ID: 1174293004

View in Genome Browser
Species Human (GRCh38)
Location 20:49522136-49522158
Sequence CAGCTGAAGCAGAGTGAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 757
Summary {0: 1, 1: 1, 2: 12, 3: 107, 4: 636}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174293004_1174293008 14 Left 1174293004 20:49522136-49522158 CCTCCCTCACTCTGCTTCAGCTG 0: 1
1: 1
2: 12
3: 107
4: 636
Right 1174293008 20:49522173-49522195 ACTCTGCAAGATCCAACCCCAGG 0: 1
1: 0
2: 0
3: 12
4: 540
1174293004_1174293009 15 Left 1174293004 20:49522136-49522158 CCTCCCTCACTCTGCTTCAGCTG 0: 1
1: 1
2: 12
3: 107
4: 636
Right 1174293009 20:49522174-49522196 CTCTGCAAGATCCAACCCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174293004 Original CRISPR CAGCTGAAGCAGAGTGAGGG AGG (reversed) Intronic
900220325 1:1505244-1505266 CAGCCGAGGCAGAGAGAGGGAGG + Intergenic
900423824 1:2567275-2567297 CAGCTGTTGCAGAGTGATGGGGG - Intergenic
900609339 1:3537859-3537881 CAGCTAATGCAGGGAGAGGGTGG + Intronic
900628484 1:3620936-3620958 CAGCTGAGGCGGAGAGAGAGAGG + Intergenic
900664600 1:3806222-3806244 CAGCCGAGGCAGAGAGAGAGGGG + Intergenic
900831222 1:4967131-4967153 CAGCTGGAGCAGAGGGAGCAGGG - Intergenic
901227996 1:7625509-7625531 CATCTGAAGAGGAGTGAGTGGGG + Intronic
901452703 1:9345574-9345596 CAGCTGTAGCTTAGTCAGGGTGG - Intronic
902684342 1:18066282-18066304 CAGTTGATGCATAGAGAGGGAGG + Intergenic
903655123 1:24944258-24944280 TGGCTGGAGCAGGGTGAGGGAGG - Intronic
903770518 1:25760911-25760933 CAGCTGGAGCAGAAAGAGGCTGG - Intronic
904265825 1:29318105-29318127 CCACTGAGGCAGAGTGTGGGGGG - Intronic
904276845 1:29390510-29390532 CAGATGTAACAGTGTGAGGGGGG + Intergenic
904329576 1:29749507-29749529 CAGAGAAAGCAGGGTGAGGGAGG + Intergenic
904348524 1:29889932-29889954 TAGCTAAAGCAGAGCCAGGGTGG + Intergenic
904842209 1:33379678-33379700 GAGCCAAGGCAGAGTGAGGGAGG - Intronic
905122216 1:35690951-35690973 CAGCTGAGGCCGAGTTGGGGAGG + Intergenic
905774359 1:40659043-40659065 CAGATGTGGCAGAGGGAGGGTGG + Intronic
906052827 1:42888604-42888626 GAGCTGTAGCAGAGGGAGAGGGG - Intergenic
906283253 1:44568277-44568299 TGGCTGGAGCAGAGTGAGGTGGG - Intronic
906514799 1:46432561-46432583 AAGCTTAAGAAGAGTGAGAGAGG + Intergenic
906581835 1:46941344-46941366 CAGCAGAAGCAGAATGAGCAGGG + Exonic
906601882 1:47137553-47137575 CAGCAGAAGCAGAATGAGCAGGG - Exonic
906883332 1:49617159-49617181 TAGCTGAAACAGAGTGAGTGAGG - Intronic
907241090 1:53081494-53081516 TAGCTGAAGCACAGAGAGTGAGG + Intronic
907347624 1:53795964-53795986 TGGCTGGAGCAGAGTGAGTGAGG - Intronic
907477470 1:54715272-54715294 GGGCTGAAGCAGAGTGAGGAAGG - Intronic
