic
1168714226 19:58517868-58517890 GCCTGGCCAGGTCTGAGGTAGGG - Intronic
925161743 2:1689071-1689093 GCCTTGCCAGGCCTCTGCTGCGG - Intronic
926217866 2:10916118-10916140 GCCTGTGCTGGCCTGAGCGGGGG + Intergenic
927478892 2:23434870-23434892 GCCTGTCAAAGCCTGAGAGGGGG + Intronic
927519441 2:23690121-23690143 TCCTGGCCATGCCTGTGCTGAGG + Intronic
927561490 2:24076937-24076959 GCCTGAGGAGGACTGAGCTGGGG + Intronic
927982754 2:27384859-27384881 GCCTGTGTAGGCCTTGGCTGTGG + Exonic
932780757 2:74556997-74557019 GGCTGTACAGGGCTGAGTTGTGG - Exonic
932793436 2:74675015-74675037 ACCTCTCCAGGTCTGGGCTGGGG - Exonic
932804125 2:74768580-74768602 GCCTGTTAAGGCCAGGGCTGAGG - Intergenic
932903268 2:75724194-75724216 GCCTGTCCAGGGGTGGGGTGGGG + Intergenic
933326496 2:80844514-80844536 GCCTGTCAAGGAAGGAGCTGAGG - Intergenic
933599285 2:84313828-84313850 GCCTGTCAAGTGCTGAGCTGTGG - Intergenic
933721849 2:85402000-85402022 GCCTGCCCAGGGCTGTGCTTGGG - Intronic
934563199 2:95323733-95323755 GCCTGTCCGGGGCTTAGCTTGGG - Intronic
934860894 2:97763049-97763071 AGCTGGCCAGGCCTGGGCTGGGG - Intronic
936151483 2:110024439-110024461 CCCTGCCCAGGCCTCACCTGGGG - Intergenic
936193191 2:110346930-110346952 CCCTGCCCAGGCCTCACCTGGGG + Intergenic
937639350 2:124193891-124193913 GTCTGTCCAGGGCTGAGGTTTGG - Intronic
938712830 2:133990336-133990358 CCCTGTCCAGGTCTTAGCTCAGG - Intergenic
941602205 2:167557603-167557625 GACAGTCCAGGGCAGAGCTGGGG - Intergenic
945230250 2:207580945-207580967 GCTTGTCCTTGCCTGTGCTGTGG - Intronic
946389267 2:219405588-219405610 GCCTCTCCAGGACAGAGGTGTGG + Intergenic
947337568 2:229103187-229103209 GGCTGTCCAGGCCTAAGTGGGGG - Intronic
947432982 2:230046710-230046732 GCCTGTACAGGCCTGGGCAGCGG - Exonic
947742960 2:232493185-232493207 GCCTGTCCAGGTTGGAGCTGGGG - Intergenic
948107487 2:235427328-235427350 TCCAGTCCATGCCTGAGCTGTGG + Intergenic
948686818 2:239675257-239675279 GCCTCCCCAGGCCCCAGCTGTGG - Intergenic
948918788 2:241051896-241051918 GACGGGCCAGCCCTGAGCTGGGG + Intronic
1169001567 20:2171514-2171536 ACCAGTCCAGGCCAGAGTTGCGG - Intronic
1170418528 20:16169587-16169609 GCCTGTGCAGGACAGAGTTGGGG + Intergenic
1171192771 20:23170951-23170973 CCCAGTCCATGCCTGATCTGAGG + Intergenic
1172183592 20:33018360-33018382 TCCTGGCCAGCCCAGAGCTGGGG + Intronic
1172847518 20:37938698-37938720 GCCTGTCGATGCCTGTGCGGAGG + Intronic
1172964997 20:38828283-38828305 GGCTCTTCAGGCCTGAGGTGAGG - Intronic
1174272797 20:49381716-49381738 GCCTGTCCAGGCCTGAGCTGGGG - Intronic
1174273125 20:49384050-49384072 GCCTATTCAGGCCTCAGCTTTGG + Intronic
1174366354 20:50058915-50058937 GCCTTGCCAGGCCTGGGCAGCGG - Intergenic
1175354716 20:58355292-58355314 GCTGGGCCTGGCCTGAGCTGGGG - Intronic
1175518756 20:59586135-59586157 GCCTGCCCTGGCCTGCTCTGTGG + Intronic
1176106935 20:63393867-63393889 GCCTGTCCTGCGCTGTGCTGGGG + Intergenic
