ID: 1174291180

View in Genome Browser
Species Human (GRCh38)
Location 20:49509840-49509862
Sequence CTGCAGGGATTGAGGGAAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 459
Summary {0: 1, 1: 0, 2: 3, 3: 40, 4: 415}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174291180_1174291186 22 Left 1174291180 20:49509840-49509862 CCCTTTTCCCTCAATCCCTGCAG 0: 1
1: 0
2: 3
3: 40
4: 415
Right 1174291186 20:49509885-49509907 TTTTTTTTTTTTTTTTTTTCTGG 0: 475
1: 20606
2: 19351
3: 44622
4: 187008

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174291180 Original CRISPR CTGCAGGGATTGAGGGAAAA GGG (reversed) Intronic
901190162 1:7405124-7405146 CTGCAGGAAGTGAGGGAGGAGGG - Intronic
901899043 1:12342275-12342297 CTTTAGGGATAGAGGGAGAATGG - Intronic
901959013 1:12810016-12810038 CAGGAGGGAATGAGGGAGAATGG - Intergenic
902227166 1:15003757-15003779 CTGCAGGGAGTGGGGGTAAGAGG - Intronic
903499308 1:23792816-23792838 CTGGAGGGGGTGTGGGAAAATGG + Intronic
903499966 1:23795326-23795348 CTGCAGGGAAGGAGGGTAACGGG - Exonic
904042640 1:27593341-27593363 CTGCAGGGAGAGAGGGAGAGAGG - Intronic
905780369 1:40703593-40703615 TAGCAGGGATTGAGGAAAACTGG - Intronic
906064341 1:42969400-42969422 GTGCTGGGATTATGGGAAAAAGG + Intergenic
906243454 1:44256904-44256926 CTGCAGGGACTGAGGCAGCATGG - Intronic
906635891 1:47410315-47410337 TTGCAGGGAATCAGGGAACAGGG + Intergenic
906668527 1:47638530-47638552 CTGCAGGGATTCAGGGGAGCTGG + Intergenic
906709016 1:47915623-47915645 CTCCAGGGAGTGTGGGAACATGG - Intronic
907935517 1:59038434-59038456 CTGAAGGGCGTGAGGGAAATAGG + Intergenic
908092928 1:60705650-60705672 GTGCAGGGATTGAGGTACTATGG - Intergenic
908851354 1:68379914-68379936 CTTCAGGCAAAGAGGGAAAAGGG + Intergenic
909804856 1:79862171-79862193 CAGCATGGATAGAGTGAAAATGG - Intergenic
910867124 1:91798851-91798873 CTGTAGGGAATAAGGGAAATAGG + Intronic
911476272 1:98377284-98377306 CTGCAGATACTGAGGGACAATGG - Intergenic
912795205 1:112689175-112689197 CTGCAGGGTGTGAGGGAAGGGGG + Intronic
914422417 1:147541579-147541601 GGCCAGGGATTGCGGGAAAAGGG + Exonic
915990184 1:160506965-160506987 GTGGAGGGACTGAGGGGAAAAGG + Intronic
916666613 1:166973520-166973542 TTGCAGGGAGTGAGAGAAGAAGG - Intronic
916808275 1:168281169-168281191 CTTCAGGCAGGGAGGGAAAAAGG + Exonic
917666545 1:177230650-177230672 CCGCAGGCCTTGTGGGAAAAAGG + Intronic
917990799 1:180376696-180376718 CTGTAGGGAGTGGGTGAAAAAGG + Intronic
919765497 1:201124678-201124700 CTGCAGGGCTGGAGGGGAGACGG + Intronic
920228272 1:204453663-204453685 CTACAGGAACTGAGGGAAGAAGG + Intronic
921019205 1:211221056-211221078 CTGCAGTGATCCAGGAAAAAAGG - Intergenic
921342226 1:214145622-214145644 CTGCATGGATAGAGGCAAAGGGG - Intergenic
921568952 1:216755615-216755637 CAGCAAGGATTGAGTTAAAAAGG - Intronic
921862378 1:220053376-220053398 TTTCAAGGATTGAGGGGAAATGG - Intergenic
922309952 1:224379046-224379068 CTGAAAGGATAGAAGGAAAAAGG - Exonic
923211294 1:231806639-231806661 CTGCAGGGTTCGAGGGTGAAAGG + Intronic
923260594 1:232264368-232264390 CTGCAGAGATGGAGAAAAAATGG - Intergenic
1062779604 10:189980-190002 CTGTAGGGCTTAAGGGAAAGTGG + Intronic
1063606228 10:7525270-7525292 CTGCTGGGAATAAGGGAGAACGG - Intergenic
1063662299 10:8043217-8043239 CTGCAGGTTCTAAGGGAAAAGGG + Intergenic
1064128443 10:12685717-12685739 CTGGAGAGATTGAGAGAGAAAGG + Intronic
1064417972 10:15167719-15167741 CTGCAGGGTTCGGGGGCAAAGGG + Intronic
1064648101 10:17480925-17480947 CTACAGGGTTTCAGGGAGAAAGG - Intergenic
1064894278 10:20216258-20216280 GTACAGGGATAGATGGAAAAAGG + Intronic
1065662238 10:28018065-28018087 CAGAAGGGATTCTGGGAAAAAGG - Intergenic
1066459509 10:35600962-35600984 CTCCAGGGCTGGTGGGAAAAGGG - Intergenic
1068141429 10:53013077-53013099 CTGCAGCGCTTGAAGGAACATGG - Intergenic
1068670347 10:59716062-59716084 AGGCAGGCATTGAGGGAGAATGG + Intronic
1070156102 10:73836562-73836584 ATGCAGAGAATGAGGGAAAGAGG + Intronic
1070729236 10:78813862-78813884 CAGCAGGGATGGAGGCAGAATGG - Intergenic
1071730433 10:88243292-88243314 CAGCAGAGCTTCAGGGAAAATGG - Intergenic
1072541376 10:96400683-96400705 TTTCAGGGAAAGAGGGAAAAAGG + Intronic