907530272 1:55088656-55088678 CAGCTGAGGCAGAGTGAAGGAGG + Intronic
909238346 1:73180951-73180973 AAGCTGAAGGAGTCTGAGGGAGG - Intergenic
909455299 1:75843083-75843105 CAGCCGAGGCAGAGAGAGAGAGG - Intronic
909799002 1:79781480-79781502 CAGCTAAAGCAGGGCGAGAGTGG + Intergenic
910046329 1:82921599-82921621 CATCTGGAGCAAAGTCAGGGTGG + Intergenic
910300817 1:85705555-85705577 TAACTGAAGCATAGTGAGTGAGG - Intronic
911090961 1:94016484-94016506 CAGCTGGAGCAGGGAGAGGACGG + Intronic
911362398 1:96895011-96895033 GAGCTGAAGCAGGATCAGGGTGG + Intergenic
912738664 1:112173683-112173705 CTGCTGAAGCAGAGTGGGAAAGG - Intergenic
914815750 1:151060646-151060668 CAGCTGAAGAGGAGAGAAGGGGG + Intronic
915639533 1:157213244-157213266 CAGCTAAAGCAGAGTTAAGAGGG - Intergenic
916195714 1:162220291-162220313 TAGCTGAATCAAAATGAGGGAGG - Intronic
916649617 1:166822603-166822625 CACATGCTGCAGAGTGAGGGAGG - Intergenic
916675167 1:167059374-167059396 CAGCTGGAGCAGAGGAAGGTGGG - Intronic
917162182 1:172070061-172070083 CAGCTCAAGCAGAGACAAGGTGG - Intronic
917305543 1:173620442-173620464 CAGCTAAAGCAGAGTTAAGAGGG + Intronic
917567780 1:176230289-176230311 CAGCTGCAGCAGAGTGCTAGTGG - Intergenic
917854972 1:179092404-179092426 CAGGTCCAGCAGAATGAGGGAGG - Intronic
917869692 1:179229923-179229945 CGGCTGAGGCGGATTGAGGGGGG - Intergenic
918237207 1:182592201-182592223 AGGCTGGAGCAGAGTGAGGGAGG + Intergenic
919673860 1:200362165-200362187 TGGCTGAAACAGAGTGAGTGAGG - Intergenic
920258176 1:204670799-204670821 CTGCTTCAGCAGAGTGATGGGGG + Intronic
920561342 1:206940940-206940962 CAGCTGAAACAGAGAGATGGGGG - Intronic
921397936 1:214688793-214688815 CAGCTCAAGTAGAGAGAGAGTGG + Intergenic
922574700 1:226654065-226654087 CAGCCGGACCAGGGTGAGGGAGG + Intronic
922609129 1:226911421-226911443 CAGCTTGAACATAGTGAGGGTGG + Intronic
922679347 1:227579143-227579165 CAGCTGCAGCAGAGTGCTAGTGG + Intronic
922725457 1:227920955-227920977 CAGCTGGAGCAGGGTGCCGGGGG - Exonic
922912400 1:229228594-229228616 CAGCTTCAGGAGACTGAGGGGGG + Intergenic
923605123 1:235436481-235436503 TAGCTGAAGTATAGTGTGGGGGG - Intronic
924180349 1:241434469-241434491 CAGTTGAGGGATAGTGAGGGAGG - Intergenic
924737132 1:246768394-246768416 CAGAGGAAGCAGAGTTAGGGTGG - Intergenic
1063612804 10:7577016-7577038 CAGTGGAAGCACAGGGAGGGAGG + Intronic
1063985220 10:11494718-11494740 CAGCTGAGGCAGAGAGAGAGAGG + Intronic
1064921592 10:20525270-20525292 CAGCTAAATCAGAGTGAATGAGG - Intergenic
1065386026 10:25133947-25133969 CTGCTGAAACAGAGAGACGGAGG + Intergenic
1065995412 10:31055532-31055554 CAGGAGAGACAGAGTGAGGGGGG + Intergenic
