ID: 1174278995

View in Genome Browser
Species Human (GRCh38)
Location 20:49424871-49424893
Sequence ACAGGAGCAGGCCCCCTGCA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 361
Summary {0: 1, 1: 0, 2: 5, 3: 41, 4: 314}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174278988_1174278995 18 Left 1174278988 20:49424830-49424852 CCAAGGCACAAAATAGTCTCACA 0: 1
1: 0
2: 0
3: 7
4: 163
Right 1174278995 20:49424871-49424893 ACAGGAGCAGGCCCCCTGCACGG 0: 1
1: 0
2: 5
3: 41
4: 314
1174278987_1174278995 24 Left 1174278987 20:49424824-49424846 CCTGAACCAAGGCACAAAATAGT 0: 1
1: 0
2: 0
3: 11
4: 149
Right 1174278995 20:49424871-49424893 ACAGGAGCAGGCCCCCTGCACGG 0: 1
1: 0
2: 5
3: 41
4: 314
1174278986_1174278995 30 Left 1174278986 20:49424818-49424840 CCAGTGCCTGAACCAAGGCACAA 0: 1
1: 0
2: 0
3: 13
4: 177
Right 1174278995 20:49424871-49424893 ACAGGAGCAGGCCCCCTGCACGG 0: 1
1: 0
2: 5
3: 41
4: 314

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174278995 Original CRISPR ACAGGAGCAGGCCCCCTGCA CGG Intronic
900487287 1:2929186-2929208 ACAGGTGCAGGGCCCATCCACGG - Intergenic
901459350 1:9382457-9382479 ACAGCAGCAGCTCCCCTGCAAGG - Intergenic
901588336 1:10317161-10317183 ACAGGTGCATGCCCCATGCCTGG + Intronic
901700713 1:11043675-11043697 TCAGGGGCTGGCCACCTGCAGGG - Intronic
901878183 1:12179005-12179027 ACATCAGCAGGCCCCTTGGAGGG + Intronic
903035434 1:20489866-20489888 ACAGGACCAGGCCATCTCCATGG + Intergenic
903161338 1:21491254-21491276 ACAGGAGCAGGCTCCGTGCAAGG - Intergenic
903790598 1:25890339-25890361 AAAGGAGCAGGCCTTCTGAAAGG + Intronic
905947565 1:41916865-41916887 CCAGGAGAAGGACCCCTGCAGGG - Intronic
906132338 1:43468177-43468199 ACAGGTGCTGGCTCTCTGCAAGG + Intergenic
908393550 1:63704732-63704754 CAAGGAGCTGGCCACCTGCAAGG - Intergenic
908486625 1:64600525-64600547 ACAGGAGTAGGTACCCTGGATGG + Intronic
909629707 1:77759241-77759263 CCAGGAGCCGGCGCGCTGCAGGG + Intronic
909800876 1:79806117-79806139 ACAGGTGCCGGCTCCATGCAAGG + Intergenic
910427274 1:87130254-87130276 ACAGGAGCTGGGACCCTGCTGGG - Intronic
911025659 1:93433817-93433839 ACAGGTGCCGGCCCCCTGTGAGG + Intergenic
911100676 1:94093576-94093598 ACAAGAGCAGGCCCCTGGGAAGG - Intronic
912390248 1:109297757-109297779 AAAGGAGGAGGCCCCCGGGAGGG - Intronic
912615861 1:111099245-111099267 AAAGGAGCAGGCCTTCTGAAAGG + Intergenic
915507145 1:156365105-156365127 ACAGGCGCAAGCCACCTGCTGGG - Intronic
915555193 1:156657341-156657363 ATTGGAGGCGGCCCCCTGCACGG - Intronic
915691404 1:157694815-157694837 ACAGCAGCAGGCCTCTTTCATGG - Intronic
918142363 1:181730308-181730330 ACTGGGGCAGGCTCACTGCAAGG + Intronic
919514215 1:198501590-198501612 ACAGGAGCATGCTCTCTGCTCGG - Intergenic
919597461 1:199581426-199581448 GCAGGAGCAGGCGTCCTACATGG - Intergenic
919913770 1:202127929-202127951 ACAGGAGCCTGCCCCCACCATGG + Exonic
920637011 1:207713665-207713687 ACAGGAGCGGGCTCCGTGCAAGG + Intronic
921650685 1:217674550-217674572 ACAGGGGCAGCCTCCCTGCAGGG + Intronic
921861215 1:220044388-220044410 ACAGAAACAGGCCACCTTCAGGG + Intronic
922179079 1:223219496-223219518 TCAGGGGCAGAACCCCTGCAGGG + Intergenic
922913753 1:229239139-229239161 GCAGGAGCAAGCTCCATGCAGGG + Intergenic
924320022 1:242839301-242839323 ACAGGAGCAAGCTCCATGCGTGG - Intergenic
1062827065 10:578654-578676 ACAGGAATAGGGCCCCTGCAGGG - Intronic