1072623513 10:97096394-97096416 CAGGAGGGGTTGAGGGAACAGGG - Intronic
1073639779 10:105240099-105240121 GTGCAGGGATGCAGGGCAAAGGG - Intronic
1073925872 10:108514563-108514585 CTGAAGGGGATGAGGGAAAATGG - Intergenic
1073948125 10:108776040-108776062 CTGCAGGCATTGAATGAGAAAGG - Intergenic
1076414245 10:130273892-130273914 CTCCAAGGATTTAGGGAAAAAGG - Intergenic
1076813251 10:132899856-132899878 CTGCAGGGATGCAGGGCAAGGGG + Intronic
1077613337 11:3658607-3658629 CTGCAGGGAGTGGGGGCAACTGG + Intronic
1077809268 11:5621121-5621143 ATGCAGGGGTTAAAGGAAAATGG - Intronic
1078442363 11:11378421-11378443 CTGCAGGGCTGGAGGGCACAGGG - Intronic
1078666358 11:13328938-13328960 CTGTAGGGATTGAAGGAGATTGG + Intronic
1079089009 11:17467737-17467759 CTGCAGGGACAGAAGGAAATGGG - Intronic
1080049580 11:27845807-27845829 CTGTGGAGATTGAGAGAAAAAGG - Intergenic
1080217500 11:29861996-29862018 CTGTGGGGTTTGAGGGAAACAGG + Intergenic
1081114392 11:39181308-39181330 GTGTAGTGATTGATGGAAAATGG + Intergenic
1081256718 11:40905504-40905526 CCCCAGGGATTGAGGCAACAAGG + Intronic
1081651547 11:44827352-44827374 CAGCAGGGGCTGAGGGAGAAAGG - Intronic
1083392174 11:62360816-62360838 TTACAGGAATTGAGGGAAAGAGG + Intronic
1085237219 11:75024336-75024358 CTGCAGAAACTGAGGGAAAGTGG + Intergenic
1085494547 11:76956036-76956058 CTGGAGGGGTTGAGAGAAAATGG + Intronic
1086923437 11:92613897-92613919 CTGGGGGGATTAAAGGAAAATGG - Intronic
1087267844 11:96080347-96080369 CTGAAAAGAGTGAGGGAAAAGGG + Intronic
1087837783 11:102892058-102892080 GAGCAGGGAAAGAGGGAAAAAGG - Intergenic
1087985732 11:104677212-104677234 TTGCAGGGAGGGAGGGAAAGAGG - Intergenic
1088673525 11:112167561-112167583 CGGCGGGAAGTGAGGGAAAATGG + Intronic
1089016920 11:115172909-115172931 CTGAGGGGATGGTGGGAAAAGGG + Exonic
1092210811 12:6645338-6645360 CTGCAGGAAGAGAAGGAAAATGG + Intronic
1092262355 12:6959496-6959518 CGTCAGGGTTTGAAGGAAAAGGG + Intronic
1092298157 12:7218804-7218826 CTGCAGGGATTGGGGGATAAGGG - Intergenic
1093360596 12:18221931-18221953 CTCCAGGGATTTGGGGAAATTGG + Intronic
1094452459 12:30597081-30597103 CAGCAGGCATTGAGTGAAGAAGG + Intergenic
1095403121 12:41838299-41838321 CTTCAGGGAAAGAGGGAAAGTGG - Intergenic
1095536090 12:43249434-43249456 CTTCAGGGACTCAGGGGAAAGGG + Intergenic
1095995972 12:48085054-48085076 CTGCAGGGATGGCGGGGAGAAGG + Intronic
1096240610 12:49958024-49958046 CTCCAGGGGTGGAGGGAAATTGG + Exonic
1096723790 12:53544958-53544980 ATCCAGGGATGGAGGGAAAGTGG - Intronic
1096867337 12:54572578-54572600 CTGCGGGGAGTTAGGGGAAATGG - Intronic
1096879510 12:54656191-54656213 TTGGAGGGATTCAGGGAACAGGG - Intergenic
1096947203 12:55420131-55420153 CTGCAGAGTTTGGGGGAAATGGG + Intergenic
1097242912 12:57588472-57588494 ATGTGGGGATTGAAGGAAAAGGG - Intergenic
1097298148 12:57989414-57989436 ATGTGGGGATTGAGGGAAAGAGG + Intergenic
1099464829 12:82970827-82970849 CTGCAGTTACTGAGAGAAAAAGG - Intronic
1099952768 12:89322960-89322982 ATGCAGGGGTTAAGGGATAAAGG + Intergenic
1100931724 12:99617633-99617655 TTTCAGGGGTTGGGGGAAAAAGG + Intronic
1101720557 12:107346892-107346914 CTGCAGGGAATGAAGAAACAGGG + Intronic
1101748751 12:107565240-107565262 CTGCAGGACTTGAAGGAAATGGG + Intronic
1101829030 12:108242870-108242892 CTGCAGGGAGTATGGGATAAGGG + Intronic
1102216249 12:111163504-111163526 CTCCAGGAATGGAGGGACAATGG - Intronic
1102307322 12:111814950-111814972 CTGCAGAGATTGTGAGGAAATGG - Intergenic
1102644095 12:114392769-114392791 CAGCAGCCATTGAGGGAAACAGG + Intronic
1102728262 12:115084913-115084935 CTGGGGGGAGGGAGGGAAAAGGG + Intergenic
1102784512 12:115593388-115593410 CTGTGGGGATTCAGGGGAAAGGG - Intergenic
1102909443 12:116701409-116701431 CTGAAGGGACTGGGGGAAATGGG - Intergenic
1104121916 12:125807979-125808001 GTGCAGGGGTTGAAGGAATAAGG + Intergenic
1105316167 13:19266095-19266117 TTGCAGGGTCAGAGGGAAAAGGG + Intergenic
1105345935 13:19572732-19572754 CTGCAGGGATTGGGGGATGTGGG + Intergenic
1106123360 13:26880381-26880403 TTGCAGGGATTTAGTGAAATTGG + Intergenic
1106244282 13:27933949-27933971 CTCCAGGGCTCCAGGGAAAAGGG - Intergenic
1106848085 13:33759425-33759447 CTGCATTGATAGAGGGAAATGGG - Intergenic