1066028674 10:31394036-31394058 CAGCTAAAGAGGAGTGATGGTGG + Intronic
1066123257 10:32312119-32312141 AGGCTGAAGCACAGTGAGTGAGG + Intronic
1066700983 10:38127976-38127998 CAGTTGAAACTGAGAGAGGGTGG + Intergenic
1067205767 10:44211500-44211522 CAGGAGAAGCAGCATGAGGGGGG - Intergenic
1067252303 10:44597165-44597187 CAGCTAAAGCAGTGTGAAGGGGG + Intergenic
1067673376 10:48346842-48346864 CAGCTGAGGCAGAGAGGGAGAGG - Intronic
1068119693 10:52772800-52772822 CAGATGCCTCAGAGTGAGGGAGG + Intergenic
1070355857 10:75639652-75639674 CATCTGAAGCACAGGGCGGGAGG - Intronic
1070635683 10:78125376-78125398 CAGTAGAAACAGAGTGAGGAAGG + Intergenic
1070670215 10:78372484-78372506 CAGCTGAGGCAGCGACAGGGTGG + Intergenic
1070873964 10:79783946-79783968 TGGCTGGAGCAGAGTGAGTGAGG - Intergenic
1071200029 10:83211574-83211596 CTGCAGAATCAGAGTCAGGGTGG + Intergenic
1071341445 10:84652376-84652398 CAGAAGAAGCAGAGTGTGGGAGG - Intergenic
1071575809 10:86725262-86725284 CAGCTGAAGCACAGTGGGTCAGG - Intronic
1071587021 10:86833497-86833519 TAGATGAAGCAGAGGGAGGTGGG + Intronic
1071640896 10:87306085-87306107 TGGCTGGAGCAGAGTGAGTGAGG - Intergenic
1071654340 10:87431851-87431873 TGGCTGGAGCAGAGTGAGTGAGG + Intergenic
1072349316 10:94542204-94542226 AACCTTAAGTAGAGTGAGGGTGG + Intronic
1072833013 10:98679228-98679250 CTGCTGATGTAGAGTGAGGATGG - Intronic
1073241006 10:102058179-102058201 TAGCCGAAGCAGAGAGAGAGGGG - Intergenic
1073300064 10:102465747-102465769 CTGCTGGGGCAGATTGAGGGTGG + Intronic
1073451148 10:103610132-103610154 GAGCTGAGGCAGAGTGAGTGAGG + Intronic
1073805554 10:107093840-107093862 GAGCTGGAGCAGAGTGAAGGAGG - Intronic
1074056216 10:109924485-109924507 CAGCTGAAGAAGAGTGAGGAAGG - Intergenic
1074232724 10:111553847-111553869 CAGGAGAAGCTGACTGAGGGAGG - Intergenic
1074766133 10:116701237-116701259 CAGCTGAAGCAGAGTGCCTCTGG - Intronic
1075500169 10:122965637-122965659 CAGCTGCAGCAGAGTGCTAGTGG - Intronic
1075686089 10:124366237-124366259 AAGCTGAGGCAGACTGTGGGAGG - Intergenic
1075688718 10:124381047-124381069 CAGATGAGTCAGAGTGTGGGAGG - Intergenic
1075714381 10:124547687-124547709 CAGGAGAAGCAGTCTGAGGGAGG + Intronic
1076352262 10:129825369-129825391 CTGCAGCAGCAGAGGGAGGGAGG + Intergenic
1076419651 10:130321943-130321965 CAGCCGAGGCAGAGAGAGAGAGG - Intergenic
1076628753 10:131839899-131839921 CAGCTGAGGCAGAGAGAGACAGG + Intergenic
1076773371 10:132679304-132679326 GAGCTGGAGGAGGGTGAGGGTGG + Intronic
1076821424 10:132941891-132941913 CAGCGGATGCAGAGTGGGGCTGG - Intronic
1076837108 10:133026695-133026717 CAGCTGCAGCTGAGTGGGGCCGG + Intergenic
