ID: 1174276797

View in Genome Browser
Species Human (GRCh38)
Location 20:49409861-49409883
Sequence CTGTCTGAGCAAAGGTAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 280
Summary {0: 1, 1: 0, 2: 2, 3: 33, 4: 244}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174276797_1174276805 -4 Left 1174276797 20:49409861-49409883 CCTCCCTACCTTTGCTCAGACAG 0: 1
1: 0
2: 2
3: 33
4: 244
Right 1174276805 20:49409880-49409902 ACAGGATCCCCTGCCTGGGGTGG 0: 1
1: 0
2: 4
3: 21
4: 291
1174276797_1174276804 -7 Left 1174276797 20:49409861-49409883 CCTCCCTACCTTTGCTCAGACAG 0: 1
1: 0
2: 2
3: 33
4: 244
Right 1174276804 20:49409877-49409899 CAGACAGGATCCCCTGCCTGGGG 0: 1
1: 0
2: 3
3: 27
4: 255
1174276797_1174276803 -8 Left 1174276797 20:49409861-49409883 CCTCCCTACCTTTGCTCAGACAG 0: 1
1: 0
2: 2
3: 33
4: 244
Right 1174276803 20:49409876-49409898 TCAGACAGGATCCCCTGCCTGGG 0: 1
1: 0
2: 1
3: 21
4: 164
1174276797_1174276802 -9 Left 1174276797 20:49409861-49409883 CCTCCCTACCTTTGCTCAGACAG 0: 1
1: 0
2: 2
3: 33
4: 244
Right 1174276802 20:49409875-49409897 CTCAGACAGGATCCCCTGCCTGG 0: 1
1: 0
2: 2
3: 22
4: 201

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174276797 Original CRISPR CTGTCTGAGCAAAGGTAGGG AGG (reversed) Intronic
900156772 1:1206294-1206316 CGGTCTGAGCACGGGAAGGGGGG + Intronic
902302277 1:15510682-15510704 CGGCATGAGCAAAGGCAGGGAGG + Intronic
902614417 1:17616075-17616097 TCATCTGAGCAAAGGTAGAGAGG - Exonic
902691887 1:18115157-18115179 CTCTCTGAGCCAAGAAAGGGCGG - Intronic
903340226 1:22649287-22649309 CTGCATGGGCAAAGGCAGGGAGG - Intergenic
903778010 1:25805552-25805574 GTGACTGAGCACAGGTTGGGGGG + Intronic
904254055 1:29243482-29243504 CAGTGTGTGCAAAGGTAGAGAGG - Intronic
904698710 1:32345632-32345654 CTGCCTGTGCAAAGGCAGGAAGG - Intergenic
906713998 1:47953502-47953524 TTGTCTGAGAAATGGTAGGACGG - Intronic
906933502 1:50191796-50191818 CTGTATGAGCAAAGGTATAAAGG + Intronic
907320808 1:53601096-53601118 CTCACAGAGCAAAGCTAGGGAGG + Intronic
908479805 1:64527396-64527418 CTGTCTCACCTAAGGTTGGGAGG - Intronic
910364321 1:86447993-86448015 ATGTTTGAGCAAAGGGTGGGAGG + Intronic
911263466 1:95715357-95715379 CTGTCTGTCCAAAGCTAGGTGGG - Intergenic
913257037 1:116963108-116963130 CTCTGTGGGCACAGGTAGGGAGG - Intronic
917306856 1:173635604-173635626 CTGTCTGGACAAAGGTTGGATGG + Intronic
918309496 1:183275582-183275604 CTCTCTGAGCATAGCTAGGATGG + Intronic
918475240 1:184917570-184917592 AAGTCTGAGTAAAGGGAGGGTGG - Intronic
920659973 1:207907420-207907442 CTGGATGAGCAAAGGTAGGCAGG - Intronic
920686872 1:208116094-208116116 ATGTATGAGCAAAGGCATGGAGG - Intronic