1108240637 13:48459772-48459794 CTGCAGGGTGTGCTGGAAAAGGG - Exonic
1108391249 13:49950007-49950029 CTTCAGGGACTCAGGGGAAAGGG + Intergenic
1108482310 13:50886426-50886448 GTTCAGGGATGGAGGGAAGAGGG + Intergenic
1108682293 13:52790625-52790647 TTGCAGGGAGTGATGGAAATGGG - Intergenic
1110418614 13:75279358-75279380 CTGCAGGGATTGGGGAAAAGGGG + Intergenic
1110469299 13:75840904-75840926 CTGCAGGCACTGGGGTAAAAAGG - Intronic
1112264758 13:97913124-97913146 CTGCACGGATTCAGGTCAAATGG + Intergenic
1113081615 13:106526122-106526144 CTGCAGGGCTTGAGAAAACAGGG - Intronic
1115874901 14:37849951-37849973 CTGCAGGCATACATGGAAAAAGG - Intronic
1116872948 14:50084940-50084962 ATGGAGGGATGGAGGGAGAAAGG + Intronic
1117230542 14:53712907-53712929 CTTCGGGGATTCAGGGGAAAGGG - Intergenic
1118057692 14:62098844-62098866 CTGGTGGGAGTGAGAGAAAAAGG + Intronic
1118104868 14:62647126-62647148 ATGGAGGGATTGAAGGAAGACGG - Intergenic
1118969717 14:70624043-70624065 ATGCAGAGATTGAGGGTGAAAGG + Intergenic
1119027997 14:71168969-71168991 CCCCAGGGCTGGAGGGAAAAAGG - Intergenic
1119195193 14:72712503-72712525 CTGCAGAGATAGAGCAAAAAGGG + Intronic
1119527521 14:75334074-75334096 CTCCAGGGCTTTAGGGGAAAAGG + Intergenic
1120640211 14:87001245-87001267 CTGCAGGCACTCAGGGAGAATGG - Intergenic
1121869991 14:97398562-97398584 TTGCAGGAGTTCAGGGAAAAAGG - Intergenic
1122147480 14:99700214-99700236 CTGAAGGGAGAGAGGAAAAAGGG + Intronic
1123005904 14:105323737-105323759 CTGCAGTGATCCAGGGAAGATGG + Intronic
1125081170 15:35675275-35675297 CTAAAAGGATTCAGGGAAAAAGG + Intergenic
1125490777 15:40147073-40147095 CAGCAGGGATAAAGAGAAAAGGG + Intergenic
1125512183 15:40298072-40298094 CAGCAGGGATTGGGGGCCAATGG - Intronic
1125767468 15:42145161-42145183 CTGGAGGGATGGAGTGGAAAAGG + Intronic
1127209310 15:56756686-56756708 TTGCAGATATTGAGGGACAATGG - Intronic
1127300860 15:57652159-57652181 ATGAAGGAATGGAGGGAAAAAGG - Intronic
1128263848 15:66251974-66251996 CTGCAGGGAGTGACGGCAGAGGG + Intronic
1128932337 15:71716741-71716763 CTGCTTGGTTTGAGGGAAAAAGG - Intronic
1129590220 15:76908196-76908218 CTGAGAGAATTGAGGGAAAATGG - Intergenic
1129665054 15:77575016-77575038 CTACAAGGATTGAGGGAAGGGGG + Intergenic
1129930610 15:79407507-79407529 CTGGAGGCAATGAGGGAAGACGG + Intronic
1130654300 15:85781346-85781368 CTGGAGAGAATGAGTGAAAAGGG + Intronic
1130886013 15:88093283-88093305 CTGCAGGGAGTGGGAAAAAAAGG + Intronic
1130897626 15:88183380-88183402 CTGCAGGGATTGGGGGCACATGG - Intronic
1131046592 15:89320428-89320450 CTACAGGGAATGAGAGCAAATGG - Intronic
1131449318 15:92525987-92526009 AAGGAGGGATGGAGGGAAAAAGG - Intergenic
1131571152 15:93537793-93537815 CTGAAGGGATCGGGAGAAAAAGG - Intergenic
1132120140 15:99169119-99169141 CCACAGGGAGTGAGGGAGAAAGG - Intronic
1132934311 16:2473245-2473267 CTGCAGAGAGGGAGGGAGAATGG - Intronic
1133985367 16:10664264-10664286 CTGCAGGGAGGGAAGGAAGAGGG + Intronic
1134054412 16:11160509-11160531 CTGAAGGGAAAGAGGGAAAGGGG - Intronic
1135110177 16:19684577-19684599 CTGTAAGGATTAAGGGAAAAAGG - Intronic
1136372719 16:29846214-29846236 CAGCCCGGATTGAGGGAGAAGGG + Exonic
1136410169 16:30071834-30071856 CTGCAGTGATTCAGGTAGAACGG + Intergenic
1137630784 16:49942706-49942728 CTGGAGGGATGTAGAGAAAAGGG + Intergenic
1138219192 16:55236619-55236641 CAGCAGGGATGGAGTGAAAAAGG + Intergenic
1139192311 16:64879056-64879078 CAGCAGGAACAGAGGGAAAAAGG - Intergenic
1139700411 16:68704582-68704604 CTGCAGGGAGGGAGGGAGAGAGG + Intronic
1140067089 16:71620801-71620823 CTGCAGGGAGGGAGGAAGAAAGG - Intergenic
1141171558 16:81694855-81694877 CCTCAGGCATGGAGGGAAAAAGG + Intronic
1141407873 16:83809241-83809263 CTGCAGGGACGGGAGGAAAAAGG + Intronic
1141839428 16:86565423-86565445 CTTCAGGGAAAGTGGGAAAAGGG + Intergenic
1141851111 16:86646628-86646650 TAGCTGGGATTGAAGGAAAAGGG + Intergenic
1143022107 17:3922110-3922132 AGGCCGGGAATGAGGGAAAATGG - Intergenic
1143175249 17:4951389-4951411 CAGCAGGGATGGATAGAAAAGGG + Intronic
1143455601 17:7065612-7065634 CTGCAGGACTTGGGGGAACATGG + Intergenic
1143577882 17:7805238-7805260 CTCCAGGGCCTGGGGGAAAAGGG - Exonic
