ID: 1174272797

View in Genome Browser
Species Human (GRCh38)
Location 20:49381716-49381738
Sequence GCCTGTCCAGGCCTGAGCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174272797_1174272809 26 Left 1174272797 20:49381716-49381738 CCCCAGCTCAGGCCTGGACAGGC No data
Right 1174272809 20:49381765-49381787 GTTGGGCTTGGCAGAACTCCAGG No data
1174272797_1174272806 14 Left 1174272797 20:49381716-49381738 CCCCAGCTCAGGCCTGGACAGGC No data
Right 1174272806 20:49381753-49381775 GATCTGAGCCCAGTTGGGCTTGG No data
1174272797_1174272802 -8 Left 1174272797 20:49381716-49381738 CCCCAGCTCAGGCCTGGACAGGC No data
Right 1174272802 20:49381731-49381753 GGACAGGCCTCTGCTTTTCTGGG No data
1174272797_1174272804 8 Left 1174272797 20:49381716-49381738 CCCCAGCTCAGGCCTGGACAGGC No data
Right 1174272804 20:49381747-49381769 TTCTGGGATCTGAGCCCAGTTGG No data
1174272797_1174272801 -9 Left 1174272797 20:49381716-49381738 CCCCAGCTCAGGCCTGGACAGGC No data
Right 1174272801 20:49381730-49381752 TGGACAGGCCTCTGCTTTTCTGG No data
1174272797_1174272805 9 Left 1174272797 20:49381716-49381738 CCCCAGCTCAGGCCTGGACAGGC No data
Right 1174272805 20:49381748-49381770 TCTGGGATCTGAGCCCAGTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174272797 Original CRISPR GCCTGTCCAGGCCTGAGCTG GGG (reversed) Intronic