1176112998 20:63418984-63419006 GTGTGTGCAGGCCTGCGCTGGGG - Intronic
1176190119 20:63804550-63804572 GCCTGTCCAGCATTGAGATGTGG - Intronic
1176416496 21:6478494-6478516 GACTGTCCAGGCAAGAGCAGAGG - Intergenic
1176521839 21:7830113-7830135 GGGTGTGCAGCCCTGAGCTGGGG + Intergenic
1176619203 21:9043345-9043367 GCCTGCCCAGGTCTGTGTTGAGG - Intergenic
1176794426 21:13360338-13360360 GCCCGCCCAGGTCTGTGCTGAGG + Intergenic
1178655859 21:34460125-34460147 GGGTGTGCAGCCCTGAGCTGGGG + Intergenic
1178828468 21:36035113-36035135 TCCTGTTCAGGCCCGTGCTGGGG - Exonic
1178883584 21:36467340-36467362 GCCTGGCCAGGACTGAGGGGTGG + Intronic
1179177847 21:39021705-39021727 CCCTGTGGAGGGCTGAGCTGGGG + Intergenic
1179452814 21:41477271-41477293 GCCCCTCCATGCCTGAGATGGGG + Intronic
1179554234 21:42162406-42162428 GGCTGTGCAGGGGTGAGCTGGGG + Intergenic
1179691996 21:43086829-43086851 GACTGTCCAGGCAAGAGCAGAGG - Intergenic
1180188558 21:46151993-46152015 GCCGGTCCAGGCCTGACCGCCGG - Intronic
1180957546 22:19747679-19747701 GCCTGTCCAGGCCTCGGCCCAGG - Intergenic
1181049272 22:20231050-20231072 GCTTCCCCAGGCCTGAGCTTGGG + Intergenic
1181161650 22:20963382-20963404 GCAAGTGCAGGCCTGACCTGGGG - Intergenic
1181412123 22:22731332-22731354 GCCTGCCCAGGGCTGTCCTGTGG + Intergenic
1181496793 22:23291840-23291862 GCCTGGCCAGGCCCTGGCTGTGG + Intronic
1181781550 22:25197520-25197542 GTCTGTCCTGTGCTGAGCTGTGG + Intergenic
1182134525 22:27888903-27888925 CCCTGGCAAGGCCTGAGCTAGGG + Intronic
1182374275 22:29835061-29835083 ACCTGTCTAGGCCTGGACTGTGG - Intronic
1182686496 22:32124267-32124289 GCCTGTCCCAGCCTGGCCTGGGG + Intergenic
1183407559 22:37637986-37638008 CCCTCACCAGGCCGGAGCTGGGG + Intronic
1183537919 22:38413764-38413786 CACTGGCTAGGCCTGAGCTGTGG - Intergenic
1183786005 22:40029603-40029625 GCCTGCCCTGCCCTGTGCTGTGG + Exonic
1183951720 22:41356332-41356354 GCATGTCCAGGACTGGGCAGGGG - Exonic
1184034019 22:41910189-41910211 CCTTGTCCAGTCCTGAGCTTGGG - Intronic
1184103090 22:42351864-42351886 GCCTCTCCAGGCCTGGACTAAGG - Intergenic
1184240210 22:43207849-43207871 GCCTCTGCAGGCTTCAGCTGAGG - Intronic
1184255878 22:43286647-43286669 TCCTGTACAGTCATGAGCTGAGG - Intronic
1184289199 22:43489311-43489333 GGCTGTCCAGGCCTCATGTGTGG + Intronic
1184332040 22:43833442-43833464 GCCTGTCAAAGCCTGAGGTGTGG - Intronic
1184498864 22:44859980-44860002 GCCTGACCAGGCCTTGGATGAGG - Intronic
1184534293 22:45076243-45076265 GCCTGTCAGGGCCTGGGATGGGG + Intergenic
1184783010 22:46658479-46658501 GCCTGTGCCTGCATGAGCTGTGG + Intronic
1185341073 22:50291372-50291394 GCCTGTCCAGGCTGCAGATGTGG - Intronic
1185359905 22:50399827-50399849 GCCTGCCCAGGCCACAGCAGAGG + Intronic
949436473 3:4034990-4035012 GCATGTCCAGGCCTATGCTATGG + Intronic
949941559 3:9158838-9158860 GCCTTCCCATGCCTGAGTTGTGG - Intronic
950263966 3:11561393-11561415 GCATCTCCTGACCTGAGCTGGGG + Intronic