1076927136 10:133497167-133497189 CAGCCGAGGCAGAGAGAGAGAGG + Intergenic
1077231774 11:1461042-1461064 CAGCAGGAGCGGAGGGAGGGCGG - Exonic
1077368595 11:2171287-2171309 CAGCTGGGGCAGAGGGAGGCAGG + Intronic
1077388315 11:2286170-2286192 CAGCCGAGGCAGAGAGAGAGGGG + Intergenic
1077542941 11:3156051-3156073 ATGCTGAGGCAGAGTAAGGGTGG + Intronic
1078064562 11:8069508-8069530 CAACTGAAGCAGTGTGACGGTGG - Intronic
1078357948 11:10646881-10646903 TAGCTGAAGGAGAATGAGGAAGG - Intronic
1078916633 11:15784398-15784420 CAGCTGAATGAGAGTTAGGAGGG - Intergenic
1080042343 11:27772079-27772101 CAGCATAAGCAAAGTTAGGGAGG + Intergenic
1080305242 11:30828131-30828153 TGGCTGGAGCAGAGTGAGTGAGG - Intergenic
1080549724 11:33362215-33362237 TAGATGAAGCAGACTGAGTGGGG + Intergenic
1080550969 11:33374001-33374023 CATCTGAAGGAGAGGGAGAGGGG - Intergenic
1080627418 11:34043075-34043097 CAGGAGAGACAGAGTGAGGGTGG + Intergenic
1081028343 11:38044815-38044837 GAGCTCAAGCAGAGTGAGCAGGG - Intergenic
1081528084 11:43940721-43940743 TGGCTAAAGCAGAGTGAGAGAGG - Intronic
1081762626 11:45587210-45587232 CAGATGAAGTAGGGGGAGGGTGG - Intergenic
1081834614 11:46143562-46143584 CACCTGAAGCAGAGTGCTGCGGG + Intergenic
1083332394 11:61904950-61904972 GAGCTGAAGGGGAGCGAGGGAGG + Intronic
1083474011 11:62904032-62904054 CAGTTAAAGCAGAGAGAGGCCGG - Intergenic
1084349017 11:68580593-68580615 TAGTTGAAGAAGAGTGAAGGTGG + Intronic
1084534374 11:69748076-69748098 CAGCTGCAGCAGCGGGTGGGTGG - Intergenic
1085070273 11:73537492-73537514 CAGAGGAGGCAGAGTGAGAGTGG + Intronic
1085371480 11:76010795-76010817 CAGCTGGAGCATAGTGAGCGAGG + Intronic
1085586181 11:77708808-77708830 TAGCTGAAGCAGAATGAGTGGGG - Intronic
1085803351 11:79611780-79611802 ATGCTGAGGCAGAGTGTGGGAGG + Intergenic
1086316665 11:85602103-85602125 GAGGAGAAGCAGACTGAGGGTGG - Intronic
1086980743 11:93195699-93195721 TGGCTGAAGCAGAGTGATGGAGG - Intronic
1087025929 11:93649813-93649835 AAACTGGAGCACAGTGAGGGAGG + Intergenic
1087182486 11:95153631-95153653 AAACTGAAGCATAGAGAGGGTGG + Intergenic
1087374573 11:97325766-97325788 CAGCTGCAGCAGAGTGCTAGTGG + Intergenic
1087864362 11:103205820-103205842 CACCTGGAGCAGAGTGATTGAGG + Intronic
1088097587 11:106118123-106118145 CAGTTGGGGCAGAGTAAGGGAGG - Intergenic
1089010404 11:115127535-115127557 CAGCTGAAGCACAGAGCAGGAGG - Intergenic
1089111736 11:116062704-116062726 CAGCTCACGCAGAGGGAGGCAGG + Intergenic
1089209834 11:116792352-116792374 CAGCTGGGGCAGAGGGATGGGGG - Intronic
1089538111 11:119173045-119173067 AAGGAGAAGCAGGGTGAGGGAGG + Intronic
1090321493 11:125847875-125847897 CAGCTAAAGCAGTGTTATGGGGG + Intergenic
