ID: 1174285679

View in Genome Browser
Species Human (GRCh38)
Location 20:49471313-49471335
Sequence TGCTGTGTGTGGAGACCAGA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 383
Summary {0: 1, 1: 0, 2: 2, 3: 42, 4: 338}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174285675_1174285679 8 Left 1174285675 20:49471282-49471304 CCATAGGAGGGTTTTGAGCGGGG 0: 1
1: 0
2: 4
3: 69
4: 384
Right 1174285679 20:49471313-49471335 TGCTGTGTGTGGAGACCAGACGG 0: 1
1: 0
2: 2
3: 42
4: 338

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174285679 Original CRISPR TGCTGTGTGTGGAGACCAGA CGG Intronic
900078119 1:834374-834396 AGCTGGGTGTGGAGATCAGGGGG + Intergenic
900651525 1:3732390-3732412 TGCTTGGTGTGGTGCCCAGAGGG + Intronic
901590676 1:10339176-10339198 TTCTGTGTGTCGAGACCTGTGGG + Intronic
901810205 1:11763075-11763097 TGGTGTGTGTGGAGGACAGTGGG + Intronic
903031847 1:20469264-20469286 TGCTGTGGGTGCAGAGAAGAGGG - Intergenic
904430728 1:30462433-30462455 TGCTGGGAGCAGAGACCAGAGGG - Intergenic
904975893 1:34456009-34456031 TACTGTGGGTGGTGAACAGAAGG + Intergenic
905066178 1:35185552-35185574 TGCTGTGTTTGCATACCTGAGGG - Intronic
905283546 1:36864599-36864621 TGCTGCCTCTGGAGACCAGAAGG - Intronic
906468703 1:46108743-46108765 TGGTGGGTGTGGAGGCAAGAAGG - Intronic
907190088 1:52641062-52641084 TTGTGTGATTGGAGACCAGATGG + Intronic
907830482 1:58060110-58060132 TTCTGTGTGGGGAGAGCAGCAGG + Intronic
907908932 1:58810343-58810365 TGGTGTGTATGGAGTCTAGAGGG + Intergenic
908484126 1:64573301-64573323 TGCCATGTGTGGATACCAGAAGG + Intronic
909806877 1:79883517-79883539 TGCTGTGGGAGGAAACCAGTGGG - Intergenic
913997084 1:143660543-143660565 GGCTGTGTGTGCAGGCCAAATGG - Intergenic
914376963 1:147080305-147080327 TGCAGTCTTTGGACACCAGATGG + Intergenic
914505169 1:148282244-148282266 GGCTGTGTGTGCAGGCCAAATGG + Intergenic
914507396 1:148301904-148301926 GGCTGTGTGTGCAGGCCAAATGG - Intergenic
915635772 1:157185524-157185546 TGCTGTGTGTGGTGAGCAGGTGG - Intergenic
915648314 1:157289600-157289622 TGCTGTGTGTGGTGAGCACGTGG + Intergenic
915916723 1:159945038-159945060 TGGTGTGTGGGGAGACTAGAAGG - Intronic
915916749 1:159945181-159945203 TGGGGGGTGGGGAGACCAGAAGG - Intronic
917677730 1:177336438-177336460 TGCTCTGTGTGCAGACCTGCAGG + Intergenic
918085454 1:181241042-181241064 TGCTGTGAGGGGAGAGCAGAGGG + Intergenic
918783628 1:188734057-188734079 TACTGTCTGTGGAGGCCTGATGG + Intergenic
919685721 1:200481918-200481940 TGAGGTGTGTGGAGACTGGAAGG + Intergenic
919825122 1:201498182-201498204 TAGTGAGTGTGGAGAACAGATGG + Intronic
920210708 1:204326215-204326237 TTCAGTTTGTGAAGACCAGAGGG + Intronic
920430353 1:205914792-205914814 TCCTGGGTGTGGAGAGCACATGG + Exonic
921265015 1:213414962-213414984 GGGTGGGTGTGGAGGCCAGAGGG + Intergenic
921726450 1:218529273-218529295 TGATTTGTGTGGAGAAAAGAAGG - Intergenic
923423865 1:233848441-233848463 TGGTGTCAGTGGAGACCACATGG + Intergenic
923729942 1:236540431-236540453 TCATGTGTGTGGAGACCTGTGGG + Intronic
924010755 1:239663069-239663091 TGCTGTGTTTGGGAAGCAGAAGG + Intronic
924279210 1:242419174-242419196 TGCTCAGTGTGGAGATGAGATGG + Intronic
1063685014 10:8228717-8228739 TTCTGTGTGTGGTAACCAGATGG + Intergenic
1064884266 10:20092111-20092133 TGCTTTCTGTGGAGAAAAGAAGG + Intronic
1064976859 10:21126051-21126073 AGCTGGTTGGGGAGACCAGAAGG - Exonic
1065145591 10:22764553-22764575 TGGTGTGGATGGAGCCCAGAGGG + Intergenic
1065332732 10:24619649-24619671 TGCGGTGTCTGGCGTCCAGATGG + Exonic