920912577 1:210232640-210232662 CGGCCTGAGCAGAGGGAGGGAGG + Intergenic
922162617 1:223089525-223089547 CTGACTGAGCACAGGGATGGGGG - Intergenic
922432572 1:225570477-225570499 CTGTCTTAGGAAGGGTAAGGTGG - Intronic
922551369 1:226496988-226497010 CTGTGGGAGCAAAGACAGGGTGG + Intergenic
923815257 1:237370538-237370560 CTGTCTCAGGAATGGTAGAGGGG + Intronic
924227629 1:241934952-241934974 CTGGCTTAGCTAAGGTAGAGGGG + Intergenic
1065361454 10:24893015-24893037 CTGTATGAGCAAAATTTGGGTGG - Intronic
1065408540 10:25395519-25395541 CTATCAAAGCAAAGGTAGGTAGG - Intronic
1069711625 10:70493080-70493102 CGGAATGAGCCAAGGTAGGGGGG - Intronic
1070469682 10:76766480-76766502 CTGTGTGAAGAAAGGAAGGGAGG + Intergenic
1070545238 10:77446872-77446894 CAGTGTGAACAAAGGTATGGAGG - Intronic
1070671015 10:78377292-78377314 CAGTCTCAGCACAGGTGGGGTGG + Intergenic
1071300875 10:84255249-84255271 CGATCTGAGCAAAGGGAGGGTGG - Intronic
1071450855 10:85790523-85790545 CTGTCTGGGCAGAGGGAGTGGGG + Intronic
1074320486 10:112397539-112397561 CAGCCTGAGCAAAGGCATGGAGG - Intronic
1074629064 10:115229915-115229937 CTTTCTTAGCACAGGTAGGCAGG - Intronic
1075370763 10:121932939-121932961 TTGTATGAGCAGAGGCAGGGAGG + Intergenic
1076614770 10:131748122-131748144 CTCTCTGAGCTAAGGTGGGAGGG - Intergenic
1077485001 11:2834597-2834619 CTGTGCGAGCAGAGGCAGGGAGG + Intronic
1078446602 11:11409492-11409514 CTGGCTGAGCACAGGAAGGCTGG - Intronic
1079361134 11:19771462-19771484 CAGCCTGAGCAAAGGCATGGAGG + Intronic
1081488717 11:43550416-43550438 CTGCATGAGCAAAGGCAGAGAGG + Intergenic
1081571303 11:44293090-44293112 CTGTCTGAGAGAAGGAAGGAAGG + Intronic
1081595352 11:44454956-44454978 CTGTCTGAGCAGAGTTTGAGAGG + Intergenic
1081632526 11:44699579-44699601 CTGCATGAGCAAAGGCATGGAGG + Intergenic
1081824838 11:46039244-46039266 CTGTTTTAGTATAGGTAGGGTGG + Intronic
1081880300 11:46444489-46444511 CTGTCTGATCAGAAGGAGGGTGG - Intronic
1082902769 11:58273761-58273783 CAGTCTGTGCAAAGGTCTGGTGG - Intergenic
1083243824 11:61410102-61410124 TTGTCTGAAAAAAGGTAGGGAGG - Intronic
1083254831 11:61489666-61489688 CAGCATGAGCAAAGGTGGGGAGG + Intronic
1084184244 11:67463305-67463327 CTGAGTGAGCAAGGGTTGGGAGG - Exonic
1084943669 11:72627498-72627520 CAGTGTGAGCAAAGGCAGGGAGG + Intronic
1085084303 11:73656487-73656509 CTGAGTGAGCAAAGGAAGGAAGG + Intronic
1085099095 11:73785465-73785487 TTGTAGGAGCAAAGGCAGGGAGG + Intergenic
1085448728 11:76617895-76617917 ATGTGTGAGAGAAGGTAGGGTGG - Intergenic
1086436187 11:86783061-86783083 CTTTCAGAGCAAAGGCAGAGGGG + Intergenic
1086521836 11:87677436-87677458 CTAGCTGAGTAAAGGTAGGAAGG + Intergenic