1090346027 11:126071512-126071534 CAACTGAAGCAGAGGAAGGAAGG + Intergenic
1090684578 11:129100906-129100928 CAGCTGCAGCAGAGTGCTAGTGG - Intronic
1091169196 11:133505483-133505505 AAGAGGAAGCAGATTGAGGGAGG - Intronic
1092519236 12:9250314-9250336 CAGCTGAAGCAGTGTGAAGAGGG + Intergenic
1092832816 12:12461694-12461716 CAGCAGCAGCAGAGTGGAGGAGG + Intronic
1093312632 12:17609178-17609200 TAGCTTAAGCAGACTGAGGAGGG + Intergenic
1093368686 12:18337614-18337636 GAGCTGGAGCAGAGGGAGGCGGG + Intronic
1094843201 12:34350481-34350503 CATGTGCGGCAGAGTGAGGGTGG + Intergenic
1095214987 12:39537920-39537942 CAGATGAATCAGAATGAGGCAGG + Intergenic
1095490360 12:42727064-42727086 CAGTTGAAACTCAGTGAGGGAGG - Intergenic
1096230344 12:49893309-49893331 CAGCAGGAGCAGAGTGTGGCAGG - Intronic
1096525483 12:52207657-52207679 GAGCTGAAACAGAGAGAGAGAGG + Intergenic
1096572660 12:52532757-52532779 CCCCTGATGCAGAGTCAGGGTGG + Intergenic
1096670610 12:53196284-53196306 AAGCTGACTCAGAGTGAGGCTGG - Intronic
1097089973 12:56497277-56497299 CAGCTGAGGCAGAGAGGGAGAGG - Intergenic
1097090534 12:56500993-56501015 CAGCTGAGGCAGAGAGGGAGAGG + Intergenic
1097181037 12:57172023-57172045 CAGCTGGAGTAGAGTGCAGGGGG - Intronic
1097591681 12:61582467-61582489 CAGCTGAGGCAGAGAGAGAGAGG + Intergenic
1098935347 12:76472655-76472677 CAGCTGAGGCAGAGAGAGACAGG + Intronic
1098967881 12:76812288-76812310 CAGTTAAAGCAGAGTGATGATGG - Intronic
1099541034 12:83907907-83907929 TGGCTGGAGCAGAGTGAGGTGGG + Intergenic
1100120586 12:91364888-91364910 CTACTGAAACAGACTGAGGGAGG - Intergenic
1100393208 12:94162354-94162376 GAGCAGAAGCAGAGTGCAGGAGG + Intronic
1100642357 12:96494165-96494187 TAGCAGAAGCAGAGTGAAAGAGG + Intronic
1100702306 12:97161470-97161492 GGGCTGAAGCAGGGTGAGGAGGG + Intergenic
1101166319 12:102037617-102037639 GAGCTGGAGAAGAGTGAGTGAGG + Intronic
1101168560 12:102063905-102063927 TAGCTGAAGCAGAGTGAGCAAGG + Intergenic
1101363505 12:104049983-104050005 CAGCCGAAGCAGCGTGAGGGCGG - Exonic
1102034278 12:109761945-109761967 CAGTTGGTGCAGGGTGAGGGTGG - Intronic
1102514143 12:113435288-113435310 AGGGAGAAGCAGAGTGAGGGAGG - Intronic
1103147744 12:118610245-118610267 CAGGTGATGCAGAGTGAGGCAGG - Intergenic
1103357987 12:120336006-120336028 CAGCCGAGGCAGAGAGAGAGAGG - Intergenic
1103361022 12:120353713-120353735 TGGCTGGAGCAGAGGGAGGGAGG - Intronic
1103643280 12:122370216-122370238 TAGCTGAAGCAGAGTGAGAAAGG + Intronic
1103845410 12:123898806-123898828 CCGCTGTAGGTGAGTGAGGGCGG + Exonic
1103995851 12:124829547-124829569 TGGCTGGAGCAGAGTGAGCGAGG - Intronic