1066586049 10:36936947-36936969 TGTTGTGTGTAGATAGCAGAGGG + Intergenic
1067269719 10:44779850-44779872 AGCTGAGCGTGGAGACCAGTAGG + Intergenic
1069236798 10:66086014-66086036 TGGTGTGTGTTCTGACCAGATGG - Intronic
1070664447 10:78333302-78333324 AGCTGTGTGTGGAGCCCATGAGG + Intergenic
1073702934 10:105950517-105950539 TGCTCTGTGTGGCCAGCAGAGGG + Intergenic
1074031869 10:109697068-109697090 TGCAGTGTGTGGAGACAGAAAGG - Intergenic
1074063368 10:109989201-109989223 TGCTGTGTTTGGAGAACATCAGG - Intergenic
1075786514 10:125053639-125053661 TGCTGTCTCTGAAGCCCAGAGGG - Intronic
1075853225 10:125605273-125605295 TGCTGTGTGTGGAGATTAACTGG - Intronic
1076199304 10:128545835-128545857 TGCGGTGTGTGGAGAGCAAATGG - Intergenic
1076932777 10:133544689-133544711 TGCTGTGTGCAGAGATCACATGG + Intronic
1076982635 11:213000-213022 GGCTGTGAGTGGAGACCCGAGGG - Intronic
1079225472 11:18601009-18601031 CACTCTGTGTGGTGACCAGAAGG - Intergenic
1080879011 11:36301664-36301686 TGCTGGGAGAGGAGAGCAGAGGG + Intronic
1081778786 11:45695526-45695548 TGCAGGGTGAGAAGACCAGAAGG + Intergenic
1081963655 11:47156373-47156395 CGGTGTGTGTAGAGACGAGATGG + Intronic
1083010040 11:59388333-59388355 TACAGTGTGTGGAAACTAGAAGG - Intergenic
1084432281 11:69117731-69117753 TGCTTTGTGGGGAGACCACAGGG + Intergenic
1084649349 11:70479575-70479597 TGCAGTGGGTGGGGTCCAGAAGG - Intronic
1085381123 11:76119618-76119640 TGATGTGAGTGGAGAAAAGAAGG - Intronic
1087684025 11:101243388-101243410 TGTTTTGTGTGGAGAGCAGTGGG - Intergenic
1088591694 11:111408917-111408939 TGCTGTGGGAGGAAACAAGATGG + Intronic
1088964056 11:114700122-114700144 TGCTGTGTCTGGAATACAGAAGG - Intronic
1088992588 11:114966862-114966884 AGCTGGGGGTGGAGATCAGAAGG + Intergenic
1089422331 11:118341137-118341159 GGCTGTGGGTGGAGACCAGCTGG + Intronic
1090480861 11:127067099-127067121 TGCTGTCTGAGGAGCCCAGGTGG + Intergenic
1091214532 11:133892625-133892647 TGCTGTTTCTGCAGACCTGAAGG - Intergenic
1091254455 11:134171811-134171833 TGCTGTGTTTGGAGGACAGCCGG - Intronic
1091596164 12:1880432-1880454 TGCTGTGAGTGGAGTCCATGTGG - Intronic
1092926095 12:13273937-13273959 TGCTCAGTGTTGAGAGCAGAGGG + Intergenic
1093191275 12:16077848-16077870 TGGTGTGTGTGGAGATCATATGG - Intergenic
1094836961 12:34326585-34326607 TGGTGTGTGTTGAGCCCACAGGG - Intergenic
1095659650 12:44716269-44716291 TGCTGTGTAAGGAGATCAGTTGG - Intronic
1096236782 12:49933884-49933906 TGGTGTGTCTGGAGATCACACGG + Intergenic
1097444147 12:59647600-59647622 AGTTGTGTTTGGTGACCAGAAGG + Intronic
1098953936 12:76669308-76669330 TGTTGTGTGAGGAGACCTGATGG + Intergenic
1102467251 12:113137134-113137156 TGCTGGGTGGGGAGTCAAGAAGG - Intergenic
1102555876 12:113726125-113726147 GACTGTGTGTGGTGACCACATGG + Intergenic
1103010139 12:117451934-117451956 TGCTGTGTGTGGCCCCAAGAGGG + Intronic
1103177544 12:118877743-118877765 AGCTTTGTGGGGAGATCAGAGGG - Intergenic
1103283565 12:119781008-119781030 AGCTGTGTTTGGCCACCAGAGGG - Intronic
1103727765 12:123007095-123007117 ATCTGTGTGCTGAGACCAGAAGG - Intronic
1104415962 12:128596763-128596785 TGCTGTGCGTGGTGACGGGAAGG - Intronic
1104591142 12:130085510-130085532 TGCTGTCTGTGGTTGCCAGAGGG + Intergenic
1104617209 12:130280896-130280918 TGCTGTGTGTGGATATCTGTGGG - Intergenic
1105446987 13:20465990-20466012 TGATGTGTGTAGAGATCACATGG - Intronic
1107733595 13:43373236-43373258 TTCTTTGGGTGGAAACCAGAAGG + Intronic
1108898010 13:55359495-55359517 TGGTGTGTGTGGAGATCATATGG - Intergenic