1063367122 10:5498423-5498445 ACAGGAGCGGGCGCCTCGCATGG - Intergenic
1063537627 10:6900665-6900687 ACAGGAGCAAGCTCCATACAGGG + Intergenic
1064358566 10:14642256-14642278 ACAGGGGCAGGGCCCCTGCCTGG - Intronic
1066702409 10:38143942-38143964 ACAGGTGGAGGCTCCCTCCAGGG - Intergenic
1067088226 10:43253942-43253964 ACAGGGGCAGGACCCCTCTAGGG + Intronic
1069215007 10:65808987-65809009 ACATGAGCATGCCCACAGCAGGG - Intergenic
1069249005 10:66245196-66245218 ACAGGTGCTGGCTCTCTGCAAGG + Intronic
1069821445 10:71230961-71230983 ACAGCAGCAAGCCACCTCCATGG + Intronic
1070167640 10:73910880-73910902 ACTGGGGCAGGCCCCCGGCCAGG + Exonic
1070654943 10:78264967-78264989 ACAGGAGGGGGCAGCCTGCAGGG - Intergenic
1072372479 10:94778370-94778392 AAAGGAGCAGGCCTTCTGAAAGG - Intronic
1072691883 10:97577639-97577661 GCAAGAGCAGGGCCCCTGGAGGG - Intronic
1073472648 10:103732626-103732648 AGAGCAGCCGGCTCCCTGCAAGG - Intronic
1073639903 10:105241304-105241326 ACAGGAGCAAGCTCCATGGAGGG + Intronic
1074464163 10:113667222-113667244 ACAGGAACAAACCCCCAGCATGG - Intergenic
1074588890 10:114793678-114793700 ACAGGAGCAGGCCCATTACTGGG + Intergenic
1076133799 10:128030891-128030913 ACAGGGGCAGGCACCCTGCAGGG + Intronic
1076289286 10:129331958-129331980 ACAGCACCAGGCCGCCTGCCTGG + Intergenic
1076581336 10:131513898-131513920 GCAGGACCCGGCCCCCTGCTCGG - Intergenic
1077200015 11:1302074-1302096 CCTGGAGCAGGCCCCTTGCAGGG - Intronic
1079370536 11:19848346-19848368 CCAGGTGCTGGCCTCCTGCAAGG - Intronic
1079646274 11:22866751-22866773 ACAGGAGCAAGCTCCGTGCGAGG - Intergenic
1080741013 11:35064333-35064355 AAATGAGCAGGGCCCCTGCTGGG + Intergenic
1082810835 11:57477887-57477909 ACAAGAGCAGTTCTCCTGCAAGG + Intergenic
1083096318 11:60254828-60254850 ACAGGAGCAGGCTTCATGCAGGG - Intergenic
1083764697 11:64836242-64836264 TCAGGAGCAGGAGCTCTGCAGGG - Exonic
1083955057 11:65978431-65978453 ACAGACGCTGGCACCCTGCAGGG - Intronic
1084374201 11:68764710-68764732 CCAGGACCAGGGCCCCTGAAAGG + Intronic
1084417176 11:69039534-69039556 ACAGGAGCAAGCCACATGCCTGG + Intergenic
1085053073 11:73389604-73389626 ACAGGATCAGGCCAGCTGCCCGG + Intronic
1085202030 11:74707689-74707711 GCAGCAGCAGCCCCCCTGCACGG + Intronic
1087594376 11:100235355-100235377 AAAGGAGCAGGCCTTCTGAAAGG + Intronic
1087594580 11:100236753-100236775 AAAGGAGCAGGCCTTCTGAAAGG - Intronic
1087602918 11:100339023-100339045 ACAGGAGCAAGCTCTGTGCAGGG + Intronic
1087636360 11:100705931-100705953 ACAGGTGCACTCCCACTGCAAGG - Intronic
1089182901 11:116595175-116595197 ACAGGAGATGGCCCTCTGAATGG - Intergenic
1096570206 12:52518738-52518760 CCAGGCTCAGGCCCTCTGCAAGG - Intronic
1096788307 12:54030322-54030344 CCAGGAGCCGGCTCTCTGCACGG - Exonic
1097298862 12:57997338-57997360 ACAGGTGCTGGCCCTCTGCAAGG + Intergenic
1098387449 12:69934289-69934311 ACAGGAGCAATCTCCATGCAGGG + Intronic
1101340906 12:103841236-103841258 GCAGGAGCTGCCCTCCTGCAGGG - Intergenic
1103485411 12:121279572-121279594 ACAGGACCAGGCCCTCTGCCAGG + Intronic
1103573080 12:121857678-121857700 ACAAGGGCAGGCCTCCAGCAGGG - Intronic
1104412309 12:128569238-128569260 GCTGGAGCAGGCCCCCTGAGGGG + Intronic
1104714164 12:131005609-131005631 GCAGGAGCTGTCTCCCTGCAGGG + Intronic
1105348659 13:19596993-19597015 AGAGTACCAGGCACCCTGCATGG + Intergenic