1088156063 11:106805203-106805225 CTGTCAGAGTAAAGGTAGAGGGG - Intronic
1089083772 11:115799609-115799631 GGGTCTGAGCAAAGGCTGGGAGG + Intergenic
1089295763 11:117466670-117466692 CTGTCTCAACAAAAGGAGGGTGG + Intronic
1090234762 11:125139300-125139322 CTGTCTGGGTAAAGGTGGGGTGG - Intergenic
1090266907 11:125359071-125359093 CTGTGGGAGCAAAGGCAGGAAGG + Intronic
1091323882 11:134669882-134669904 CTGTGTGTGCACAGGGAGGGGGG + Intergenic
1091674203 12:2476731-2476753 TTGTCTTAGCAAAGGGATGGTGG - Intronic
1092758707 12:11789573-11789595 CTTCCTGAGAAAGGGTAGGGGGG + Intronic
1092962556 12:13609885-13609907 CTGTCTATGCAAAGGTTAGGTGG - Intronic
1094126084 12:27023410-27023432 CTGTCTGAGCCAAAGTAGCTGGG + Intronic
1095852312 12:46824141-46824163 GTGTCTGAGCATAGATAGGCAGG + Intronic
1095939394 12:47716241-47716263 CTGTCTGAGCGAAGCCAGGTGGG - Intronic
1096618021 12:52845366-52845388 CTGTCTGAGGAAATGCAGGAAGG - Intronic
1097282196 12:57852009-57852031 CTGCCTGTGCAAAGGTAGGGAGG - Intergenic
1099586381 12:84522038-84522060 CTGTCTGAGGAAAAGTAGACAGG - Intergenic
1101502319 12:105315673-105315695 CTGCATGAGCAAAGGTATGGTGG + Intronic
1102028862 12:109728575-109728597 CAGTCTGAGCAAAGGCACAGAGG - Intronic
1102419364 12:112791731-112791753 CTGTGTGAGCAAGGGAAGCGGGG - Exonic
1104599832 12:130145227-130145249 CAGCCTGAGCAAAGGTGGTGGGG - Intergenic
1104867148 12:131963114-131963136 CTTTCTAAGCACAGGTAAGGGGG - Intronic
1106546000 13:30731707-30731729 CTTTCTGGGCAATGGGAGGGGGG + Intronic
1107305606 13:39015007-39015029 CAGTATGAGCAAATGTATGGGGG - Intronic
1108116471 13:47134229-47134251 CTGGATGAGCTAAGGTAGGATGG + Intergenic
1108805473 13:54150226-54150248 TTGTCTGAGCAGAGATAGAGTGG + Intergenic
1112025973 13:95411463-95411485 CTGTCTGAGCATAAGGTGGGGGG + Intergenic
1114416452 14:22548043-22548065 CAGTCTGAGCAAAGGCAGGCAGG - Intergenic
1115755191 14:36521725-36521747 CTCCCTGCGCAAACGTAGGGTGG - Intergenic
1118570251 14:67187749-67187771 CAGTCTGAGCAAAGGCACAGAGG - Intergenic
1120486457 14:85120059-85120081 TGGTCTGACCAAAGGTGGGGGGG + Intergenic
1122119350 14:99543650-99543672 CAGCCTGAGCAAAGGCAGGGAGG + Intronic
1122774928 14:104112921-104112943 CAGCCTGGGCAAAGGCAGGGTGG - Exonic
1122911058 14:104827764-104827786 CTGGCTGAGCAAAGGACAGGAGG - Intergenic
1126267826 15:46775043-46775065 TTCTCTAAGCAAAGGGAGGGAGG + Intergenic
1126339105 15:47620119-47620141 CTGTCTGGGCAAAAGATGGGAGG - Intronic
1127697508 15:61465518-61465540 GTGTCTGAGCAAAAGTAATGTGG + Intergenic
1128087225 15:64894625-64894647 CAGCCTGGGCAAAGGCAGGGAGG + Intronic
1129283638 15:74506105-74506127 CTGCCGGTGCAAAGGCAGGGTGG - Intergenic