1109269336 13:60236870-60236892 CGGTGGGTGTGGAGAACAGATGG - Intergenic
1110763247 13:79253429-79253451 AGCTGTGTGTGGAGGAAAGAAGG - Intergenic
1112434398 13:99381380-99381402 TGCTGAGTGTGGACAGCAAATGG + Intronic
1113713709 13:112488730-112488752 TGGTGGGTGTGGAGACCTGGGGG - Intronic
1113866923 13:113532519-113532541 GCCTCTGTGTGGAGAGCAGATGG + Intronic
1113886295 13:113660312-113660334 TGGTGTCAGTGGAGACCATATGG + Intergenic
1114533482 14:23409429-23409451 TGCAGTGCCTGGGGACCAGATGG - Intergenic
1114666942 14:24383405-24383427 TTCAGTGTGGGGACACCAGAAGG + Intergenic
1115670429 14:35605426-35605448 TGCTGTATGTGCAGACAAAATGG + Intronic
1116799356 14:49427145-49427167 CACCGTGTGTGGATACCAGAGGG - Intergenic
1116863218 14:50010894-50010916 TGCAGTGTGGGGAGAGAAGAGGG - Intergenic
1118223780 14:63879741-63879763 TGCTATCTGTGGATACCAAAGGG - Intronic
1118269476 14:64329148-64329170 TACTGTGTGTGTAGATCACATGG + Intronic
1118975379 14:70671813-70671835 TGGTATGTGTGGTCACCAGAGGG - Exonic
1119231085 14:72980387-72980409 TGCAGTGTGTCGAGGTCAGATGG - Intronic
1120076713 14:80167423-80167445 TGTTGTGCGTGGATACCAAAGGG - Intergenic
1120498668 14:85266985-85267007 TGCTATGTGTGGAGAACACAAGG + Intergenic
1120828335 14:88975172-88975194 TGCTGAGTGAGCAGAACAGATGG + Intergenic
1121436431 14:93923583-93923605 TACTGTGTGCAGGGACCAGAGGG - Intronic
1121788775 14:96683006-96683028 GGCTGTGTGTTTAGACCACAGGG + Intergenic
1121997659 14:98616359-98616381 TGCAGTGTGTGGAGCCCTGTGGG - Intergenic
1122153418 14:99736853-99736875 TTCTGTATGCAGAGACCAGAGGG - Intergenic
1122276768 14:100594690-100594712 TTCCATGTGTGGAGCCCAGAGGG - Intergenic
1122846559 14:104503243-104503265 TGGTGTGTGCAGAGACCACATGG - Intronic
1123069632 14:105636157-105636179 TGCTGAGTGTGGGTAGCAGAGGG + Intergenic
1123088725 14:105731940-105731962 TGCTGAGTGTGGGTAGCAGAGGG + Intergenic
1124017947 15:25893794-25893816 TGCCATGTGTGAAGAGCAGAAGG + Intergenic
1124497120 15:30193354-30193376 TCCTGAGTGTGCAGAGCAGAAGG - Intergenic
1124661867 15:31556291-31556313 TCCTGCGAGTGTAGACCAGATGG + Intronic
1124746456 15:32345293-32345315 TCCTGAGTGTGCAGAGCAGAAGG + Intergenic
1126695252 15:51320496-51320518 AGGTGAGTGAGGAGACCAGATGG + Intronic
1127850368 15:62906947-62906969 TGCTGTGGGTGGGGACAGGAGGG + Intergenic
1128336829 15:66792072-66792094 TGCTGTGGGCAGAGACCAGAAGG + Intergenic
1128731792 15:70026310-70026332 TGCTGTGTAGGGAAAGCAGAAGG + Intergenic
1129172780 15:73818061-73818083 TGGTGTTTGTGGAGGCCAGGTGG + Intergenic
1129254860 15:74328544-74328566 TGCTGTCCGAGGACACCAGATGG + Intronic
1129702070 15:77773910-77773932 TGTTGTTTGTGGGGACCAGCAGG - Intronic
1129703771 15:77782999-77783021 GGCTGTGTCTGGAGACCAGGAGG - Intronic
1130744660 15:86638244-86638266 TGTTTTGTGTAGTGACCAGATGG + Intronic
1131785301 15:95905742-95905764 TGTTCTGTGTGATGACCAGATGG - Intergenic
1133417623 16:5618837-5618859 TGCTGTGTCTGGATACCAGTGGG + Intergenic
1134412921 16:14018158-14018180 TCCTGAGTGTGGAATCCAGAGGG + Intergenic
1134489711 16:14687555-14687577 GGCTGGGGGTGGGGACCAGAAGG - Intronic
1135907048 16:26521787-26521809 CGCTGTGTGCAGAGACCACATGG - Intergenic
1137384385 16:48028151-48028173 TCCTGTGCGTGGTGGCCAGAGGG + Intergenic
1139515473 16:67450083-67450105 TCCTGGGTGTGAAGACCTGAGGG - Intronic
1139958370 16:70704124-70704146 GGCTGTGTGTGGATGCCAGGTGG - Intronic
1140449354 16:75057966-75057988 GGCTGTGTGTGGAGAAAAGTAGG + Intronic