1105837724 13:24225307-24225329 ACAGGTGCTGGCTCCATGCAAGG + Intronic
1106456883 13:29935502-29935524 ACAGTAGCAGAGCCCCTGCCAGG + Intergenic
1106924534 13:34600287-34600309 GCAGGAGCAGGCATCTTGCATGG - Intergenic
1107353123 13:39537013-39537035 AGAGGAACAGGCCCCATGGAGGG - Intronic
1107356405 13:39571857-39571879 ACAGAAGCAAGCTCCATGCAGGG - Intronic
1109255629 13:60077602-60077624 ACAGGAGGAGGCAGTCTGCATGG + Intronic
1109866647 13:68272937-68272959 ACAGGAGCGGGCTCTGTGCAAGG + Intergenic
1109982383 13:69924898-69924920 ACAGGTGCCAGCTCCCTGCAAGG - Intronic
1111309920 13:86471570-86471592 ACAGGAGCAAGCTCCATGCGGGG + Intergenic
1112879988 13:104095428-104095450 GCAGTGGCAGGCTCCCTGCATGG - Intergenic
1113040342 13:106098334-106098356 GAATGAGCAGGCCCCCTGAAAGG + Intergenic
1113849971 13:113412548-113412570 ACTAGAGCAGAGCCCCTGCATGG + Intergenic
1115406333 14:33021178-33021200 CCAGTACCAGGCCCTCTGCAAGG - Intronic
1115811640 14:37115426-37115448 ACATGAGGACGGCCCCTGCATGG + Intronic
1118486220 14:66216407-66216429 ACAGGAGCAAGCTCTGTGCAGGG - Intergenic
1118521912 14:66595596-66595618 CCAGGTGCCGGCACCCTGCAAGG + Intronic
1118607751 14:67515605-67515627 CTAGGAGCACGCCCCCTGCCAGG + Intronic
1119207181 14:72803118-72803140 ACTGAAGCAGGCCCCTTCCAAGG + Intronic
1119432682 14:74578706-74578728 ACAGGACAAGGCTCCCTGCAGGG - Intronic
1120978022 14:90266594-90266616 ACAGCTGCAGGCCCCCTGTGGGG + Intronic
1121111010 14:91313175-91313197 CAAGGAGCTGGCCCGCTGCAGGG - Exonic
1121527925 14:94632449-94632471 ACAGGTGCTGGCTCCATGCAAGG + Intergenic
1122793881 14:104195938-104195960 GCAGGAGCCGGCCCCCAGCATGG - Intergenic
1122815365 14:104309530-104309552 ACATGAGCAGCCCCCTTGCCCGG + Intergenic
1122850507 14:104525874-104525896 ACAGGTGCAGCCCCTCTGGAGGG + Intronic
1122873421 14:104651684-104651706 ACAGGAGCAGACCCACGGCCCGG + Intergenic
1123025661 14:105422485-105422507 ACAGGAGCAAGCCCCTTCCCAGG - Intronic
1123990922 15:25682652-25682674 ACAGAAGCAGGCCGCATGCACGG - Intronic
1125200493 15:37097802-37097824 AGAAGAGCAGGCCCCCTCCACGG + Intronic
1125733349 15:41906793-41906815 ATAGGAGCAGGCTCTGTGCATGG - Intronic
1125766380 15:42139362-42139384 AAAGGAGCAGGCCTTCTGAAAGG - Exonic
1128749071 15:70135587-70135609 ACAGGAGCAAGGCTCCAGCATGG - Intergenic
1128806053 15:70532120-70532142 TCAGCACCAAGCCCCCTGCAGGG + Intergenic
1129697944 15:77751278-77751300 ACAGGTCAAGGCACCCTGCAAGG - Intronic
1129790347 15:78336965-78336987 TCCAGAGCAGGCCCCCTGCTGGG - Intergenic
1129889355 15:79060881-79060903 ACAGGAGAAGAAGCCCTGCAGGG - Intronic
1130327956 15:82896539-82896561 ACATGGTCAGGCCCTCTGCAGGG + Intronic
1132612648 16:824936-824958 GCAGGGGCAGCCCCCCCGCAGGG - Intergenic
1132872690 16:2122814-2122836 ACACAGGCAGGCCCCCTGGAAGG + Intronic
1132899018 16:2243425-2243447 AGCGGGGCAGGCTCCCTGCAGGG + Exonic
1133211312 16:4264675-4264697 ACTGGAGCAGGCCTGCTGCACGG + Intronic
1133756939 16:8768946-8768968 ACAGGAGGAGGCCCGCTGTCTGG + Exonic
1134551782 16:15142013-15142035 ACACAGGCAGGCCCCCTGGAAGG + Intergenic
1135537562 16:23305815-23305837 CATGGAGCAGGCACCCTGCAGGG + Intronic
1136554475 16:30999714-30999736 TCCTGAGCAGGCCCCCGGCATGG - Intronic
1137448567 16:48549525-48549547 ACACGGGCAGGGACCCTGCAGGG - Intronic
1137675598 16:50302275-50302297 AGAGGAGGAGCCCCCCGGCATGG - Intronic
