ID: 1174287947

View in Genome Browser
Species Human (GRCh38)
Location 20:49485126-49485148
Sequence TCTCTAAGGATGCCACAGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174287944_1174287947 -2 Left 1174287944 20:49485105-49485127 CCTGGAGAGGCAGGCAAGGGTTC No data
Right 1174287947 20:49485126-49485148 TCTCTAAGGATGCCACAGATGGG No data
1174287936_1174287947 24 Left 1174287936 20:49485079-49485101 CCCAGAAATGAAAACTGGAGGAG No data
Right 1174287947 20:49485126-49485148 TCTCTAAGGATGCCACAGATGGG No data
1174287937_1174287947 23 Left 1174287937 20:49485080-49485102 CCAGAAATGAAAACTGGAGGAGG No data
Right 1174287947 20:49485126-49485148 TCTCTAAGGATGCCACAGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174287947 Original CRISPR TCTCTAAGGATGCCACAGAT GGG Intergenic
No off target data available for this crispr