951709450 3:25573945-25573967 CCCTGCCCTGGCCTGAGGTGGGG - Intronic
953840519 3:46386481-46386503 GCCTGACCAGGCCTGGACTATGG + Intergenic
954622180 3:52002565-52002587 GCCTGAGCAGGCCTGGGCTGGGG + Intergenic
955638306 3:61054263-61054285 ACCTGTTCAGCCCAGAGCTGGGG - Intronic
961143742 3:124577010-124577032 GCCTGAGCTGGCCTGAGCTCAGG - Intronic
961619456 3:128212272-128212294 CCCTGTCCAGATATGAGCTGGGG - Intronic
961782884 3:129331462-129331484 GGCTGCCCAGGGCTGAGCTCTGG + Intergenic
961809678 3:129514677-129514699 GCATGGCCAGGCTTGAGCAGGGG - Intronic
962367973 3:134798228-134798250 CCCTGCCCTGGCCTGGGCTGAGG - Intronic
968494339 4:907151-907173 GCGTGGCCCAGCCTGAGCTGTGG - Intronic
968943870 4:3653569-3653591 CCCTGGCCAGGCCTGGGCCGGGG - Intergenic
969279112 4:6157643-6157665 GCATGTCCAGGGCTACGCTGGGG - Intronic
969871511 4:10107661-10107683 GCCTGTGAGGGCCAGAGCTGGGG + Intronic
970448100 4:16140564-16140586 GGCTGTCCTTGCCTAAGCTGGGG + Intergenic
971278835 4:25224228-25224250 GCCTGAGCAGGCCTGGGCTGTGG - Intronic
972390353 4:38607577-38607599 ACCTGTTCAGGTCAGAGCTGGGG + Intergenic
974849345 4:67386124-67386146 GCCCTTAGAGGCCTGAGCTGAGG - Intergenic
975697350 4:77026446-77026468 GCCTCTCCAGGACTGAACTTCGG + Intronic
977033910 4:91924957-91924979 GCCTGCCCTGGCCTGAAGTGGGG - Intergenic
979205400 4:118032850-118032872 CACTGGCCAGACCTGAGCTGTGG + Intergenic
979503509 4:121467334-121467356 GCCTGTCCAGGGGTGTGGTGGGG - Intergenic
981761147 4:148196295-148196317 CCATGTCCAAGACTGAGCTGGGG - Intronic
982584861 4:157222872-157222894 GCCTGCCCACGCCTGCGCGGGGG - Intronic
982658132 4:158174236-158174258 ATCTGTCAAGGCCTGGGCTGAGG - Intergenic
982819263 4:159926266-159926288 GCCTGAGCAGGCCTAGGCTGCGG - Intergenic
984449710 4:179883641-179883663 CTCTGTTCAGGCCTGTGCTGTGG + Intergenic
984661619 4:182381119-182381141 TCCCGACCAGGGCTGAGCTGAGG + Intronic
985578617 5:685205-685227 GGGTCTCCAGGCCTGGGCTGAGG + Intronic
985705047 5:1395599-1395621 GCCTGTGCCGGCATCAGCTGTGG - Intronic
985873527 5:2577752-2577774 GCCTGCCCAGGCCGGTGTTGGGG + Intergenic
985915413 5:2914562-2914584 GCCTCTCCAGTCAGGAGCTGGGG + Intergenic
985986693 5:3522097-3522119 GCCTGCCCAGCCCTGGGCTGGGG - Intergenic
988702320 5:33687693-33687715 GCCTTAACAGGACTGAGCTGGGG + Intronic
989541532 5:42624262-42624284 GCATTTCCAGGCCAGAGCTTTGG + Intronic
990615744 5:57506032-57506054 GCGTGTCCAGGGCTGAGATAGGG + Intergenic
991216995 5:64166317-64166339 CCCTCTCCAGGTCTGAGGTGGGG + Intronic
991488919 5:67165014-67165036 GCCTGGCCAGGTCAGGGCTGTGG - Exonic
991984837 5:72274398-72274420 CCCTGTGCAGGCCTAAGCTAAGG - Intronic
992942436 5:81775288-81775310 CCCTGGCCTGGCCTGAGCTGAGG + Intergenic
995903347 5:117094390-117094412 TCCTGACCAGGCCTCATCTGGGG + Intergenic
996967463 5:129322459-129322481 GCTTTTCCAAGCCTGAGGTGGGG + Intergenic
997206643 5:132054102-132054124 GCCTGGGCAGGACAGAGCTGGGG - Intergenic