1141358680 16:83373966-83373988 TGTTGCGTTTGGAGATCAGAAGG - Intronic
1143681724 17:8480793-8480815 TGTTGTCTGTGGAGAACAGCTGG - Intronic
1143852327 17:9822153-9822175 GGCTGTGTGAGGATGCCAGATGG - Intergenic
1144116014 17:12091363-12091385 TGCTGTGTTTTGTGACGAGATGG + Intronic
1144203634 17:12963567-12963589 TGCTGTGTGTGCAGACAGGCCGG + Intronic
1144203639 17:12963601-12963623 TGCTGTGTGTGCAGACAGGCTGG + Intronic
1144203642 17:12963635-12963657 TGCTGTGTGTGTAGACAGGTCGG + Intronic
1144347088 17:14359270-14359292 TGCTCTGCATGGAGAACAGATGG - Intergenic
1144946839 17:18973676-18973698 TTCTGTGTGTTGAGACCATAGGG + Intronic
1144955274 17:19015875-19015897 GGCTGTGTCTGGAGAACAGGTGG + Intronic
1146892158 17:36513253-36513275 TGCTGAGTCTGGAGACCAGGTGG - Intronic
1147129824 17:38400714-38400736 TCCAGTGAGTGGAGACCAGCAGG - Exonic
1148138904 17:45314380-45314402 CCTGGTGTGTGGAGACCAGAGGG + Intronic
1148823018 17:50371565-50371587 GGCTGTGTCTGGAGACCTGCAGG - Intronic
1149420017 17:56501357-56501379 TGCTGTATGAAGAGACCATAAGG + Intronic
1149432777 17:56607735-56607757 AGCTGTGAGAGGAGCCCAGAAGG + Intergenic
1150635023 17:66906862-66906884 TGCTGGATCTGGACACCAGAGGG - Intergenic
1151190620 17:72395237-72395259 TGGTGTGCATGGTGACCAGAAGG + Intergenic
1151687149 17:75654580-75654602 TGCTGTATGTGGAAACTTGAAGG - Intronic
1151725623 17:75882102-75882124 GGCTGTGGGTGGGGAGCAGAGGG - Intronic
1152211732 17:79006041-79006063 TGCTGTCTGTGGAGGCAGGATGG - Intronic
1153933591 18:9900901-9900923 TGCTGGGTGTGGAGATGAGATGG + Intergenic
1153949238 18:10044247-10044269 TGCTGTGGGTGGAGACGGGAGGG + Intergenic
1155403149 18:25460386-25460408 AGCTGAGTGGGGAGACAAGAAGG - Intergenic
1156253352 18:35373392-35373414 AGATGTGTGTGGTGAGCAGAGGG + Intronic
1157084104 18:44560114-44560136 TGTTGTTTGTGGAGACATGAAGG - Intergenic
1159070162 18:63613947-63613969 GTCTGTGTGGGGAGACCAGGAGG - Intergenic
1160018745 18:75164332-75164354 TGCTGTTTCTGGAGCGCAGAGGG + Intergenic
1160416581 18:78716292-78716314 TGCTGTGTGTGGAGGCCTCTGGG - Intergenic
1160576741 18:79859434-79859456 TGGTGTGTGCAGAGACCACACGG + Intergenic
1161325451 19:3661542-3661564 GGCGGTGTGGGGTGACCAGAAGG + Intronic
1162888450 19:13714053-13714075 TGATGTGGGTGGGGACCAGCTGG - Intergenic
1163574578 19:18103107-18103129 AGCTGTGGGTGGAAAGCAGATGG + Intronic
1163798331 19:19349759-19349781 TGCTATGTGTTGACACCTGAGGG + Intronic
1164983036 19:32628368-32628390 TGCTGGGTGTGGAGGCCTAAAGG - Intronic
1165490179 19:36118869-36118891 GGCTGTGTGTGGGGAACAGGTGG + Intronic
1165756488 19:38296208-38296230 TGCTGGGTCTGGAGGCCAGAGGG - Intronic
1165888916 19:39099045-39099067 GGCTGTGTTTGGAGACCTGGGGG + Exonic
1166416328 19:42596867-42596889 AGCTGTGTGTGGAGATCTAATGG + Intronic
1166416977 19:42602279-42602301 AGCTGTGTTTGGAGACCTAATGG + Intronic
1167281078 19:48568907-48568929 AGCGGTGTGTGGGGACCAGAAGG - Intronic
1168306142 19:55437390-55437412 TCCTGGGAGGGGAGACCAGAAGG + Intronic
925085281 2:1102778-1102800 TGCTGTAGGTGGAGAGGAGAAGG + Intronic
925969847 2:9098657-9098679 TGCTGGGTGTGGGGAGGAGAGGG - Intergenic
926355162 2:12034771-12034793 TGCTGTGTGAGGAGCCTTGATGG + Intergenic
927967893 2:27283020-27283042 TGTTGTGGCTGGAGAGCAGAAGG + Intronic
928215347 2:29356761-29356783 TGCTGTGTGCAGGGCCCAGATGG - Intronic
928728268 2:34201290-34201312 TGATGTGTGTAGAGATCACATGG - Intergenic
928877348 2:36055866-36055888 TACTGTGTGAGAAGAGCAGAAGG + Intergenic