1138282375 16:55781682-55781704 AGAGGAGCAGCCCCTCTGGAAGG - Intergenic
1138286571 16:55814962-55814984 AGAGGAGCAGCCCCTCTGGAAGG + Intronic
1138681188 16:58684594-58684616 CCAGGATCTGGACCCCTGCAGGG + Exonic
1140271670 16:73471904-73471926 ACAGGAGCAAGCCCGCTGCATGG + Intergenic
1140468757 16:75203207-75203229 AAAGGAACCGGCCCCCTCCATGG + Intergenic
1141063279 16:80894694-80894716 ACAGCAGCAGGCCCGCTGTCGGG + Intergenic
1141594222 16:85087657-85087679 ACAGGGACGGGCCCCCAGCAAGG - Intronic
1141753529 16:85975723-85975745 AGAGAGGCTGGCCCCCTGCAGGG - Intergenic
1142237877 16:88931191-88931213 ACAGGAGCAGGGCCCCTGGGAGG - Intronic
1142796317 17:2310356-2310378 ACAGGCGCCTGCCACCTGCACGG + Intronic
1144217296 17:13067789-13067811 ACAGGAGCAGGCTCCGTGTGGGG + Intergenic
1145111426 17:20165368-20165390 ACAAGATCATGCCCTCTGCAGGG - Intronic
1145918616 17:28592709-28592731 AGAGGAGGTGGCACCCTGCATGG - Exonic
1146198348 17:30832260-30832282 ACTGGAGCGGGCCGCCTCCATGG + Exonic
1146304821 17:31722827-31722849 CCAGGAGCAAGCTTCCTGCATGG + Intergenic
1147886440 17:43687616-43687638 ACTGGAGCAGGCCCCCAGAGCGG + Intergenic
1148779374 17:50112860-50112882 ACAGGCGCTGGCACCCGGCAGGG - Exonic
1150285334 17:63950834-63950856 CCAGCAGCACACCCCCTGCATGG + Intronic
1150345217 17:64399325-64399347 ACTGGAGGGGGCCTCCTGCAGGG - Intronic
1151443485 17:74148577-74148599 TCAGGAACAGGTTCCCTGCAGGG - Intergenic
1151986778 17:77548746-77548768 ACAGGTGCAACGCCCCTGCAGGG - Intergenic
1152597902 17:81246829-81246851 ACAGCAGGAGACCCCCTGCCTGG + Intronic
1152611608 17:81317614-81317636 GCCGGAGCCTGCCCCCTGCACGG + Intronic
1153617163 18:6945777-6945799 CCAGGAGCAGCCCCCATGCAGGG + Intronic
1155310387 18:24517718-24517740 ACAGGAACAAGCTCCATGCAGGG + Intergenic
1156293934 18:35773322-35773344 ACAGGAGCAGAGACCCTGCAGGG - Intergenic
1156476847 18:37410872-37410894 AAGGGAGCAGTGCCCCTGCAGGG - Intronic
1157493255 18:48138365-48138387 TCTGGGGCAGGCTCCCTGCAGGG - Intronic
1159032968 18:63249887-63249909 AGAGGAGCAGGCCCCCAGTGTGG + Intronic
1160083470 18:75753141-75753163 ACAGGTGCTGGCTCCCTGCAAGG + Intergenic
1160438219 18:78867393-78867415 GCAGGAGCAGGCCACCACCACGG + Intergenic
1160710537 19:549164-549186 CAAGGACCAGGCTCCCTGCAAGG + Exonic
1160912645 19:1481974-1481996 CCAGCAGCAGGGCTCCTGCATGG - Exonic
1161251190 19:3281191-3281213 GCTGGAGGAGGCTCCCTGCAGGG - Exonic
1161936253 19:7374048-7374070 AAAGGAGCAGGGGCCCGGCATGG - Intronic
1162101298 19:8340774-8340796 ACTGGAAGAGGCCCCCTGCCTGG - Intronic
1163353604 19:16795297-16795319 ACAGGGCCAGGCTCCATGCAGGG + Intronic
1163455603 19:17404235-17404257 AGTGGAGCAGGGCCCCAGCATGG - Intronic
1163617747 19:18339965-18339987 ACAGGAGGAGGGCCCCTGGGAGG + Intergenic
1164834874 19:31350186-31350208 CCACGGGCAGGCCCCCTCCAGGG + Intergenic
1165730797 19:38143383-38143405 TCAGGAGGAGGACCACTGCAAGG - Intronic
1165872228 19:38981111-38981133 ACAGGGGCAGGCTCCATGTAGGG - Intergenic
1166941989 19:46372900-46372922 TCAGGAGCAGGAGCCCAGCAGGG + Intronic
926163787 2:10505526-10505548 ACAGCCACAGGCACCCTGCAGGG - Intergenic
926577363 2:14596838-14596860 CCAGGAGCAAGGCCCCAGCAAGG + Intergenic
926717991 2:15940053-15940075 ACAGGAGCAACCTCCCTGCAAGG + Intergenic
927472479 2:23386102-23386124 GCCGGAGCAGCCCCCCTGCTGGG + Intronic