1143881529 17:10033786-10033808 CTGCAGGCACTGAAGGAAAATGG + Intronic
1143920737 17:10329267-10329289 CTGCAGGGATTGGAGGGAGAGGG - Intronic
1144204683 17:12971760-12971782 CACCAGGGATGGAGGGAAAGGGG - Intronic
1144520231 17:15948087-15948109 GTGCAGGGAGTGAGGGCTAAAGG + Intronic
1144524375 17:15977906-15977928 CTGCAGTCCTGGAGGGAAAAGGG + Exonic
1145065374 17:19758070-19758092 CTCCAGGGAAGGAAGGAAAAAGG + Intergenic
1146842239 17:36164101-36164123 CTGCAGGGCTTGAGAGGGAACGG - Intergenic
1146854550 17:36252060-36252082 CTGCAGGGCTTGAGAGGGAACGG - Intronic
1146866070 17:36336316-36336338 CTGCAGGGCTTGAGAGGGAACGG + Intronic
1146870450 17:36375952-36375974 CTGCAGGGCTTGAGAGGGAACGG - Intronic
1146877807 17:36427033-36427055 CTGCAGGGCTTGAGAGGGAACGG - Intronic
1147030857 17:37634694-37634716 CTTCATAGATTGAGGGAGAAAGG - Intronic
1147068940 17:37936928-37936950 CTGCAGGGCTTGAGAGGGAACGG + Intergenic
1147073333 17:37976576-37976598 CTGCAGGGCTTGAGAGGGAACGG - Intergenic
1147080464 17:38016465-38016487 CTGCAGGGCTTGAGAGGGAACGG + Intronic
1147084854 17:38056114-38056136 CTGCAGGGCTTGAGAGGGAACGG - Intronic
1147096411 17:38140425-38140447 CTGCAGGGCTTGAGAGGGAACGG + Intergenic
1147100802 17:38180080-38180102 CTGCAGGGCTTGAGAGGGAACGG - Intergenic
1147907824 17:43834046-43834068 CTGCTGGGATTGAGGGAAGGGGG - Intergenic
1148050299 17:44766820-44766842 CACCAGGGATGGAGGGACAATGG + Intronic
1148675361 17:49441755-49441777 CTGCAGGGAGGGAGGGAGAGGGG - Intronic
1149063870 17:52457352-52457374 CTGCTGAGGTTGTGGGAAAATGG + Intergenic
1150288222 17:63966043-63966065 CTGCAGGGATGGAGGGGGAGTGG + Intronic
1150370268 17:64631416-64631438 ATGCAGGGGTTGAAGGAAATGGG + Intronic
1150842374 17:68620749-68620771 CTGGAGGGAAGGATGGAAAAAGG + Intergenic
1151109934 17:71664267-71664289 CAGCAGGGATTGAAGGAAAGGGG - Intergenic
1152044932 17:77929567-77929589 CTGCAGGTATTGAGGCCAGAAGG + Intergenic
1152360188 17:79829444-79829466 CAGCAGGAACTGAGGGAAGAAGG + Intergenic
1154064589 18:11095127-11095149 CTACATGGAATGAGTGAAAATGG + Intronic
1157332724 18:46715178-46715200 CTGCAGAAAAGGAGGGAAAAAGG - Intronic
1157422260 18:47557013-47557035 TTGCAGGGATTGGGGGAGGAAGG - Intergenic
1158519931 18:58163432-58163454 CTGCAGCGCTTCAGGGAACAGGG + Intronic
1158933239 18:62341499-62341521 CTGAGGGGAGAGAGGGAAAAGGG - Intronic
1159605308 18:70468756-70468778 CTGCATGAACTGAGGGGAAAAGG + Intergenic
1159818153 18:73103428-73103450 CTGCAGGAATTGTTGGACAATGG - Intergenic
1159874864 18:73799565-73799587 GGGTAGGGATTGAGGGTAAAGGG - Intergenic
1162023297 19:7878823-7878845 CTGCAGGGAAGGAGGGTAATGGG + Intergenic
1162540808 19:11294894-11294916 CTGCATGGATTGGGGGAAGGCGG - Intergenic
1163556564 19:17996805-17996827 TTGCACTGATGGAGGGAAAAGGG + Intronic
1164286525 19:23822189-23822211 CTGCAATGATTGAGGGAAGGTGG - Intronic
1164677894 19:30114117-30114139 CTTCAGGGACTCAGGGGAAAAGG - Intergenic
1165027016 19:32969572-32969594 CTGCAGGGATGGAGGGTGAAGGG + Intronic
1165929127 19:39344671-39344693 CTGAAGGGATAATGGGAAAAGGG - Intronic
1166445321 19:42853531-42853553 CAGCAAGGATTTAGGGACAAGGG + Intronic
1166506190 19:43373129-43373151 CTCCTGGGACTGAGGGAGAAGGG - Intergenic
1166662120 19:44654096-44654118 CTCCTGGGACTGAGGGAGAAGGG + Intronic
1167180947 19:47903117-47903139 GTGCAGGGATTGAGGGGAAAGGG - Intergenic
1167367926 19:49064558-49064580 CTCCAGGGTCTGAGGGAGAAGGG - Intronic
1167668935 19:50838813-50838835 CTCCTGGGTTTGAGGGAGAAAGG + Intergenic
1167805943 19:51785532-51785554 TTGTAAAGATTGAGGGAAAAGGG - Intronic
1168214164 19:54912971-54912993 CTGCAGGGAAAGAGGGACACTGG + Exonic
1168280357 19:55302377-55302399 CTCCCAGGTTTGAGGGAAAAAGG + Intronic
1168481023 19:56719693-56719715 CTGCTGGGATGGAGGAAAGATGG + Intergenic
925169426 2:1741959-1741981 AGGCAGGGACTGAGGGAAGAGGG - Intronic
925421264 2:3713742-3713764 CTGTAGGGATTGATCTAAAATGG + Intronic
926463120 2:13158287-13158309 CTGTGGCGATTGAGGGGAAACGG + Intergenic
927194484 2:20538330-20538352 CTCCAGGGAGTGAGAGAAAGGGG - Intergenic
927849745 2:26491360-26491382 GTGGAGGGGTGGAGGGAAAAAGG + Intronic