929637446 2:43538848-43538870 TGCTGTGTGGGGAGAAGAAATGG - Intronic
930130926 2:47849769-47849791 TAGTGTGTGTGAAGACCTGAAGG + Intronic
933547202 2:83729690-83729712 GGCTAGGTGTGGAGGCCAGAAGG + Intergenic
934560065 2:95308560-95308582 TGCAGTGTGCAGAGACCAGTGGG + Intronic
935057343 2:99579061-99579083 GGCTGTCTGTGAAGACCAGAAGG + Intronic
935591583 2:104850685-104850707 TGCTGTGTCTGGGGAGCAGGCGG - Intergenic
936057621 2:109272699-109272721 GGCTGTGTGTGGTCAGCAGAGGG + Intronic
936146346 2:109982716-109982738 TGCTGTCTCTGGACCCCAGAGGG + Intergenic
936198345 2:110388763-110388785 TGCTGTCTCTGGACCCCAGAGGG - Intergenic
936875980 2:117190067-117190089 TGCTTTGGTTGGAGCCCAGATGG + Intergenic
937295353 2:120806817-120806839 AGCTCTGTGTGGACACCAGAGGG + Intronic
937367174 2:121271872-121271894 TGCTGTGAGTGGAAAACAGGAGG + Intronic
938193553 2:129304387-129304409 TGGTGTTAGTGGAGACCACAGGG + Intergenic
938306398 2:130259177-130259199 GGCTTTGTGTGGAGCCAAGATGG + Intergenic
939408623 2:141794658-141794680 TGTTATGTGTGGAGAATAGAAGG - Intronic
940176161 2:150879734-150879756 TGCTGTGTGAGGAGATGGGAAGG - Intergenic
941018115 2:160379917-160379939 GGCTGGGTGTGGAGATCAGTGGG + Intronic
942176122 2:173336135-173336157 TGGTGTCAGTGGAGACCATATGG - Intergenic
942601053 2:177641512-177641534 AGCTGGCTGTGGAGTCCAGATGG + Intronic
942975997 2:182018574-182018596 TTAGGTGTGTGGGGACCAGAGGG + Intronic
946734396 2:222740072-222740094 TGGTGTGTGTGGAAACCACATGG + Intergenic
946919623 2:224565317-224565339 TACTGAATGTGAAGACCAGAAGG - Intronic
948083189 2:235224488-235224510 TTCTGTGGATGGAGACGAGACGG + Intergenic
948229828 2:236341744-236341766 TGCTGTGTGTGGTGGGGAGAAGG + Intronic
948272658 2:236686432-236686454 TGCAGTGTGTGAGGAACAGAGGG - Intergenic
948316707 2:237032744-237032766 TGTTGTGTGTGGACTCCACATGG - Intergenic
948627224 2:239276590-239276612 GCCTGTGTCTGGAGAGCAGATGG - Intronic
948883356 2:240871310-240871332 GGCTGTGGGTGGAGCTCAGAGGG - Intronic
948913369 2:241017684-241017706 TGCCGTGGGAGGAGATCAGAAGG - Intronic
1169500064 20:6150998-6151020 TGCTGTGTGTAGAGATCAAATGG + Intergenic
1170881970 20:20304760-20304782 AGCTGTGGGTGGAGAGGAGAGGG + Intronic
1171401425 20:24875074-24875096 TGCTGTCTGTTGGGACCTGATGG - Intergenic
1172325779 20:34033510-34033532 TGCTGTGGGTAGAAATCAGATGG + Intronic
1173374693 20:42472880-42472902 TGCTGTGTGTGGTACCAAGAAGG - Intronic
1174285679 20:49471313-49471335 TGCTGTGTGTGGAGACCAGACGG + Intronic
1174404806 20:50296209-50296231 GCCTGTGTGTGGAGATGAGAGGG + Intergenic
1174904564 20:54536906-54536928 TGGTGTCTGCGGAGACCACATGG + Intronic
1175618525 20:60423736-60423758 TGCAGTGTGTAGAGTCCAGTGGG + Intergenic
1175930911 20:62493331-62493353 TGCTGTGTATGGACACAAGAAGG - Intergenic
1177584324 21:23070093-23070115 TGCAGTGCTTGGTGACCAGAAGG - Intergenic
1177634548 21:23770716-23770738 GTCATTGTGTGGAGACCAGAAGG - Intergenic
1178938992 21:36889320-36889342 CGCAGTGTGTGGTGAGCAGATGG - Intronic
1179730067 21:43362663-43362685 TGCAGTGCGTGGAGTGCAGAAGG - Intergenic
1180248248 21:46562659-46562681 GGCTGAGTGTGGGGAGCAGAAGG + Intronic
1181307765 22:21926760-21926782 TGCTGTGCCTGGGGACTAGAAGG - Intronic
1181333844 22:22115337-22115359 GGCTGAGTGGGGAGACTAGAGGG - Intergenic
1181615602 22:24052156-24052178 TGATGTGACTGGAGAACAGAGGG + Intronic
1183317270 22:37143569-37143591 TCCTGTGTCTGGAGCCAAGATGG - Exonic
1183981006 22:41540204-41540226 CGCTGCCTGTGGAGAGCAGACGG - Intronic
