ID: 1174292699

View in Genome Browser
Species Human (GRCh38)
Location 20:49520104-49520126
Sequence CGGACCACACAGGTCCCTGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174292699_1174292709 22 Left 1174292699 20:49520104-49520126 CCTACAGGGACCTGTGTGGTCCG No data
Right 1174292709 20:49520149-49520171 TCACCCTTAGTCCTGCCTCAGGG No data
1174292699_1174292708 21 Left 1174292699 20:49520104-49520126 CCTACAGGGACCTGTGTGGTCCG No data
Right 1174292708 20:49520148-49520170 GTCACCCTTAGTCCTGCCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174292699 Original CRISPR CGGACCACACAGGTCCCTGT AGG (reversed) Intronic