1129713873 15:77835941-77835963 CTGTGTGAGCAAAGGCTTGGAGG - Intergenic
1130373638 15:83308857-83308879 CTTGCTGAGCAAAGGCACGGAGG - Intergenic
1130793169 15:87178357-87178379 CTGTCTGAGGAAAGGTGGGGAGG + Intergenic
1132375345 15:101325047-101325069 CTGTAGGAGCAAAGGCAGGAGGG + Intronic
1132548455 16:544292-544314 CTGTCTGGGCACAGGTTGCGGGG + Intronic
1133338805 16:5023483-5023505 CTGTCACAGCAAAGTTAGAGGGG - Intergenic
1133481918 16:6179083-6179105 CTGTCTTACCACAGGGAGGGTGG + Intronic
1134473414 16:14548946-14548968 CTGTCTCAGAAAAGGAAGAGGGG + Intronic
1134818606 16:17227325-17227347 CTGCATGTGCAAAGGTATGGTGG + Intronic
1134858218 16:17538120-17538142 CTAGCTGGGCAAAGGCAGGGTGG + Intergenic
1135181830 16:20281544-20281566 GTGTCTGAGGAATGGCAGGGAGG + Intergenic
1135557697 16:23450878-23450900 TTGTTTAAGAAAAGGTAGGGAGG - Intronic
1136145502 16:28313962-28313984 CTGGCTGAGCAAGGGTGGGCGGG - Intronic
1138160453 16:54748323-54748345 GTTTCTGAGCAAAGAAAGGGTGG + Intergenic
1139438035 16:66948178-66948200 CCGCTTGAGCAAAGGCAGGGAGG - Intergenic
1139946925 16:70647993-70648015 CAGTGTGAGCAAAGGTTTGGCGG + Intronic
1140107382 16:71973180-71973202 CTGCCTGGGCAAAAGGAGGGAGG - Intronic
1141765112 16:86053002-86053024 CTGCCTGAGCAAAGGCCTGGAGG + Intergenic
1142907361 17:3053133-3053155 CTCTCTAAGCAAAGGGAGGAGGG - Intergenic
1142927202 17:3251108-3251130 CTCTCTAAGCAAAGGGAGGAGGG + Intergenic
1144018135 17:11216412-11216434 CTGTCTGAGAAATGGGAGGATGG - Intergenic
1144537656 17:16106834-16106856 ATGTCTGATCAAGTGTAGGGTGG - Intronic
1144765408 17:17729883-17729905 CTATGTTAGCAAAGGTAGAGTGG + Intronic
1144851965 17:18248388-18248410 CAGTATGAGCAAAGGTCTGGAGG - Intronic
1145953683 17:28839942-28839964 TTACCTGAGTAAAGGTAGGGAGG - Intronic
1146546299 17:33741760-33741782 CTGCCTGAGCATGGGTAGGCTGG - Intronic
1146920459 17:36706689-36706711 CTCAGTGAGCAAAGGTAGGTGGG - Intergenic
1149559097 17:57595526-57595548 CTGTCTGTACACAGGAAGGGGGG - Intronic
1149596813 17:57869074-57869096 CTGTCTCAGAAAAGCTGGGGAGG + Intronic
1150591143 17:66563801-66563823 CTGTCTGTGCAGAGGTACGTTGG + Intronic
1157824072 18:50796645-50796667 CAGACTGAGCAAAGGTGAGGGGG + Intronic
1158859708 18:61580460-61580482 TTGTTTGAGCAAAGGAAGGTGGG - Intergenic
1160802621 19:977316-977338 CTGTCAGAGCAAAGGGGGAGAGG - Intergenic
1161651012 19:5484833-5484855 CTGTGTGAGCAAACGCGGGGAGG + Intergenic
1162136935 19:8561237-8561259 CTGTCTGGGGAAAGGTGTGGAGG + Intronic
1162875136 19:13615886-13615908 TTGTCTATGCAAAGATAGGGGGG - Intronic
1163120680 19:15215632-15215654 CTGAATGAGCAAAGGTGAGGAGG + Intergenic