1184688221 22:46105847-46105869 TGCTGGGTGGGGTGACCACAGGG + Exonic
1185089326 22:48757054-48757076 TGCTTTGTGAGGAAATCAGAAGG + Intronic
1185315330 22:50176556-50176578 GGCTGTGTGTGGATAGAAGAAGG + Intronic
1185338807 22:50282665-50282687 AGCTGGGTGTGGGGAGCAGAGGG + Intronic
950863224 3:16168919-16168941 AGAAGTGTCTGGAGACCAGATGG + Intergenic
951154915 3:19339948-19339970 TTCTGTGTGTGGAAAGAAGAGGG + Intronic
951274030 3:20663342-20663364 TGCTGTCATTGGAGAACAGACGG + Intergenic
951349591 3:21590125-21590147 TGCTGTGTGAATAGACCATAGGG - Intronic
953830110 3:46289709-46289731 AGATGGGTGTGGAGAGCAGAGGG + Intergenic
954146838 3:48638753-48638775 TGCTGGGGGTGGGGACCAGAGGG - Intronic
954433646 3:50484594-50484616 ACGTGTGTGTGGAGACCGGAGGG - Intronic
956743310 3:72291656-72291678 TGCTGTGTGTGGAGTCCTGTGGG + Intergenic
956760465 3:72438909-72438931 CGCTGTGTATGGAGGGCAGACGG + Intronic
956797332 3:72728763-72728785 TGCAGTGCCTGGAGATCAGAAGG + Intergenic
957416878 3:79917006-79917028 TGCTGAATGTGGAGAAAAGAAGG - Intergenic
958569370 3:95860384-95860406 TCCTGAGGGTGGAGACAAGATGG + Intergenic
959376336 3:105593038-105593060 TGTTGTGGGTGGAGATGAGAAGG + Intergenic
959676934 3:109046237-109046259 TGCTGTGCGTGGAGACTAGAAGG + Intronic
961437264 3:126927983-126928005 AGCTGTGTGTGCACACCACATGG - Intronic
962740381 3:138359043-138359065 TGCTGTATGTAGAAAGCAGAGGG + Intronic
963055384 3:141182236-141182258 TGCAGGGTGTGTTGACCAGAAGG - Intergenic
964825871 3:160827720-160827742 TCATGTGTGTAGAAACCAGATGG + Intronic
965516784 3:169630108-169630130 TGCTGTGTGTTGAGGAGAGAAGG - Intronic
967061878 3:185879960-185879982 TGCTGTGTGTCCAGATAAGAAGG + Intergenic
967875846 3:194268048-194268070 GGCTCTGTGTGGGGACCAGGGGG + Intergenic
968667968 4:1831585-1831607 TGGTGTCAGTGGAGACCAGGTGG - Intronic
969210907 4:5686508-5686530 GGCAGTGTGTGGAGATCAGCTGG - Intronic
970211317 4:13713014-13713036 TGCGGTGTCTGGTGACAAGAAGG + Intergenic
971104743 4:23512178-23512200 TGCTGTCAGTGGAGACAAAATGG - Intergenic
972977934 4:44660470-44660492 GGCTGTATGGGGAGACCACATGG + Intronic
975041368 4:69747644-69747666 TACGCTGTGTGGAGTCCAGAGGG - Intronic
975211332 4:71703623-71703645 TGGTGGGGGTGGAAACCAGATGG + Intergenic
975211370 4:71703981-71704003 TGGTGGGGGTGGAAACCAGATGG - Intergenic
975996496 4:80321758-80321780 TGGTGGGTGTGGAGACAGGAAGG - Intronic
976226766 4:82800337-82800359 TGCTGGGTATGGGGAGCAGAGGG - Intergenic
976449274 4:85167789-85167811 TGCTGTGTGTTTGGAGCAGAGGG + Intergenic
976691938 4:87877401-87877423 TGGTGTCAGTGGAGACCACATGG + Intergenic
979011015 4:115368477-115368499 TACTGTGCTTGGAGACCAAAGGG + Intergenic
980582366 4:134771702-134771724 TGGTGTGTGTGGAAGACAGAGGG - Intergenic
982002145 4:151030928-151030950 GGCTGTGTGTGAAGAACAGATGG + Intergenic
982051461 4:151506552-151506574 TGCTGTATGTGGAGGTCACATGG + Intronic
982279510 4:153668906-153668928 TCCTGAGTGTGGCCACCAGATGG - Intergenic
982348319 4:154385932-154385954 TGCAGAGTCTGGAGCCCAGATGG - Intronic
982932213 4:161422942-161422964 AGCTGTTTATGGAGACCACAAGG + Intronic
983631313 4:169852405-169852427 TCCTGTAAGTGGAGAGCAGAGGG - Intergenic
986046234 5:4041161-4041183 TACTGTGGGTGGTGACCAGATGG - Intergenic
987332148 5:16866869-16866891 GGCTGTGGGTGGAGACCAGCAGG - Intronic
987540048 5:19243317-19243339 TGATGTTTGTGGACAGCAGATGG + Intergenic
988922254 5:35954235-35954257 TGCTGGGTGTGGTGGCCAGGTGG - Exonic
989032235 5:37131312-37131334 AGCTGACTGTGAAGACCAGAGGG - Intronic