1104135752 12:125936551-125936573 CAGCTGCAGTAGAGTGATGGGGG - Intergenic
1104169007 12:126261639-126261661 CCGCTGGAGCAGAGTGAGCCAGG + Intergenic
1104215192 12:126727230-126727252 TAACTGAACTAGAGTGAGGGAGG - Intergenic
1104385790 12:128350583-128350605 TGGCTGGAGCAGAGTGAGTGTGG + Intronic
1104642045 12:130473572-130473594 TAGATGGAGCAGAGTGAGGGAGG + Intronic
1104812850 12:131628889-131628911 CAGCAGGTGCAGAGTGAGGAGGG - Intergenic
1105856362 13:24376085-24376107 CAGCTGAGGCAGAGAGGGAGAGG - Intergenic
1106029904 13:25990568-25990590 CAGCTGGGGCAGAGGGAGGGAGG + Intronic
1108160692 13:47635297-47635319 CAGCTAAAGCAGAGTTAAGAGGG + Intergenic
1108711948 13:53042066-53042088 CAGCTGAAGGAGAGTTTTGGTGG + Exonic
1109004992 13:56862350-56862372 CAGATGATGCAGAGGGAAGGAGG - Intergenic
1109226223 13:59699373-59699395 CAGCTGAAGGGGAGTGAGCCAGG + Intronic
1110536027 13:76651827-76651849 CAGCTAAGGCAGTGTTAGGGGGG - Intergenic
1111104556 13:83628849-83628871 CAGGAGAAGGAGAGTGAGGGGGG - Intergenic
1111192618 13:84830459-84830481 CACCTGAAGAATGGTGAGGGAGG + Intergenic
1111218462 13:85175369-85175391 CTGCTGAAGAAGAATGAGGAAGG + Intergenic
1111716292 13:91883623-91883645 TAGCTGAAGCAGAGTGAGGAAGG + Intronic
1112423078 13:99271411-99271433 CAGCTGGAGCAGAGTGATGGGGG + Intronic
1113880341 13:113622042-113622064 CAGCCGAGGCAGAGAGAGAGAGG - Intronic
1115650746 14:35401417-35401439 GAGGTGGAGCAGTGTGAGGGAGG - Intergenic
1116301665 14:43191030-43191052 CAGCTAAAGCAGTGTTAGGAGGG + Intergenic
1116703595 14:48267670-48267692 AGGCTGAGGCATAGTGAGGGAGG + Intergenic
1117632564 14:57708892-57708914 CAGCTGAGGCAGAGAGAGAGAGG + Intronic
1118538896 14:66801632-66801654 TAGCTCAAGGAGAGAGAGGGGGG - Intronic
1118742837 14:68753028-68753050 ACCCTGAAGCAGAGTGAGGCTGG - Intergenic
1118877632 14:69798156-69798178 GAGCAGAAGCAGAGAGAGGTGGG + Intergenic
1118991942 14:70804984-70805006 CAGCTGCAGCAGAGTATGTGGGG + Intronic
1119402370 14:74371961-74371983 CAGCTGCAGCACAGGGAGAGTGG - Intergenic
1119625175 14:76168062-76168084 AAGCTGAAGCAGAGAAAGAGAGG - Intronic
1120964205 14:90153166-90153188 CAGGGGAAGGAGAGTCAGGGAGG - Intronic
1121664263 14:95660045-95660067 CAGCAGGATCAGAGTGAGGAAGG - Intergenic
1121949934 14:98162911-98162933 CAGCTGAACCGAAGAGAGGGCGG - Intergenic
1122750179 14:103927648-103927670 GAGCTCTAGAAGAGTGAGGGTGG - Intronic
1123115279 14:105891637-105891659 CAGCGGAAGCAGAGAGAGCAGGG - Intergenic
1123117449 14:105901080-105901102 CAGCGGAAGCAGAGAGAGCAGGG - Intergenic
1123193230 14:106591521-106591543 CAGCTGAGGCAGAGAGAGAGAGG + Intergenic
1124604334 15:31159863-31159885 CCGCTGAAGCAGTGTGAGCCAGG - Intronic