997594200 5:135095395-135095417 GCCTGTTCTGGCCAGAGCAGAGG - Intronic
998406681 5:141878271-141878293 GCCGGCCCCGGCCTGGGCTGCGG + Exonic
999637586 5:153638954-153638976 GCCTGTGCAGGCTGGAGCAGGGG + Intronic
1001524520 5:172419128-172419150 GCCTGTTCAGGGCTCAGCTTGGG - Intronic
1002458169 5:179357831-179357853 GCCGGTCCAGGCTGTAGCTGGGG + Intergenic
1002603930 5:180370885-180370907 GCCTGCCCCTCCCTGAGCTGTGG - Intergenic
1002675453 5:180908614-180908636 GCCTGTCCAGGCCTTGGTGGGGG + Exonic
1002741895 5:181440208-181440230 GCCTCCCCAGGGCTGGGCTGTGG - Intergenic
1002929015 6:1620673-1620695 CACGGCCCAGGCCTGAGCTGCGG - Intergenic
1003330201 6:5123159-5123181 GCCTGACAGGGCCTCAGCTGGGG + Intronic
1005166108 6:22923181-22923203 ATCTGTGGAGGCCTGAGCTGGGG - Intergenic
1005564760 6:27079847-27079869 TCCTGTCCAGGCCTGTGGTTGGG + Intergenic
1005674753 6:28142076-28142098 GCTGGTCCAGGCCGCAGCTGAGG + Intronic
1006392121 6:33764552-33764574 GACTGCACAGGCCTGAGGTGGGG - Intergenic
1006922781 6:37637407-37637429 GCCAGTCCAGCCCACAGCTGTGG - Exonic
1007108089 6:39296959-39296981 GCCTGGCCAGCCCTGAGAGGGGG + Intergenic
1007729397 6:43936743-43936765 GCCTGGACAGGGCTGAGCTTGGG + Intergenic
1007781876 6:44259062-44259084 GCCAGTACAGTCCTGAGCCGAGG - Exonic
1009192874 6:60650701-60650723 GCCAGGCCAGGGCTGGGCTGGGG - Intergenic
1009411542 6:63370666-63370688 CCCTGCCCAGGCCTCAGCTGGGG - Intergenic
1010259143 6:73795476-73795498 ACCTGGCCAGGACTGACCTGAGG - Intronic
1012910572 6:105113224-105113246 GCCTGGCCAAGCATGAGCTCTGG + Intronic
1013518403 6:110910583-110910605 GCCTGTCCTGGGGTGAGATGGGG + Intergenic
1014046809 6:116898216-116898238 GCCTTTCCAGTGGTGAGCTGGGG + Intronic
1014498514 6:122157375-122157397 GCCTGACCAGCACAGAGCTGTGG - Intergenic
1016942317 6:149492983-149493005 GCCTGTGCCTGCCTGTGCTGGGG + Intergenic
1016958298 6:149648338-149648360 GCCTGCCTGTGCCTGAGCTGAGG - Intronic
1017093688 6:150784627-150784649 GCCTGTCCAGGTTGGAGCAGAGG + Intronic
1018262445 6:161984050-161984072 GCCTGTTCACCCCTGGGCTGGGG - Intronic
1018974435 6:168554550-168554572 GCCTGTGCAGGCCTGAGACGGGG - Intronic
1019173502 6:170148024-170148046 GCGTGTCCAGGGCCGAGCTCGGG - Intergenic
1019247036 6:170715965-170715987 GCCTCCCCAGGGCTGGGCTGTGG - Intergenic
1019294843 7:268483-268505 GACTGTGCAGGTTTGAGCTGTGG - Intergenic
1019746456 7:2702907-2702929 GCCTGCCTTGGCCTGAGCGGCGG - Intronic
1023684654 7:42721884-42721906 GCCTGGCCGGGGCTGGGCTGGGG - Intergenic
1024668625 7:51569815-51569837 GCTGGTGCAGGACTGAGCTGAGG + Intergenic
1027430714 7:78109985-78110007 GCGTGCTCAGGCCTGAGCAGGGG - Intronic
1029551410 7:101238969-101238991 TCCTGTGCTGGCCTGGGCTGTGG + Intergenic
1030304924 7:108007821-108007843 GCCTGTCCAGGGCTTTGCTCTGG + Intergenic
1031196432 7:118620305-118620327 GCTGGTGCTGGCCTGAGCTGGGG - Intergenic