989170483 5:38467405-38467427 GTCTGTGTGTGGACACCAGCCGG - Intergenic
989319615 5:40119823-40119845 TGTTGTGTGTGTGGACCAAAGGG - Intergenic
991610409 5:68443755-68443777 TGCAGTGTGTGCAGAGCAGTGGG - Intergenic
992564785 5:77986439-77986461 AGCTTTGTGTGGACACCAGCAGG - Intergenic
992877262 5:81069181-81069203 TGATGTGTGTAGGGAGCAGAAGG - Intronic
997170118 5:131710545-131710567 TGCTGTGTGGGTAGACTAGTTGG - Intronic
998109890 5:139493083-139493105 TGATGTGTGTGCAGAGCAGCAGG + Intergenic
999298107 5:150473138-150473160 TGCTCTGTGTGGAGACCTCTGGG - Intergenic
999345594 5:150816519-150816541 TTCTGTTTGAGGAGAACAGAGGG + Intergenic
999600007 5:153252381-153252403 TGGTGTGTGCAGAGATCAGATGG + Intergenic
999873247 5:155773885-155773907 GGATGTGGGTGGAGACCTGAGGG + Intergenic
1001943384 5:175756802-175756824 TGGTGTCAGTGGAGACCATATGG + Intergenic
1002680049 5:180954639-180954661 AGCTGAGTCTGGAGGCCAGAGGG + Intergenic
1002956151 6:1866822-1866844 TGCTGTATGTGCTGACCATAGGG - Intronic
1003654317 6:7991671-7991693 CCCTGTGTGTGGCCACCAGATGG + Intronic
1004435292 6:15586723-15586745 TGCTGGGGGTAGAAACCAGATGG - Intronic
1004982229 6:21038269-21038291 TTCTGTGTGTGGAGGCCAGTAGG + Intronic
1006992917 6:38230702-38230724 TGGTATGTGTGCAGAACAGAAGG - Intronic
1007278515 6:40693088-40693110 GGCTGTGTGTGGGGGCGAGAGGG - Intergenic
1007909242 6:45496767-45496789 TGCTGTTTGAGGGGACCATAAGG + Intronic
1008508248 6:52252110-52252132 TGCTGTGTGAGGATCCCGGACGG + Intergenic
1010523220 6:76867295-76867317 TGGTGTCAGTGGAGACCACATGG + Intergenic
1010791270 6:80067913-80067935 TGCGGTGTCTGGTGTCCAGATGG + Intergenic
1011662021 6:89602919-89602941 TGCTCTGTGTGGGGACGGGAGGG + Intronic
1014473166 6:121840661-121840683 TGCTGTGTTTTCAGAACAGAGGG + Intergenic
1015471168 6:133607903-133607925 TCCTGTGTGTGAAGAGCAAAAGG - Intergenic
1017691378 6:156968943-156968965 TTCTGTGAGTGGAGCCCAGGTGG + Intronic
1018910284 6:168097664-168097686 TGCTGTGTCTGCAGCCCAGCAGG - Intergenic
1020003274 7:4767798-4767820 TGCTACGTTTGGTGACCAGAGGG + Exonic
1022547314 7:31201179-31201201 TGATGTGTGGGGAAAGCAGAAGG - Intergenic
1023922913 7:44643684-44643706 GTCTGAGTCTGGAGACCAGAAGG - Intronic
1024045160 7:45580766-45580788 TGCTGAGTGTGGCCACCAGGAGG + Intronic
1024528227 7:50367788-50367810 TGCTGTGAGTTGACACCTGAGGG + Intronic
1025033197 7:55573296-55573318 TGCTGAGTGCGGAGACCAGGAGG + Intergenic
1025161955 7:56668999-56669021 AACTGTGTGTTGAGCCCAGAAGG + Intergenic
1025224116 7:57141915-57141937 ATCTGTGTGTTGAGCCCAGAAGG + Intergenic
1025721947 7:64025156-64025178 ATCTGTGTGTTGAGCCCAGAAGG - Intergenic
1025745545 7:64239495-64239517 ATCTGTGTGTTGAGACCAGAAGG - Intronic
1026004552 7:66590877-66590899 TGTTGGGTGTGGAGCCTAGAAGG - Intergenic
1028508978 7:91601200-91601222 TGCTGTATGTGGGGATCAGAAGG - Intergenic
1029189561 7:98762068-98762090 TGCTGTGTGCTGTGACCAGGGGG + Intergenic
1032153688 7:129451379-129451401 GGCTGTGTGTGGAGGACAGAGGG + Intronic
1032669899 7:134073283-134073305 TGCTGTATGTGGACACCTAAAGG + Intergenic
1032859236 7:135861851-135861873 CTTTGTGTGTGGAGACCTGAAGG + Intergenic
1033771470 7:144557392-144557414 TAGTGTGTGTGGAGAGCAGAAGG - Intronic
1034302109 7:150025281-150025303 TTTTGAGTGTGGACACCAGAGGG - Intergenic
1034421143 7:150991618-150991640 AGCAGAGTGTGGAGCCCAGATGG + Intronic
1034553111 7:151833603-151833625 TGCTGGGGCTGGGGACCAGATGG - Intronic
1034803946 7:154072034-154072056 TTTTGAGTGTGGACACCAGAGGG + Intronic