927475930 2:23414256-23414278 GCTGGGGCCGGCCCCCTGCAGGG + Intronic
928309105 2:30195049-30195071 ACAGAATCAGACCCTCTGCAGGG - Intergenic
929971990 2:46588112-46588134 ACAGTACCAAGCCCCCTGCAGGG + Intronic
931443373 2:62306911-62306933 CCAGCAGCAGGCTTCCTGCAGGG + Intergenic
932960408 2:76406604-76406626 ACAGGCGCCGGCTCCATGCAAGG - Intergenic
936270039 2:111042390-111042412 AGAGGTGCAGGCTCCCTGCACGG + Intronic
936846619 2:116842362-116842384 ACAGGAGCAAGCTTCATGCAAGG - Intergenic
937302581 2:120852305-120852327 TCAGGAGGAGCCCCGCTGCATGG - Intronic
938089491 2:128421992-128422014 ACAGGAGCAAGCTCTGTGCAGGG + Intergenic
939361912 2:141183530-141183552 ACAAGAGCAGGCCATCTGCCAGG - Intronic
940173063 2:150849677-150849699 ACAGCAGCAAGCTCCCTACAGGG + Intergenic
941928345 2:170917371-170917393 ACAGGAGCGGGCTCCGTGCAGGG + Intergenic
942104082 2:172615044-172615066 ACAGGAGCAAACTCCGTGCAGGG - Intergenic
942639722 2:178048652-178048674 AAAGGGACAGGCCCCTTGCATGG + Intronic
943283713 2:185970495-185970517 AAAGGAGCAGGCCTTCTGAAAGG + Intergenic
943483272 2:188448885-188448907 ACAGGAGCAGGCATGTTGCATGG - Intronic
946907479 2:224430487-224430509 ACAGGAGCAAGCTCCATGCAGGG - Intergenic
947053640 2:226075532-226075554 ACAGGAGCAAGCTCCATGCAGGG - Intergenic
948372982 2:237502403-237502425 AAAGGAGCAGGCCTCCTCCTGGG + Intronic
948643798 2:239391443-239391465 TCAGCAGCAGGCCCCGGGCAGGG + Intronic
948680515 2:239631188-239631210 ACTGCAGCAGGCCCTGTGCACGG + Intergenic
948942098 2:241201728-241201750 TCAGGAACAGGCCTCCTGCCGGG - Intronic
949077997 2:242073590-242073612 ACAGGAGCAGAACCTCTGCGGGG + Intergenic
1169959084 20:11138799-11138821 CCAGGGGCAGCCCACCTGCAAGG - Intergenic
1170779268 20:19409251-19409273 GCAGGAGCAGAGGCCCTGCAGGG + Intronic
1174278995 20:49424871-49424893 ACAGGAGCAGGCCCCCTGCACGG + Intronic
1174353861 20:49985751-49985773 ACAGCTGCTGGCCCACTGCATGG + Intronic
1174542887 20:51303786-51303808 ACAGGGGTAGGCTCCCTGCTGGG + Intergenic
1174674582 20:52341152-52341174 ACAGGAGCAGCCTCTCTCCAGGG + Intergenic
1175505728 20:59482949-59482971 ACAGGAGCAGGGCCCAGGCGGGG + Intergenic
1175793106 20:61754574-61754596 ACAGGTGCAGGCACACTGCCCGG + Intronic
1175816643 20:61886518-61886540 ACAGGAGCATGCATCCAGCAGGG + Intronic
1176229512 20:64024832-64024854 ACAGGAGCAGGGGCCGTGAAGGG + Intronic
1176973158 21:15289456-15289478 ACGGGTGCCGGCTCCCTGCAAGG + Intergenic
1176976348 21:15326559-15326581 TCAGGAGCAGGCTCTGTGCAGGG + Intergenic
1179599766 21:42469143-42469165 ACAGGCACAGGCCCCTTGCAAGG + Intergenic
1179991245 21:44949264-44949286 TCAGGAGCAGCCCCCGGGCAAGG - Intronic
1179999649 21:44989538-44989560 ACAGGAGCAGGCCCCATGGTAGG - Intergenic
1180087938 21:45516385-45516407 GCAGAAGCAGGCCACCTGCCAGG - Intronic
1180303431 22:11054962-11054984 GCAGGAGAAGGTCTCCTGCAGGG + Intergenic
1180918342 22:19505230-19505252 ACAGGAGCTGTTCCCATGCAGGG - Intronic
1181086503 22:20441965-20441987 ACAGGGGCAGGGGCCCTGCCTGG + Exonic
1182091327 22:27596887-27596909 AGAGGAGCAGGGCCCATGGAGGG - Intergenic
1184019629 22:41812143-41812165 ACAGGAGTAAGCCACCTGCTTGG - Intronic
1184795304 22:46728717-46728739 ACAGCAGCAGGCCCGCTGGCTGG + Intronic
1184870371 22:47233915-47233937 ACAGGAGCGGGCCCTGTACAAGG - Intergenic
1185091618 22:48778756-48778778 CCAGGAGCAGGGCCACTGCACGG + Intronic