927932682 2:27055287-27055309 ATGCAGGGCATGAGGGGAAATGG - Intronic
929033351 2:37669560-37669582 CTGCTCAGATTGAGGGAAAGAGG + Intronic
929176133 2:38978339-38978361 CTGAAGGGAATGAGGCAAGAAGG - Intergenic
929532056 2:42759220-42759242 CTGCTGAGATGGAGGAAAAATGG - Intergenic
929575017 2:43046172-43046194 CTTCAGGGATTGAGGAGGAAAGG - Intergenic
929588679 2:43131637-43131659 CAGCAGGGACTGAGGGAGAAGGG - Intergenic
929696064 2:44116539-44116561 ATGCAGTCATAGAGGGAAAATGG + Intergenic
930425656 2:51209355-51209377 TTGCAGGGATTCCTGGAAAATGG + Intergenic
932942350 2:76182170-76182192 TTGCATGGTTTGAGGGAAAGAGG + Intergenic
933896569 2:86815670-86815692 ATGCAGGCATTGGGGGACAAAGG + Exonic
934146610 2:89100957-89100979 CTGCATGCATTGAGGAAACACGG - Intergenic
934220937 2:90082171-90082193 CTGCATGCATTGAGGAAACATGG + Intergenic
934222655 2:90099617-90099639 CTGCATGCATTGAGGAAACACGG + Intergenic
934233574 2:90209410-90209432 CTGCATGCATTGAGGAAACACGG + Intergenic
934904097 2:98184277-98184299 CTGCAAGGATGGAAGGAGAAAGG - Intronic
939005504 2:136781963-136781985 CCACAGGGCTTGTGGGAAAAAGG + Intronic
940318721 2:152351348-152351370 CTGCTGGGATTGGTGGGAAAGGG - Intronic
940730292 2:157381563-157381585 CTGCAAGGATGGGGAGAAAAGGG + Intergenic
940850455 2:158683232-158683254 ATGAAGGGATGGAGGGAGAATGG - Intergenic
941142973 2:161807457-161807479 CTTCAGGGATGGAGTGAATATGG - Intronic
943741148 2:191410440-191410462 CTTCAGGGATGGAGTGAAAGGGG + Intronic
944534024 2:200692290-200692312 TTGCAGCGATTGGGGGAAAACGG - Intergenic
944934507 2:204553873-204553895 CTTCAGGGACTCAGGGAGAAAGG + Intronic
946078630 2:217097183-217097205 CTGCAGTGATTGAGGGAGTTTGG + Intergenic
947751745 2:232536161-232536183 CTGCAGGAATTGGGAGACAAGGG + Intronic
948890231 2:240903777-240903799 CTGCAGTGACTGAGGAAAAGGGG + Intergenic
949048932 2:241886736-241886758 CTGCAGAGAATGAGGAAAAATGG + Intergenic
1168904976 20:1395837-1395859 CTGCTAGGCTTCAGGGAAAACGG - Intergenic
1169024785 20:2360605-2360627 TTCCAGGGGTTCAGGGAAAAGGG - Intergenic
1169068643 20:2708317-2708339 CTGCTGGGGTTGCGGGAACAGGG + Intronic
1169142791 20:3235645-3235667 CTGCAGGAATTGAGGACCAAGGG - Intronic
1169262861 20:4150179-4150201 CTGGAGGGAATGAGGGATTAAGG - Intronic
1170010096 20:11713349-11713371 CTGAAGGTTTTGAGAGAAAAGGG + Intergenic
1170069714 20:12352939-12352961 CTCCAAGGATTGAGGGAAGAAGG + Intergenic
1171006232 20:21467994-21468016 CTGCATGGAGTGTGGGGAAATGG - Intergenic
1171464810 20:25320000-25320022 CTGAAGGGGTTGAGGGAAGGCGG - Intronic
1172965052 20:38828604-38828626 CTGCAGGGATGGTGGCAACAAGG + Intronic
1173784399 20:45782245-45782267 CTGCAGGCATTGAGGGAGACGGG - Intronic
1174213737 20:48900193-48900215 CTGCAGGAATAATGGGAAAAGGG - Intergenic
1174291180 20:49509840-49509862 CTGCAGGGATTGAGGGAAAAGGG - Intronic
1174392913 20:50228904-50228926 CTGGTTGGATAGAGGGAAAAAGG - Intergenic
1175884785 20:62283576-62283598 CTGCACTGATTGATAGAAAAGGG + Intronic
1177681711 21:24379833-24379855 TTGCAGGGTGTGGGGGAAAAGGG - Intergenic
1178068880 21:28938898-28938920 CTGCGGGGTTTGAGAGGAAATGG + Intronic
1178364551 21:31978478-31978500 CTGAAGGGGATGAGGGAAAGTGG - Intronic
1178529777 21:33366140-33366162 CTGCAGGCATTGAAGGAAGAGGG - Intergenic
1178777583 21:35566960-35566982 CTGCAAGGGTTGAGGGGTAAGGG - Intronic
1179286910 21:39985347-39985369 ATGCAGGGATGGAGGAAGAAGGG - Intergenic
1180668478 22:17534086-17534108 CTGCAGTGATTGAGAGAGAATGG + Intronic
1182803945 22:33054890-33054912 ATGCAGGGAATATGGGAAAAGGG - Intronic
1184453863 22:44598189-44598211 ATGCAGTGATTGAGGGAAAGAGG + Intergenic
1185300271 22:50076047-50076069 AGGCAGGGAAGGAGGGAAAAAGG + Intronic
950100777 3:10355435-10355457 CTGAAGGAAGTGAGGGAAGATGG + Intronic
950272959 3:11633837-11633859 CTGCAGGGTGTGAGCGAACATGG + Intronic
950321874 3:12063311-12063333 CTGAAATGAATGAGGGAAAAAGG + Intronic
950439785 3:13003476-13003498 CACAAGGGACTGAGGGAAAATGG + Intronic
950526863 3:13529348-13529370 CAGGAGGGATGGAGGGAAAAGGG - Intergenic
951498952 3:23362488-23362510 CAGCAGGGATGGAGGGAGGAGGG - Intronic
951512460 3:23518732-23518754 AGGCAGGGACAGAGGGAAAAAGG - Intronic