1164776749 19:30858742-30858764 GTGTCTGGGCTAAGGAAGGGAGG + Intergenic
1168714473 19:58518943-58518965 CTGGCTGAGCAAAGGGACGGCGG - Intronic
926942916 2:18156696-18156718 CTGTCAGAGTCAAGGGAGGGTGG + Intronic
927708078 2:25309259-25309281 ATGTCTGAAGAAAGGGAGGGAGG + Intronic
928167425 2:28981355-28981377 CTGTCTGAGCAGGGGCTGGGTGG - Exonic
928379472 2:30805223-30805245 CTATCCGAGCAAGGGTAGAGAGG - Intronic
928768707 2:34679108-34679130 ATGTCTGAGAACAGGTAGGTAGG + Intergenic
929791106 2:45023792-45023814 ATGGCTGGGCAAAGGAAGGGAGG - Intergenic
930246648 2:48990430-48990452 CTGGGTTAGCAAAGATAGGGAGG - Intronic
931292270 2:60883098-60883120 CAGCGTGAGCAAAGGCAGGGAGG + Intronic
931384588 2:61786626-61786648 CCATCTGAGCAAAGGCATGGAGG + Intergenic
936522284 2:113218948-113218970 CTGTTTGGGCAAGGCTAGGGAGG - Intronic
938183534 2:129207007-129207029 CTGTCTGGGCAAAGCTGGGAAGG - Intergenic
939953991 2:148509656-148509678 CTGTGTGATCAGAGGAAGGGCGG - Intronic
941754308 2:169168221-169168243 AAGTCTGAGGAAGGGTAGGGAGG - Intronic
942132417 2:172893263-172893285 ATGCCTGGGCAAAGGCAGGGAGG + Intronic
942309972 2:174647109-174647131 GTGTCTGATCAAAAGTAAGGAGG + Intronic
942985181 2:182132163-182132185 CTGTCTGAGGAAAGGTTTGATGG + Intergenic
944193016 2:197023496-197023518 CTGGCTGCGTAAAGATAGGGTGG - Intronic
945618069 2:212098350-212098372 CTGTTTGAGGAAAGGCAGTGAGG + Intronic
947119807 2:226801604-226801626 CTGTCAGAGGAAAAGAAGGGAGG - Intergenic
1168764406 20:372018-372040 CTTTCTGAGAAAAGCTTGGGGGG - Intronic
1168961880 20:1875649-1875671 CTGCATGAGCAAAGGTAAGGAGG - Intergenic
1169981426 20:11389065-11389087 CTGTCTGAGGCAGGGTAGAGAGG - Intergenic
1170213425 20:13868107-13868129 TTCTGTGAGCAAAGGTAGAGTGG - Intronic
1170658933 20:18317251-18317273 CTGTCAGAGCCAAGGGATGGGGG - Intergenic
1172515468 20:35529744-35529766 GTGTCAGAGAAAGGGTAGGGTGG - Intergenic
1172845028 20:37925152-37925174 CCCTGTGAGCAAAGGTAGGGAGG - Intronic
1173665041 20:44757261-44757283 CAGAGTGAGCAAAGGAAGGGTGG - Intronic
1173826538 20:46051421-46051443 CTGTATGAGCAGTGGGAGGGTGG + Intronic
1173844589 20:46179881-46179903 CTTTATGAGGAAAGGCAGGGCGG - Intronic
1174276797 20:49409861-49409883 CTGTCTGAGCAAAGGTAGGGAGG - Intronic
1174897597 20:54467523-54467545 TTGTCTAGGCAAAGGTAGAGAGG - Intergenic
1176122126 20:63458660-63458682 CTGTCTGAGCAGAGGATGTGGGG - Intronic
1177628967 21:23701890-23701912 GTGTCTGTGCAAAGGTAGGATGG - Intergenic
1178482042 21:32987885-32987907 CAGCCTGAGCTAAGATAGGGAGG - Intergenic
1178507746 21:33176685-33176707 ATGTCTGAGCAAAGACATGGGGG - Intergenic