1125210321 15:37207230-37207252 CAGCTGAAATACAGTGAAGGTGG - Intergenic
1125524858 15:40368393-40368415 CAGCTGCCGCAGGGCGAGGGCGG + Exonic
1125691475 15:41599527-41599549 CAGCAGAAGGAGAGTGAGGGTGG + Intergenic
1127078102 15:55348098-55348120 CAGCTGAGGCAGGCTGAGGCAGG - Intronic
1127612193 15:60647836-60647858 CAGCTGCAGCAGGCTGAGGGTGG - Intronic
1127745817 15:61971084-61971106 TGGCTGAAGCAGAGTGAGCAAGG + Intronic
1127752177 15:62056841-62056863 CAGCCGAGGCAGAGAGAGAGAGG - Intronic
1128439201 15:67688184-67688206 GAGCTGAAGCAGAGTGGGCATGG + Intronic
1129291169 15:74568995-74569017 CAGCAGAGGCAGATGGAGGGTGG - Intronic
1129372828 15:75108816-75108838 CAGCTGAAGGAGAGATGGGGAGG + Intronic
1129477274 15:75794603-75794625 CTGTTGCAGCAGAGTGAGGGTGG - Intergenic
1129574903 15:76732876-76732898 CAGCTGAGGCAGAGAGAGAGAGG - Intronic
1129622717 15:77163693-77163715 CATCTGAAGCTGAGTGAAGGTGG - Intronic
1130654480 15:85782493-85782515 GAGCTAAAGCCGAGAGAGGGAGG - Intronic
1130924558 15:88375345-88375367 CAGATGAAGCAGAGTTTGTGAGG + Intergenic
1131343823 15:91627759-91627781 CAGCTGCTGCTGAGTCAGGGTGG - Intergenic
1132107473 15:99073737-99073759 GAGCTGCAGCAGAGGTAGGGAGG - Intergenic
1132569604 16:638352-638374 CAGCTGAGTTAGAGTGAGGGCGG - Intronic
1132822866 16:1885407-1885429 CAGAGGAAGGGGAGTGAGGGGGG + Intergenic
1133010307 16:2906831-2906853 CAGCCGAGGCAGAGAGAGAGAGG + Intergenic
1133772994 16:8878480-8878502 CTGCTGAGCCAGAGTGAGGAAGG + Intergenic
1134382449 16:13740536-13740558 CAGCCGAGGCAGAGAGAGAGAGG - Intergenic
1135665437 16:24331726-24331748 CAACTGGAGCAGAATGAGTGAGG - Intronic
1135670904 16:24374680-24374702 CAGCCGAGGCAGAGAGAGAGAGG + Intergenic
1135812234 16:25598754-25598776 TGGCCGAAGCAGAGTGAGTGAGG + Intergenic
1135894440 16:26386138-26386160 CAGGGAAAGCAGAGTGAGGCTGG - Intergenic
1137563652 16:49519849-49519871 CAGCTGAAGCACAGTGAATTGGG - Intronic
1137568882 16:49551726-49551748 CAGCTGAGCCAGAGTGGGTGGGG + Intronic
1137578750 16:49621010-49621032 CTGCTGAAGGAGAGAGAGGGAGG - Intronic
1138187174 16:54985615-54985637 CTGCTGACGCAGAGTGGGAGTGG - Intergenic
1138591956 16:58005030-58005052 CAGCTGAGGCAGAGAGAGAGAGG + Intronic
1139347967 16:66316659-66316681 CTGCTGCTGCAGATTGAGGGAGG + Intergenic
1139526176 16:67518228-67518250 CAGCCAAGGCAGGGTGAGGGAGG + Intergenic
1139797902 16:69497887-69497909 AAGATGAGGCAGAGGGAGGGAGG + Intergenic
1139968277 16:70757655-70757677 CTGCTGAAGCAGAAGCAGGGAGG + Intronic
1140123387 16:72101808-72101830 CAGAGGAAGCAGTGTGAGGGAGG - Intronic
1140942756 16:79737187-79737209 AAGCTGAATTAGAATGAGGGAGG - Intergenic