1185244951 22:49768644-49768666 TCACGTGCAGGCCCCCTCCAGGG + Intergenic
952408655 3:33027228-33027250 ACAGGCGCCAGCCCTCTGCAAGG - Intronic
954441986 3:50527007-50527029 ACAGGAATAGGCACCCAGCATGG - Intergenic
956783600 3:72624050-72624072 ACAAGAGAAGGGGCCCTGCAAGG - Intergenic
961311502 3:126004767-126004789 ACAGGCGCCGGCTCCATGCAAGG - Intergenic
962241769 3:133756244-133756266 ACATCAGCAGGGCTCCTGCAGGG - Intronic
963774669 3:149426320-149426342 ACAGGGGCAGGCACAGTGCAGGG + Intergenic
964075070 3:152683821-152683843 ACAGGTGCCGGCTCCCTGCAAGG + Intergenic
965123751 3:164596578-164596600 AAAGGAGCAGTCCTCCTGTAAGG - Intergenic
965562744 3:170077451-170077473 AAAGGAGCAGGCCTTCTGAAAGG + Intronic
965562933 3:170078868-170078890 AAAGGAGCAGGCCTTCTGGAAGG + Intronic
965756697 3:172034861-172034883 GCAGGAGCAGGCGTCCTACACGG + Intergenic
966651364 3:182304503-182304525 ACACCAGCAGGCACCATGCATGG - Intergenic
966880000 3:184344826-184344848 GGAGGAGCCAGCCCCCTGCAAGG + Exonic
967725900 3:192862128-192862150 ACAGAAGCAGACTCCCTGGAAGG + Intronic
968561595 4:1286057-1286079 ACAGACGCAGGCTCCATGCAGGG + Intergenic
968621163 4:1604082-1604104 GCAGGGGCAGGCACCCTGCCTGG - Intergenic
968674377 4:1870111-1870133 ACAGGTGCTGGGCCCCTGTATGG - Intergenic
969500393 4:7549087-7549109 GCAGGAGCGTGCCCCCAGCAAGG + Intronic
971791359 4:31173795-31173817 ACAAGAGCATGCCCTTTGCAGGG - Intergenic
972075411 4:35080134-35080156 ACAGGTGCTGGCTCCATGCAAGG - Intergenic
973279243 4:48341849-48341871 AAGGGAGCCGGCGCCCTGCACGG - Exonic
974640661 4:64625526-64625548 AAAGGAGCAGGCCTTCTGAAAGG - Intergenic
974683390 4:65194246-65194268 ACAGGCACTGGCTCCCTGCAAGG + Intergenic
975220817 4:71810316-71810338 AAAGGAGCAGGCCTTCTGAAAGG - Intergenic
976504561 4:85832064-85832086 AGAGGGGCAGGCCACATGCAGGG + Intronic
979648856 4:123106974-123106996 ACAGGTGCTGGCTCCATGCAAGG + Intronic
979708544 4:123750119-123750141 CCAGAAACAGGCCTCCTGCAGGG + Intergenic
980081681 4:128350977-128350999 ACAGGAGCAAGCTCTGTGCAGGG - Intergenic
980480878 4:133385504-133385526 ACAGGTGCCGGCTCCTTGCAAGG - Intergenic
981591692 4:146371305-146371327 ACAAGGGCAGGCGCCCTGTAAGG - Intronic
983355822 4:166656226-166656248 AAAGGAGCAGGCCTTCTGAAAGG - Intergenic
984966695 4:185145634-185145656 ACAGGGGCAGGTTCCCCGCAAGG + Intronic
985490418 5:175570-175592 ACACGACCAGGGCTCCTGCACGG + Intronic
985490434 5:175628-175650 ACACGACCAGGGCTCCTGCACGG + Intronic
985490451 5:175687-175709 ACACGACCAGGGCTCCTGCACGG + Intronic
985490468 5:175746-175768 ACACGACCAGGGCTCCTGCACGG + Intronic
985490485 5:175805-175827 ACACGACCAGGGCTCCTGCACGG + Intronic
985490502 5:175864-175886 ACACGACCAGGGCTCCTGCACGG + Intronic
985490518 5:175922-175944 ACACGACCAGGGCTCCTGCACGG + Intronic
985490534 5:175980-176002 ACACGACCAGGGCTCCTGCACGG + Intronic
989734419 5:44686815-44686837 ACAGTAGCAGGCTTCCTCCAAGG - Intergenic
992325226 5:75653935-75653957 GGAGGAGCTGGGCCCCTGCAAGG + Intronic
992752245 5:79872176-79872198 ACAGGAGCAGCCCTCATGGAGGG + Intergenic
993404969 5:87499968-87499990 ACAGGAATAGGCTCCATGCAGGG - Intergenic
993761693 5:91803228-91803250 ACAGGAGCAGGCTCTGTGCAGGG - Intergenic
994692257 5:103033920-103033942 ACAGGTACTGGCTCCCTGCAAGG + Intergenic
996923805 5:128799809-128799831 AGAGGAGCTGCCCCCCTCCAGGG - Intronic