951969366 3:28426672-28426694 TTGCAGGGGCTGATGGAAAAGGG - Intronic
952659611 3:35829506-35829528 CTGCAGGGAGTTGAGGAAAATGG - Intergenic
952979927 3:38726539-38726561 CTTCAGGGCTTGAGTGACAAAGG - Intronic
954667456 3:52264451-52264473 CAGCAGGGAATGAAGGATAAAGG + Intronic
954920573 3:54187482-54187504 CTGCAGGGCTGGAGGGTAATGGG + Intronic
955408193 3:58639176-58639198 CTGGACGGAATGAGGGAAGAGGG + Intronic
955474315 3:59320168-59320190 GTGCAGAGATTGAGAGAATAGGG - Intergenic
955527447 3:59836013-59836035 CTATGGGGAGTGAGGGAAAATGG - Intronic
956588688 3:70890324-70890346 CTGCATGGATTGCGGGGAAGTGG - Intergenic
957803968 3:85122723-85122745 CGGCAAGGATTGAGGAAAAGAGG - Intronic
957929999 3:86864911-86864933 CACCAGGGATTGAGGGGAAGAGG + Intergenic
958061269 3:88484605-88484627 CTAAAGGGGATGAGGGAAAAGGG + Intergenic
960635223 3:119778488-119778510 ATAAAGGGATTGAGGGGAAAAGG - Intergenic
960791022 3:121430974-121430996 CTGCAGAGAATGAGGCAGAAGGG + Intergenic
962241719 3:133755831-133755853 CTGCTGAGATTGAGGGAAGAGGG - Intronic
962416374 3:135186195-135186217 ATCCAGAGAGTGAGGGAAAATGG - Intronic
963715708 3:148801378-148801400 ATGAAGGGATAGAGGGAAAGAGG - Intronic
964392230 3:156210018-156210040 CTGCAGGGAAGCAGGGAAACTGG - Intronic
966010345 3:175067599-175067621 CTGCAGGGCTGCAGAGAAAAAGG + Intronic
966921290 3:184613288-184613310 CTGGAGGGAATGAGGGAATGAGG - Intronic
967855995 3:194117908-194117930 CTGCAGGGTTTGAGGGACAGGGG + Intergenic
968819402 4:2838107-2838129 CTGCAGGAAATGAATGAAAAAGG - Exonic
968969575 4:3786608-3786630 CTGCAGGGATGGTGCAAAAAAGG - Intergenic
969546635 4:7834342-7834364 CTTTGGGGATTCAGGGAAAAAGG + Intronic
970142333 4:12996168-12996190 CTGCAGGGATATAGGGGAGATGG - Intergenic
970675828 4:18449417-18449439 TTGCAGGGATTGATTGCAAAGGG + Intergenic
972953861 4:44364899-44364921 AGGCAGGGAGTGAGGGAAGAAGG + Intronic
974858897 4:67495939-67495961 CAGCAGAGATTGAAGGAGAAGGG - Intronic
976104197 4:81599535-81599557 AAGCAGGGACTGAGGGAAATAGG - Intronic
976593192 4:86869816-86869838 CAGCAAGAATGGAGGGAAAAAGG - Intergenic
976605357 4:86977557-86977579 ATGCAGGGGGTGAGGGAAAAAGG - Intronic
976800295 4:88982960-88982982 CTCCAGTGATTGATGGAAATGGG + Intronic
977637788 4:99320205-99320227 CTTTGGGGACTGAGGGAAAAGGG - Intronic
977760655 4:100732717-100732739 CTGGAGGAAGTGAGGGCAAAGGG + Intronic
978802277 4:112766650-112766672 CTGCTGGGCTTGAGGGTAGAGGG - Intergenic
979314161 4:119240406-119240428 CAACAAGGATTGAGGCAAAATGG - Intronic
979627099 4:122857349-122857371 CTTCAGAGATAGAGAGAAAAGGG - Intronic
980984766 4:139684681-139684703 CTTCAGGGGTTGAAGGAAAGAGG + Intronic
981630697 4:146815245-146815267 TTGCAGAGATAGAGGGAAAAGGG + Intronic
981763802 4:148224040-148224062 CTAAAGGGATTAAGTGAAAAAGG + Intronic
982520156 4:156406543-156406565 TGGCAGGGATGGAGGGAAAAGGG + Intergenic
982803996 4:159740345-159740367 CTTCAGGGATTCAGGGGAAAGGG - Intergenic
983809872 4:172048462-172048484 CTGTGGTGACTGAGGGAAAATGG - Intronic
984163851 4:176285297-176285319 TTGCAGGGAGTGTGGGGAAAGGG - Intergenic
984731070 4:183068808-183068830 ATGCAGGAAATGAAGGAAAATGG + Intergenic
984842694 4:184082810-184082832 GTGAAGTAATTGAGGGAAAATGG + Intergenic
984936767 4:184896893-184896915 CTGCAGGGGTTGGGGGAAAGGGG + Intergenic
985657961 5:1141991-1142013 CTGCAGGGCTGCAGGGAAGAGGG - Intergenic
986888480 5:12270268-12270290 CTGAAAGTATTGAGGAAAAAGGG + Intergenic
988598313 5:32615853-32615875 CTGGTGGGATTGAGGTGAAAGGG + Intergenic
989985228 5:50689495-50689517 TTTCAGGGAAGGAGGGAAAATGG + Intronic
990497505 5:56363313-56363335 CCGCAGGTATAGAGTGAAAATGG - Intergenic
991021812 5:61987248-61987270 CTGTGGGGATTGAGGGAGATTGG + Intergenic
991153541 5:63400867-63400889 CTGTAGTGTTTGAGGGCAAAGGG + Intergenic
992488023 5:77214378-77214400 CTGTATGAATGGAGGGAAAACGG - Intronic
993951325 5:94179372-94179394 TTGAAGGGAATGGGGGAAAAGGG + Intronic
994310258 5:98261024-98261046 TTTAAGGGATTGTGGGAAAAAGG + Intergenic
996578618 5:125004993-125005015 CAGCATGGTTTGAGGGGAAATGG - Intergenic
996729968 5:126707460-126707482 CTGCAGTAATTGGGGAAAAAAGG + Intergenic