1035438602 7:158878214-158878236 TGCTGTGTGGGGAGGCCAGGAGG + Intronic
1035527499 8:325296-325318 AGCTGGGTGTGGAGATCAGGGGG - Intergenic
1036614439 8:10377805-10377827 TGCTGGGTGTGGAGGCAAGTGGG + Intronic
1037556031 8:20023458-20023480 TGCTGGGTGTGTGGAGCAGATGG + Intergenic
1038412084 8:27366804-27366826 GGCTGTGTGTGGAGAGCAGAGGG + Intronic
1041429491 8:57763017-57763039 AGCTGTGTGTCCAGACCAGGAGG + Intergenic
1042730230 8:71925455-71925477 TGCTGAGTGTGGAGGGCAGATGG - Intronic
1042886994 8:73563398-73563420 TGGTGTCAGTGGAGACCATATGG + Intronic
1044558373 8:93589051-93589073 TGCTCTCTGTGGAAACCACAAGG + Intergenic
1045240411 8:100395819-100395841 TGTTATGTTTGGAGTCCAGATGG + Intronic
1045766547 8:105678494-105678516 TGCTCTATGTTGAGACCAGGAGG - Intronic
1046612779 8:116444331-116444353 TGCTGAGTGTTGGGACCACATGG - Intergenic
1047073157 8:121370630-121370652 TGGTGTCAGTGGAGGCCAGATGG - Intergenic
1048514893 8:135097315-135097337 TGATGTCAGTGGAGACCAGGTGG + Intergenic
1048861408 8:138726931-138726953 TGCAGTCTGGGGTGACCAGAGGG + Intronic
1049069164 8:140343890-140343912 AGCTGAGTGTGGAGGGCAGAGGG + Intronic
1049528464 8:143141720-143141742 CGCGCTGTGTGGGGACCAGAGGG - Intergenic
1050168493 9:2791335-2791357 TGCTCTGGCTGGAGACCAGGTGG + Intronic
1050250330 9:3736753-3736775 TGTTTTGTGAGGAGAACAGAAGG + Intergenic
1052480526 9:29019512-29019534 TAGTGGGAGTGGAGACCAGAAGG - Intergenic
1055163604 9:73163083-73163105 TGGTGTGTGCAGAGACCACATGG + Intronic
1056558027 9:87706214-87706236 TGCTGTCCGTGGAGACCCCACGG + Exonic
1057064177 9:92033462-92033484 TGCTGTGCATGGAGTCCTGAGGG + Intronic
1057840169 9:98479858-98479880 TACTGTGTGTTGAGAAGAGAAGG - Intronic
1058672053 9:107367984-107368006 TGCAGTGTGGCGAGACCAGGAGG - Intergenic
1059058839 9:111014106-111014128 TGGTGTGAGGGGAGCCCAGAGGG - Intronic
1059350487 9:113660967-113660989 AACTGTGTGTGCAGATCAGAAGG + Intergenic
1060827958 9:126697094-126697116 AGCTGTATGGGGACACCAGAAGG + Exonic
1061987013 9:134135803-134135825 TGCTGTCTGTGGAAACGCGAGGG + Intronic
1186086141 X:5992737-5992759 TGCTGTGTGCGCAGATCATATGG + Intronic
1187222170 X:17338693-17338715 AGCTGTGTGTGGAGCACAGGGGG + Intergenic
1188225477 X:27592243-27592265 GGCTGTGTGAGGATGCCAGATGG - Intronic
1189873620 X:45410568-45410590 TGCTATGTGTTCAGGCCAGAGGG - Intergenic
1192596593 X:72414743-72414765 TGCAGTGGCTGGAGAGCAGAAGG + Intronic
1193776168 X:85644656-85644678 TGCTCTGTGTGCAGATGAGAAGG - Intergenic
1194268051 X:91779180-91779202 TGCAGGGAGTGGGGACCAGAGGG + Intergenic
1195694557 X:107657203-107657225 TGGTGTCTGTGGAGACCACGTGG - Intergenic
1196232669 X:113242074-113242096 TTCTGACTGTGGAGAACAGATGG + Intergenic
1196613775 X:117743675-117743697 GCCTGGGTGTGGAGTCCAGAGGG - Intergenic
1197068679 X:122266928-122266950 TCCTGTGTGAGGAAAGCAGAGGG - Intergenic
1197689791 X:129485822-129485844 TGGTGTGTGCAGAGACCACATGG - Intronic
1197708413 X:129649976-129649998 GGCAGTGTGTGGAGATGAGATGG + Intronic
1198172078 X:134117176-134117198 TGCTGGAGGTGGAGCCCAGATGG + Intergenic
1198208485 X:134492759-134492781 TTCTGTGTGTGTACACCAGGAGG + Intronic
1198968233 X:142250425-142250447 GCCTGTGTGTGGAGTGCAGAGGG + Intergenic
1199071319 X:143478352-143478374 TGCTGTGGGTGGAGAGAACATGG - Intergenic
1199372562 X:147068483-147068505 TGCAGTGTGTGGAGATCACATGG + Intergenic
1199875126 X:151922584-151922606 CACTGTGTCTGTAGACCAGATGG - Intronic
1200585254 Y:5000101-5000123 TGCAGGGAGTGGGGACCAGAGGG + Intergenic