1031197094 7:118628888-118628910 GCTGGTGCTGGCCTGAGCTGGGG + Intergenic
1032474512 7:132202995-132203017 GAAAGTCCAGGCCTGAGCAGAGG + Intronic
1032548852 7:132765910-132765932 AGCTCTCCAGGCCTGAGCTGGGG - Intergenic
1034547339 7:151797510-151797532 GCCTTTGCAGGCCTCAGCTCTGG - Intronic
1034943626 7:155248184-155248206 GGGTGTCCAGCCCTGAGCTGAGG - Intergenic
1034978837 7:155463173-155463195 GCTGGTCCAGGCTTGAGGTGTGG - Exonic
1035277763 7:157758263-157758285 GCCTGGACAGGCCTGGACTGTGG - Intronic
1035501105 8:91988-92010 GCCTCCCCAGGGCTGGGCTGTGG + Intergenic
1036097642 8:5741472-5741494 CCCTCTCCAAGCCTGAGCAGGGG - Intergenic
1038714691 8:29981176-29981198 CCCTGGCCAGGCCTGGTCTGAGG - Intergenic
1040063485 8:43124866-43124888 GCCTGAGCAGGCCTGGGCTGCGG - Intergenic
1040331160 8:46386467-46386489 GCTTGTCCAGGACTGCCCTGGGG - Intergenic
1040337722 8:46424531-46424553 GCCTGCCCAGGACAGACCTGGGG - Intergenic
1041673765 8:60517429-60517451 GCCTGGCCAGGCCCGGTCTGCGG + Intronic
1047759007 8:127940208-127940230 GCCTGTCCAGGCCTGGATTATGG - Intergenic
1049365812 8:142236360-142236382 GCCTGGCCAGGGCTGAGCCCAGG + Intronic
1049439459 8:142602579-142602601 TTCTGTCCAGGGCTGAGCTGAGG + Intergenic
1049473394 8:142786120-142786142 GGCTGTCCTGGGCTGTGCTGGGG + Intronic
1049478486 8:142807877-142807899 ACCTTCCCAGGCCTGGGCTGAGG - Intergenic
1049574556 8:143384296-143384318 GCCTGTCGAGACCCAAGCTGGGG + Intergenic
1049584495 8:143426647-143426669 GCATGGCCGGGCCCGAGCTGTGG - Intronic
1049655011 8:143793476-143793498 GCCTGTGAGGGGCTGAGCTGGGG + Intronic
1049683585 8:143930482-143930504 GCTTGGCCAGGCCTGAGAGGTGG + Exonic
1049761361 8:144333189-144333211 GCCTGCACAGGGCTGAGCTGTGG + Exonic
1057234041 9:93344966-93344988 GCCTGTCGAGGGTTGAGGTGAGG - Intronic
1057306090 9:93912813-93912835 GTCTGTGGAGGCCTGAGCTGAGG - Intergenic
1057857759 9:98615089-98615111 GCCAGCCCAGGGCTGACCTGAGG - Intronic
1059435488 9:114273491-114273513 GCCTGCTGAGGCCTGAGCTCTGG - Intronic
1060402432 9:123356456-123356478 GTGGGTGCAGGCCTGAGCTGTGG + Intronic
1060419873 9:123460681-123460703 GCCTGTCCAGGCCTACGCCAAGG - Intronic
1060976899 9:127770315-127770337 GCCATCCCAGGCCTAAGCTGGGG - Intronic
1061577805 9:131518556-131518578 GCTTGGCCTGTCCTGAGCTGTGG + Intronic
1061855776 9:133441275-133441297 GCCCGGCCTGGCCTGATCTGTGG - Intronic
1062303452 9:135888772-135888794 GCCTCTCCAGGATGGAGCTGGGG - Intronic
1203607807 Un_KI270748v1:71424-71446 GCCTCCCCAGGGCTGGGCTGTGG - Intergenic
1185629587 X:1506488-1506510 TCCTTTTCAGCCCTGAGCTGGGG + Intronic
1186816053 X:13239084-13239106 GAGTGTCCAGGTCTGAGCTGGGG - Intergenic
1195616725 X:106918340-106918362 GACTCCCCAGGCCTGAGCTCAGG + Intronic
1198638678 X:138730168-138730190 GCATGTCCAGGCCTGTCGTGGGG + Intronic
1200005972 X:153084461-153084483 GTCTGTTCAGGGGTGAGCTGGGG + Intergenic
1201152868 Y:11103330-11103352 GCCTGCCCAGGTCTGTGCTGAGG - Intergenic