996784719 5:127226443-127226465 TTCCAGGGACTGGGGGAAAAGGG - Intergenic
996962185 5:129264416-129264438 CTGGAGGGATTAGGGGAAAAAGG - Intergenic
997580754 5:135015338-135015360 CTGCAGAGCTAGAGGGAAAGGGG + Intergenic
998228552 5:140345047-140345069 CTCCTGGGAATGAGGGAGAAGGG + Intronic
998533585 5:142908431-142908453 ATGCAGAGAAAGAGGGAAAAGGG - Intronic
999434922 5:151556086-151556108 CTGCAGGGAGTGAAGGAGAGGGG - Intronic
1000493478 5:161946641-161946663 ATGCAAGGATTGATAGAAAAGGG + Intergenic
1002157973 5:177297790-177297812 CAGGAGGGAGTGAGGGAAAGGGG + Exonic
1002568317 5:180126588-180126610 CTCCAGGCACTGAGAGAAAACGG - Intronic
1002949342 6:1793697-1793719 TTGCAGAGAATGAAGGAAAAGGG - Intronic
1003044311 6:2719061-2719083 TAGCAAGGAATGAGGGAAAACGG + Intronic
1003291194 6:4779658-4779680 CTGCTAGGATTGAGGAAAAACGG + Intronic
1003421602 6:5963409-5963431 CTGCAAGGATTGGGGCAACATGG - Intergenic
1003428679 6:6018873-6018895 CTGAAGGGGGTGAGGGGAAAAGG - Intergenic
1004878046 6:19976074-19976096 CTCCAGGCCTTGGGGGAAAATGG - Intergenic
1005136168 6:22570903-22570925 CTTCAGACATTTAGGGAAAAGGG + Exonic
1006093035 6:31639423-31639445 CTGAAGGGATCCAGGGAAGAGGG + Intronic
1006195694 6:32240629-32240651 ATGGAGGGAATGAGGGAAATAGG + Intergenic
1006327398 6:33364928-33364950 CTGCAGGGAAGGAGGGTAACGGG + Intergenic
1006446330 6:34081775-34081797 CTCCAGGGATGCAGAGAAAAAGG + Intronic
1006740816 6:36307148-36307170 CTGCAGGTATTGAGAGAGCAGGG + Intronic
1007313142 6:40962646-40962668 CTGCATGAATTCAGGGAAACTGG - Intergenic
1008050772 6:46898479-46898501 CTTCAGGGAAGGAGGGAGAAAGG + Intronic
1008248825 6:49211986-49212008 CTCCAGGGCTTGAGAGAAATAGG - Intergenic
1008275761 6:49542467-49542489 CTTCAGGGATTGAAGAAGAAGGG + Intergenic
1010835579 6:80584013-80584035 CTGAAGGAAGTGAGGGAACACGG + Intergenic
1011731305 6:90266736-90266758 TTCCAGGGGTTGAGGGATAAGGG + Intronic
1012372384 6:98523399-98523421 CTGCAGGCATGGAAGTAAAATGG + Intergenic
1012494280 6:99817222-99817244 CAGCATGGAAAGAGGGAAAAAGG - Intergenic
1013913409 6:115306046-115306068 CTTCAGGGACTCAGGGGAAAGGG - Intergenic
1014432595 6:121388511-121388533 CTGCAGGGATGGAAGGAGAGGGG - Intergenic
1014888608 6:126814024-126814046 CTGCAGGCATTGTGGGAACCAGG + Intergenic
1015678417 6:135777474-135777496 TTCAAGGGATTGAGGGGAAATGG + Intergenic
1015955090 6:138590433-138590455 CCTCAGGGAGTGAGGGGAAAGGG - Intronic
1016456868 6:144240061-144240083 GTGAAGGGATGGGGGGAAAATGG - Intergenic
1016772652 6:147869461-147869483 CTGAATGGAATGGGGGAAAATGG + Intergenic
1017680880 6:156862630-156862652 CTGCAGTGATTGATGGTACAAGG + Intronic
1017897384 6:158692473-158692495 CTGCTGGGAGGGAGGGATAAAGG - Intronic
1018645561 6:165944631-165944653 CTGCAGGGCTTATGGGAAAATGG - Intronic
1018675953 6:166222597-166222619 CTACGGGGATTGAGGGAAGGCGG + Intergenic
1020034050 7:4953135-4953157 CTGTAGGGATGGAGGAAACAGGG - Intronic
1021276861 7:18662708-18662730 CAGCAGGGAGTGAGGAAAAGGGG + Intronic
1021444117 7:20714477-20714499 CTACAAGAATTGAAGGAAAACGG - Intronic
1021812567 7:24417381-24417403 CTGCAGTGACTGGAGGAAAAGGG - Intergenic
1023129401 7:36987403-36987425 CCACAGAGATTGATGGAAAATGG + Intronic
1023513419 7:40977210-40977232 CTGCTGGGAGGGAGAGAAAAGGG + Intergenic
1023590865 7:41779215-41779237 CAGTAGGGATTGCGGGAAGAAGG + Intergenic
1024426246 7:49229580-49229602 CTGAAGGTTTTCAGGGAAAATGG + Intergenic
1025636558 7:63325036-63325058 GTGCTGGTATTGAGGGGAAAAGG + Intergenic
1025646138 7:63423066-63423088 GTGCTGGTATTGAGGGGAAAAGG - Intergenic
1025724946 7:64047810-64047832 GTGCTGGTATTGAGGGAAAAAGG + Intronic
1027767366 7:82362548-82362570 CTGCAGTAATGGAGGAAAAAAGG + Intronic
1028228192 7:88274420-88274442 ATGAAGGGATTGAGGGCAAAGGG - Intergenic
1028646128 7:93098679-93098701 CTGCTGGCATTGAGGAAATAAGG + Intergenic
1028786558 7:94801139-94801161 CTGCAGGATTTGGGGGCAAAAGG - Intergenic
1029510068 7:100988673-100988695 CTGCAGGGTTAGAGGTCAAAGGG + Intronic
1029574664 7:101395558-101395580 CAGCGGGGCTGGAGGGAAAATGG + Intronic
1032739287 7:134722801-134722823 CAGCAGGGACTGTGGGTAAATGG - Intergenic
1034061876 7:148099568-148099590 CTGCAGCCATTGGGGGAAAAGGG - Intronic