1179008497 21:37534780-37534802 CTGCATCAGCAAAGGTAGGAAGG + Intergenic
1179546886 21:42118606-42118628 CAGTCTGGGGAGAGGTAGGGAGG + Intronic
1179669796 21:42938656-42938678 CTATCTGAGGAAAGGGAGGGGGG + Intergenic
1180954183 22:19734154-19734176 CTGTCTGAGCAGGGCTGGGGAGG + Intergenic
1181409856 22:22711218-22711240 CTCCCAGAGCAAAGGCAGGGAGG - Intergenic
1181604005 22:23969108-23969130 TTGTCTGAGCAAAGGGAGAGTGG - Intronic
1181604508 22:23972198-23972220 TTGTCTGAGCAAAGGGAGAGTGG + Exonic
1181623484 22:24106545-24106567 CTGGGTGAGTCAAGGTAGGGAGG - Intronic
1181665483 22:24393022-24393044 CTGTGTCATCAAAGGTGGGGTGG - Intronic
1181761995 22:25065074-25065096 CTGCCTGAGCATAGGCAGGGAGG + Intronic
1182455253 22:30446338-30446360 TGGCCTGAGCAAAGGCAGGGAGG - Intergenic
1182747114 22:32614537-32614559 CTGTCTGACCAGTGGTGGGGAGG + Intronic
1182825070 22:33257977-33257999 CTGTGAGAGCATAGGTTGGGGGG + Intronic
1183230431 22:36578671-36578693 CTGTCTGAGGCCAGGAAGGGTGG + Intronic
1183413742 22:37671115-37671137 CTGTCTGGACAAAGGCTGGGAGG + Intergenic
1183515363 22:38262447-38262469 CTATATGAGCAAAGGCACGGAGG + Intronic
1183924163 22:41193843-41193865 CTGTCTCAAAAAAGGGAGGGAGG + Intergenic
950032437 3:9861851-9861873 CTGTCTGTGCAAAGGTTGTGAGG + Intergenic
951589209 3:24245003-24245025 CTGTTTGAACAAAGGTCAGGGGG + Intronic
952128022 3:30324889-30324911 CTCTCTGGGCAGAGGTAGGGAGG + Intergenic
954080266 3:48209471-48209493 CGGCCTGAGCAAAGGCATGGTGG - Intergenic
961155265 3:124674441-124674463 CTGTGTGAGCCAAGGTGAGGTGG + Intronic
961167836 3:124775925-124775947 CTGTCTGAGCACAGGAGGGTTGG - Intronic
961181804 3:124883777-124883799 CTGTCTTAGCAAAGGCAGCGTGG + Intronic
963745053 3:149117423-149117445 CAGGCTGAGCAAAGGAAGGTAGG - Intergenic
963789005 3:149564142-149564164 CTGTGTCAGTAAATGTAGGGTGG - Intronic
964551601 3:157890880-157890902 CAGCCTGAGCAAAGGCATGGAGG + Intergenic
966931057 3:184675894-184675916 CTGTATGTGCAAAGAAAGGGAGG + Intronic
967016127 3:185483401-185483423 CTGTAGGAACAAAGGTTGGGGGG + Exonic
967105833 3:186254440-186254462 CAGGCTGTGCAAAGGCAGGGAGG - Intronic
969322104 4:6418540-6418562 CTGGCTGCGCTAGGGTAGGGTGG + Intronic
970322226 4:14886151-14886173 ATGTCTGAGCAGTGGTGGGGAGG - Intergenic
970737679 4:19193802-19193824 CTGTATCAGCAAAGATATGGAGG - Intergenic
971047338 4:22819745-22819767 CAGTGTAAGCAAAGGTGGGGTGG + Intergenic
971196424 4:24474732-24474754 CTGGCTGAGAAAAAGAAGGGAGG + Intergenic
972297261 4:37752071-37752093 CAGTCTGTGCAAAGGCAGGGAGG - Intergenic
972323235 4:37991916-37991938 CTGCATGAGCAAAGGTATGGAGG + Intronic
972630134 4:40835493-40835515 AGGTATGAGCAAAGGCAGGGAGG + Intronic