997646683 5:135486818-135486840 ACAGCAGCAGTTCCCCTCCATGG - Intergenic
999174674 5:149623684-149623706 ACAGGGACAGGCCACATGCATGG - Intronic
999682124 5:154070236-154070258 AAAGGAGCAGGCCTTCTGAAAGG - Intronic
1001074405 5:168614851-168614873 CCAGGAGCAGGCTCCATGCGGGG + Intergenic
1001691155 5:173633556-173633578 ACAGGAGCTGGGCGCCTCCATGG + Intergenic
1001761602 5:174212275-174212297 ACAGGAGAAGGCTCCCAGAAAGG - Intronic
1001989418 5:176104003-176104025 ACATGAGCAGGCCCCTTGCACGG - Intronic
1002191469 5:177480077-177480099 CCAGGAGCAGGGCCCACGCAGGG - Intergenic
1002227454 5:177734135-177734157 ACATGAGCAGGCCCCTTGCACGG + Intronic
1002613395 5:180435884-180435906 AGAGGAGCAAGCCCCAGGCAAGG - Intergenic
1003745795 6:9000474-9000496 ACAGGATCATGCCCTTTGCAGGG - Intergenic
1004955455 6:20723402-20723424 ACAGGAGCAAGCTCCGCGCAGGG - Intronic
1005026499 6:21467298-21467320 ACAGGAGCAAGCTCTGTGCAGGG - Intergenic
1005114466 6:22319991-22320013 ACAGGAGGAGGCCCTCAGCTTGG - Intergenic
1005481581 6:26260048-26260070 AAAGGAGCAGGCCTTCTGAAGGG + Intergenic
1006800861 6:36758889-36758911 ACTGGAGGACGCCCCCTCCACGG + Intronic
1007351009 6:41273470-41273492 CCAGGATCAGACACCCTGCAAGG + Intronic
1008496260 6:52137221-52137243 ACAGAAGCAGATCGCCTGCAGGG - Intergenic
1009530124 6:64802974-64802996 ACAGGTGCTGGCTCCATGCAAGG + Intronic
1010353144 6:74899848-74899870 ACAGGAACAGGCTGCCTGCCAGG + Intergenic
1012749431 6:103139648-103139670 ACAGGTGCTGGCTCCATGCAAGG + Intergenic
1013414616 6:109913439-109913461 ACAGGGGCAGGCCCCTGGCTGGG + Intergenic
1016730559 6:147423189-147423211 ACAGGAGCTGGGTCCGTGCAGGG - Intergenic
1017046965 6:150356069-150356091 ACAGGAGCAAACTCCGTGCAGGG + Intergenic
1017964621 6:159253417-159253439 ACATTATCGGGCCCCCTGCAGGG + Intronic
1018920312 6:168167982-168168004 ACAGGGGCAGCCTCCCTCCAGGG + Intergenic
1019738466 7:2661624-2661646 GCATCAGCAGGGCCCCTGCATGG - Intronic
1019788453 7:2994616-2994638 CCAGGAGGTGGCCACCTGCAAGG - Intronic
1023242140 7:38160026-38160048 AAAGGAGCAGGCCTTCTGAAAGG + Intergenic
1023529166 7:41135780-41135802 ACAGGTGCTGGCTCCATGCAAGG + Intergenic
1023699521 7:42878522-42878544 CCAGGTGCTGGCCCTCTGCAAGG - Intergenic
1024219256 7:47274736-47274758 TCAGGAGCTGGCCCACTTCAGGG + Intergenic
1024547426 7:50534266-50534288 AAAGGAGCAGGCCTTCTGAAAGG - Intronic
1024566926 7:50688973-50688995 GCAGGAGCAGGCTCTGTGCATGG - Intronic
1024895038 7:54249184-54249206 GCAGGAGCAGGCACGCTACACGG + Intergenic
1026391924 7:69911188-69911210 ACAGGTGCTGGCTCCATGCAAGG + Intronic
1026880031 7:73902086-73902108 ACATATGCAGGCCCCCTTCAAGG + Intergenic
1028640885 7:93040491-93040513 ACAGGTGTCGGCTCCCTGCAAGG - Intergenic
1029423388 7:100483345-100483367 GCCGGAGCACGCCCCCTGCTGGG + Intergenic
1029661704 7:101966692-101966714 ACAGGTGAGGGCCACCTGCAGGG + Intronic
1029899430 7:104023204-104023226 ACAGGTGCGGGCTCTCTGCAAGG - Intergenic
1030385526 7:108863593-108863615 ACAAGAACAGGCTCCATGCAGGG - Intergenic
1031012669 7:116539893-116539915 ACAGGAGAAGTCCCCTGGCAAGG + Intronic
1031035687 7:116785368-116785390 GCAGGAGCAGGCATCTTGCATGG + Intronic
1033218068 7:139508513-139508535 ACAGGAGCAGACGCCATGCCTGG + Intergenic
1034894576 7:154868164-154868186 TCAGCAGCAGGTGCCCTGCAAGG + Intronic