1034459613 7:151191280-151191302 CTGCAGGTGTGGAGGGAAGAGGG - Intronic
1035198280 7:157241176-157241198 CTGCAGGGCATGTGGGAAAATGG + Intronic
1037681701 8:21103002-21103024 ATGAAGGGATAGAGAGAAAATGG + Intergenic
1037951918 8:23024141-23024163 CAGCAGGAATGGAGGGAATAGGG - Intronic
1039096005 8:33886136-33886158 CTACAGGGAGGGAGGGAAGAGGG + Intergenic
1041800472 8:61792460-61792482 CTGGAGTGTTTCAGGGAAAAAGG + Intergenic
1044194383 8:89356816-89356838 CTGCAGGTGTTTAGGGAAAGTGG - Intergenic
1044322197 8:90815289-90815311 CTGGAGGGATTGAGGGAGAGTGG - Intronic
1045039839 8:98212914-98212936 AGGCAGGGAGTGAGGGAAAGGGG - Intronic
1045064576 8:98434302-98434324 CTGCAGGGATGGTGGCTAAAGGG - Intronic
1045542436 8:103099710-103099732 CAGCAGGGATGAAGGGAGAAAGG - Intergenic
1046037977 8:108867102-108867124 CTATAGGAATTGAGGGAACATGG - Intergenic
1046448633 8:114358669-114358691 CTGCAAGCATTGTGGGCAAATGG + Intergenic
1046958266 8:120083666-120083688 CTGAAGGGACTGTGGGAAGAAGG - Intronic
1047205417 8:122799256-122799278 CTGCAAGGTTTGAGGGAAGTGGG + Intronic
1047219026 8:122903791-122903813 ATACAGGGATAGAGAGAAAATGG + Intronic
1048530577 8:135245282-135245304 CTTCGGGGATTCAGGGGAAAGGG - Intergenic
1048905457 8:139083926-139083948 CTGTGGGGAATGAGGGAATAAGG - Intergenic
1048939311 8:139384572-139384594 CTGCAGGAAGTGAGAGCAAATGG - Intergenic
1048970676 8:139643466-139643488 CTGCAGGGACTGAGGGACACAGG + Intronic
1049335069 8:142079933-142079955 CTGCAGGTATGGAGGGCACACGG + Intergenic
1049749420 8:144276305-144276327 CTGCAGAGAGAGAGAGAAAATGG + Intronic
1050028107 9:1356740-1356762 CTGCAGGGTGTGAGGGCCAACGG - Intergenic
1050099186 9:2100086-2100108 CTGCAGGGATCCAGGGAGGAGGG + Intronic
1051786917 9:20755117-20755139 CTGAAAAGCTTGAGGGAAAAGGG - Intronic
1051870427 9:21731061-21731083 ATGCAGGAATGGAGAGAAAATGG - Intergenic
1051930845 9:22383495-22383517 GTGCAGGGATTTAGGTAAACTGG - Intergenic
1052221005 9:26022428-26022450 GTGCAGGGAATGGGGGAAAATGG + Intergenic
1052452448 9:28649619-28649641 CTCCAGGAATTGAGGCAGAATGG - Intronic
1054814674 9:69463739-69463761 CTGCAGGGAGTGAGGGAAGAAGG + Intronic
1056805928 9:89728878-89728900 CTGCAGTAATTTAGGGAAACAGG + Intergenic
1057008002 9:91577644-91577666 CTGCAGGGATTCAAGGTAAGGGG - Intronic
1058219830 9:102284792-102284814 CTTTGGGGATTGAGGGGAAAAGG + Intergenic
1059541778 9:115137432-115137454 TTGCAGGGATGGAGGGAATTGGG + Intergenic
1186412499 X:9356337-9356359 CTGACGGGACTGAGGGACAAAGG + Intergenic
1186621809 X:11249255-11249277 CTTCAGGGACTCAGGGAGAAAGG + Intronic
1187236668 X:17474511-17474533 CTGCAAGGAGTGAGGGAAGCAGG + Intronic
1188973156 X:36641830-36641852 TTGGAGGGATTGGGGGAACATGG - Intergenic
1190141585 X:47850599-47850621 TTGCAGGGAGGGAGGGAAAGAGG + Intronic
1190327044 X:49212905-49212927 CTGGAGGGATGGAGGGACAGAGG + Intronic
1191822446 X:65326981-65327003 TGGCAGGGATGGAGAGAAAAGGG + Intergenic
1192150832 X:68711491-68711513 CTGCAGGTTTTGGGGGCAAATGG - Intronic
1192226887 X:69235043-69235065 CTGTAAGGATTGAGAGAAGAAGG + Intergenic
1192310207 X:70005609-70005631 GTGTAGGTATTGAGGGAAAGTGG + Intronic
1193366752 X:80643746-80643768 CTACGGGGACTCAGGGAAAATGG + Intergenic
1193644892 X:84055613-84055635 CTACAAGGAGTGTGGGAAAATGG + Intergenic
1194032557 X:88834589-88834611 CTCTAGGGACTCAGGGAAAAAGG + Intergenic
1195718597 X:107843391-107843413 CTCCAGGGATGGATGGAACATGG + Intronic
1195845172 X:109219795-109219817 CAGCAGGGACTGAGAGAAGAGGG + Intergenic
1196191631 X:112801070-112801092 TTTCAGGGATGGTGGGAAAAAGG - Intronic
1198328437 X:135597643-135597665 CTTCTGGGATTTAGTGAAAATGG - Intergenic
1199078389 X:143549593-143549615 CTGCTGAGATGGAGGGAAAAAGG + Intergenic
1199492233 X:148413066-148413088 CTGAGGGGATTGAGGGGAAATGG + Intergenic
1199596233 X:149508239-149508261 CTTCAGTGAATGAGGGATAAGGG + Intronic
1199835438 X:151585530-151585552 TTGCAGGAATTGAGGTGAAAGGG + Intronic
1200254343 X:154571764-154571786 CTGGAGGAGTTGGGGGAAAACGG + Intergenic
1200263426 X:154632644-154632666 CTGGAGGAGTTGGGGGAAAACGG - Intergenic
1200857849 Y:7958754-7958776 CTCCAGGGAGTAAGGGCAAAGGG + Intergenic