973258585 4:48137905-48137927 CAGCTTGAGCAAAGGTAAGGAGG - Intronic
975254538 4:72217049-72217071 CTGGCTGTGCAAGGGTGGGGTGG + Intergenic
976006650 4:80438347-80438369 GTGTCTGAGGAATGGCAGGGAGG + Intronic
977989566 4:103424551-103424573 CTGTCTGAGGAATGGTAGGAAGG + Intergenic
978305439 4:107323242-107323264 GTGTCTGAGCCAAGCTGGGGTGG - Intergenic
978416738 4:108484860-108484882 CTGTCTTAGCAAAGATTGGTGGG + Intergenic
983330713 4:166324375-166324397 CTGTCTAGCCAAAGGTAGGGAGG + Intergenic
983373682 4:166897439-166897461 CTGCATGAGCAAAGGTTGGGTGG + Intronic
983832946 4:172352949-172352971 CTGTCTAAGCAAAAGTAAGCTGG - Intronic
986575797 5:9211570-9211592 CAGCCTGAGCACAGCTAGGGTGG - Intronic
987112521 5:14701073-14701095 CTGGCTGAGCCCAGGAAGGGCGG - Intergenic
989173239 5:38494323-38494345 CTGGCTGACCAGGGGTAGGGTGG + Intronic
990304200 5:54479089-54479111 CTCTCTGAGCCAGGGGAGGGTGG + Intergenic
990911116 5:60853247-60853269 CTCTCTGAGCAAACATCGGGAGG - Intergenic
991182075 5:63764123-63764145 CTATTTGAGAAAAAGTAGGGGGG + Intergenic
999121737 5:149215024-149215046 CAGTTTGAGCAAAGGGAGGTAGG - Intronic
1000196000 5:158958504-158958526 CTGACTGAGTAAGGGCAGGGCGG - Intronic
1001435145 5:171694170-171694192 CTGTATAAGCCAAGGCAGGGAGG + Intergenic
1001713438 5:173795663-173795685 CTACCTGAGCAAACGTATGGAGG + Intergenic
1005342614 6:24857499-24857521 GTGTCTGAGCAAAGGAAGGCAGG - Intronic
1006645957 6:35514222-35514244 CAGCCTGAGCAAAGGCATGGAGG - Intergenic
1006920059 6:37621812-37621834 CTGACTGAGCCCAGGAAGGGAGG - Intergenic
1011208908 6:84933342-84933364 ATGTCTGAGCATATCTAGGGAGG - Intergenic
1013265074 6:108488434-108488456 CTGTTGGTGCAAAGGTTGGGGGG + Intronic
1013572723 6:111445860-111445882 CAGTTTAAGCAAAGGTATGGGGG + Intronic
1014215386 6:118747956-118747978 CTGTTAGAGCAAAGGAAGGTAGG - Intergenic
1015414262 6:132930881-132930903 CTGTCTGAGCAGCAGGAGGGAGG + Intergenic
1016286344 6:142477468-142477490 CTGTCTGCACAAAAGTATGGCGG + Intergenic
1018931323 6:168242151-168242173 CTGTCTGAGCAGGGGTAGGCTGG + Intergenic
1019921491 7:4166199-4166221 CTGCCTGGGCAAAGGCAGGGAGG + Intronic
1020241700 7:6400175-6400197 ATGTCCGTGCAAAGGTAGGTGGG + Exonic
1021972765 7:25981664-25981686 CTGTCTTAGCAAAGGGAAAGAGG - Intergenic
1023651365 7:42372715-42372737 CTGTCTGAGCAAAGAGTGGAGGG + Intergenic
1024343050 7:48286507-48286529 CTGTCTGAAAAAAGGAAGGAAGG - Intronic
1024459510 7:49645512-49645534 CTGGCTGTGCAGATGTAGGGAGG + Intergenic
1026735406 7:72945742-72945764 CTGTCTGAGGAGGGGTTGGGCGG + Intronic
1026785744 7:73300672-73300694 CTGTCTGAGGAGAGGTTGGGCGG + Intergenic