1035485834 7:159225213-159225235 AGAGGATCAGACCCCCTGGAAGG - Intergenic
1035536534 8:395391-395413 ACAGGAGCAGAACCTCTGCGGGG + Intergenic
1035714636 8:1744486-1744508 ATGGGAGCAGGGCCCCTGGATGG + Intergenic
1036019785 8:4831777-4831799 ACTGCAGCAGGTCCCCTTCAGGG + Intronic
1036102115 8:5798913-5798935 AAAGGAGCAGGCCTTCTGAAAGG - Intergenic
1037472936 8:19228696-19228718 ACAGGAGCAAACTCCATGCAGGG + Intergenic
1037878098 8:22558760-22558782 GAAGGAGCAGCCTCCCTGCATGG - Intronic
1038286079 8:26207398-26207420 ACAGGAGCAAGCTCCATGCAGGG - Intergenic
1038547188 8:28434827-28434849 ACAGGAGCAAGCTCCGTGCAGGG + Intronic
1040356187 8:46620741-46620763 ACAGAAGCAAGCATCCTGCATGG + Intergenic
1043734112 8:83723428-83723450 ACAGGTACTGGCTCCCTGCATGG + Intergenic
1044216922 8:89623168-89623190 GCAGGAGCAGGCACATTGCACGG + Intergenic
1046503646 8:115110855-115110877 ACAGGCGCTGGCTCCCTGCAAGG + Intergenic
1046601252 8:116319604-116319626 ACAAGATCATGCCCTCTGCAGGG + Intergenic
1047208599 8:122822597-122822619 CCAGGAGCAGTCCCTCTGCTTGG - Intronic
1048547778 8:135403665-135403687 ACAGGAGCTGGCTCCATGCAAGG + Intergenic
1048873441 8:138817379-138817401 ACAGGAGCAGCCCTCCGCCAAGG - Intronic
1049369539 8:142257297-142257319 ACAGGACAAGGTCCTCTGCAGGG + Intronic
1049394231 8:142391684-142391706 ACAGGTGCTGGCTCCATGCAAGG - Intronic
1049783328 8:144438923-144438945 GCAGGAGCAGGGTCCCAGCAGGG - Intronic
1049792770 8:144479535-144479557 ACAGGAGGAGCCCCCTTGCTAGG - Intronic
1050012793 9:1201816-1201838 ACAGGAGCAGGGCTGCTCCAAGG - Intergenic
1051568589 9:18528518-18528540 ACAAGATCATGCCCCTTGCAGGG - Intronic
1052437277 9:28444715-28444737 ACAGGTGCTGGCTCCATGCAAGG - Intronic
1052580516 9:30349174-30349196 CCAGGAACAGGCTCCCTGCAAGG + Intergenic
1053154069 9:35762141-35762163 ACAGGAGCAGGCTGCCTCCATGG + Intergenic
1056778377 9:89531198-89531220 AAAGGAGCAGGCCTTCTGAAAGG - Intergenic
1056830692 9:89914974-89914996 ACAGGTGCACGCCACCTGCCTGG + Intergenic
1056994336 9:91442648-91442670 ACAGGTGCTGGCTCCCTGCAAGG + Intergenic
1057400059 9:94715421-94715443 TCAGGAGGAGTCCTCCTGCAAGG + Intergenic
1061403660 9:130382176-130382198 GCAGGACCCGGCCTCCTGCAGGG - Intronic
1061848750 9:133402601-133402623 GCAGGGTCAGGCCCCCTGGATGG + Intronic
1061953832 9:133951312-133951334 ACAAGAGCTGGCACCCAGCAGGG + Intronic
1062010329 9:134263611-134263633 TCAGGACCAGGCCACCTGGAGGG + Intergenic
1062033562 9:134372759-134372781 ACAGGAGCACACGCCCTGCTGGG - Intronic
1062186773 9:135222424-135222446 ACAGGGCCAGGCCTCCTGCAGGG + Intergenic
1062329230 9:136029726-136029748 ACAGGCGCCGGCTCCCTGCAGGG - Intronic
1186311456 X:8323719-8323741 ACAGGAGCAAGCTCTGTGCAGGG - Intergenic
1188891958 X:35622640-35622662 AAAGGAGCAGGCCTTCTGAAAGG + Intergenic
1189676647 X:43467765-43467787 ACAGGAACAAGCCCCATGCAGGG + Intergenic
1193111196 X:77732210-77732232 ACAGCAGCAAGCCCTGTGCAGGG - Intronic
1193485389 X:82080274-82080296 ACAGGAACAAGCTCCATGCAGGG + Intergenic
1196882783 X:120213733-120213755 ACTGTAGGAGGCACCCTGCAGGG + Intergenic
1197035781 X:121871230-121871252 ACAGGCTCCGGCTCCCTGCAAGG - Intergenic
1197585133 X:128337668-128337690 ACAGGAGCAGGCATCTTACACGG - Intergenic
1201720408 Y:17090191-17090213 ACAGGTGCTGGCTCCATGCAAGG - Intergenic
1202038313 Y:20657771-20657793 AAAGGAGCAGGCCTTCTGAAAGG + Intergenic