1027108321 7:75419264-75419286 CTGTCTGAGGAGAGGTTGGGTGG - Intronic
1029977501 7:104848612-104848634 GTGTCTGAGGAAAGGGAGGGAGG + Intronic
1033589158 7:142796304-142796326 CTGTCTGTGCTAAGGGAGGTGGG + Intergenic
1033616041 7:143015089-143015111 CTGTCTGGGAAAAGGGAGGAAGG + Intergenic
1035017651 7:155780791-155780813 CTGTCGAAGCAAAGGTTGAGAGG - Exonic
1039759368 8:40558157-40558179 TTGCCTGAGCCAAGGCAGGGAGG + Intronic
1040896057 8:52369512-52369534 CTGTCTGGGCATAAGTAGGCTGG - Intronic
1047014563 8:120710075-120710097 CTGTCTGCGGAAACGGAGGGGGG - Intronic
1047127241 8:121976076-121976098 GGGTGTGAGCCAAGGTAGGGAGG + Intergenic
1047752403 8:127891714-127891736 CTTTCTGAGCAGAGCCAGGGAGG + Intergenic
1047772259 8:128038984-128039006 CTGTCTGAGGGAGGGAAGGGAGG + Intergenic
1047791854 8:128211364-128211386 CAGTCTGTGCAAAGGCAAGGAGG + Intergenic
1048382849 8:133883373-133883395 CTGTGAGAGCAAAGGTTGGCAGG + Intergenic
1049505449 8:142994103-142994125 CTGTCTGAGCATGGGTTAGGAGG - Intergenic
1049867010 8:144945904-144945926 CTGTGTCATCACAGGTAGGGAGG - Intronic
1052679729 9:31673982-31674004 CAGTGAGAGAAAAGGTAGGGAGG - Intergenic
1053198152 9:36136027-36136049 CCGCCTGAGGAAAGGCAGGGAGG + Intergenic
1053286328 9:36851717-36851739 CTGCATGAGCAAAGGCAGGGAGG + Intronic
1056431201 9:86529636-86529658 CTGTCTGGACAAAGTTAGGTAGG - Intergenic
1057449927 9:95149284-95149306 CTACCTGAGCAACGGTAGGAGGG + Intronic
1057919525 9:99085514-99085536 CTGTCTGAGGCAAGGTAGTGAGG - Intergenic
1059399829 9:114061955-114061977 CAGTGGGAGCAAAGGCAGGGTGG - Intronic
1059454369 9:114390236-114390258 GTGCATGAGCAAAGGCAGGGAGG - Intronic
1059932781 9:119277909-119277931 TTTTCTAAGCAGAGGTAGGGGGG - Intronic
1059982806 9:119791918-119791940 TTGACTGAGCAAAGGCAAGGAGG + Intergenic
1060602428 9:124887067-124887089 CAGTCTGAGGAAAGGGAGAGAGG + Intronic
1060637339 9:125209735-125209757 CTGTGTGTGCAAAGGCATGGAGG - Intronic
1060815991 9:126635436-126635458 CTGCCTGGGCAAAGGCATGGAGG + Intronic
1061012344 9:127963102-127963124 AGGTCTGACCAAAGGTGGGGTGG + Intronic
1061774041 9:132948774-132948796 CGGCCTAAGCCAAGGTAGGGCGG - Intronic
1185758892 X:2674109-2674131 ATGTGTGAGCAAAGGCAGGAAGG - Intergenic
1187616822 X:21004449-21004471 ATGTCTCAGCTAAGGAAGGGAGG - Intergenic
1190635761 X:52432363-52432385 CTGTCTGAAAAAGGGTGGGGGGG - Intergenic
1196025665 X:111039188-111039210 CTTTGTGAGCAAGGGAAGGGTGG - Intronic
1197256663 X:124270621-124270643 AGGTCTGGGCAAAGGGAGGGTGG + Intronic
1199688814 X:150290658-150290680 ATTTTTGAGCAAAAGTAGGGTGG - Intergenic
1201901443 Y:19048607-19048629 CTGCCTGGGCAAAGGTAAGATGG - Intergenic