1141049727 16:80749681-80749703 CAGCTGAAGCTGAGTTCAGGGGG + Intronic
1142273693 16:89104601-89104623 CAGGAGAAGCAGAGGGAAGGTGG - Intronic
1142384319 16:89753152-89753174 CAGCTGAGGCAGAGAGGGAGAGG - Intronic
1142587444 17:982474-982496 CAGCCGAGGCAGAGAGAGAGAGG - Intergenic
1142663758 17:1449626-1449648 CAGCTGAAGGAGTGTGAGTTAGG - Intronic
1142928193 17:3259575-3259597 GGGCTGAGGCAGAGAGAGGGCGG + Intergenic
1142928203 17:3259617-3259639 GGGCTGAGGCAGAGAGAGGGAGG + Intergenic
1143014604 17:3885005-3885027 AAGCTGGAGAAGAGTTAGGGGGG + Intronic
1143116046 17:4582387-4582409 GAGCTAAAGGAGAGTGGGGGAGG + Intergenic
1143852952 17:9826215-9826237 CAGCAGGACCAGAGTGAGGAAGG - Exonic
1145732026 17:27198122-27198144 CAGCTGAGGCAGAGAGGGAGAGG - Intergenic
1145783137 17:27577276-27577298 CAGCTGAAGCAGACTCGGTGGGG - Intronic
1145875742 17:28317437-28317459 GAGCTGAAGAAGAGTGATTGAGG - Intergenic
1145963220 17:28899634-28899656 TGGCTGGAACAGAGTGAGGGGGG - Intronic
1146103831 17:30012474-30012496 CAGCCGAGGCAGAGAGAGAGAGG - Intronic
1146356078 17:32135343-32135365 CAGCCGAGGCAGAGAGAGAGAGG + Intergenic
1146662676 17:34675028-34675050 CATGTGCAGCAGAGTGAGGAGGG - Intergenic
1147009251 17:37431282-37431304 CAGATTAGGCACAGTGAGGGTGG + Intronic
1148591410 17:48818944-48818966 AAACTGAAGCAGAATGATGGAGG + Intergenic
1149239052 17:54627120-54627142 CAGCAGCCGCAGAGTGAGGGTGG - Intergenic
1149586083 17:57787972-57787994 CAGCAGAAGCGGAGTGCTGGGGG - Intergenic
1149668536 17:58383964-58383986 AAGCTGAAGCAAAGGCAGGGTGG - Intronic
1149671515 17:58416964-58416986 TTGCTGAGGCAGAGGGAGGGGGG + Exonic
1149936342 17:60810740-60810762 CAGCTGAAGCTGAGTGACATTGG - Intronic
1150227118 17:63530250-63530272 CCGGTGAGGCAGAGTGAGGGTGG + Exonic
1150284847 17:63948898-63948920 CAGATGGAGCTGGGTGAGGGAGG - Intronic
1150355901 17:64484410-64484432 CTGCTGGAGCAGACTGAGTGAGG + Intronic
1151284543 17:73100508-73100530 TGGATGAAGCAGAGTGAGGAAGG - Intergenic
1151544873 17:74786584-74786606 CGGCTGAAGCAGGGTCAGGGAGG + Intronic
1152239282 17:79153111-79153133 CAGCTGGACCAGGGTGAGGCAGG - Intronic
1152339406 17:79716019-79716041 CAGCAGAAGCCGGGAGAGGGTGG + Intergenic
1152460774 17:80441316-80441338 AAGCTGAAGAGGAGTGAGGCTGG - Intergenic
1152670081 17:81598279-81598301 CAGCAGCACCAGAGGGAGGGTGG - Intronic
1153010249 18:532178-532200 CAGCAGAAGCAGCGTGGGGTGGG + Intergenic
1153189564 18:2522545-2522567 GAGCTAAAGCTGAGTAAGGGAGG - Intergenic
1153714074 18:7827975-7827997 CATCTGGAGCAGTGTGAGAGTGG + Intronic
1154472852 18:14721847-14721869 CTGGTGCAGCAGAGAGAGGGAGG + Intergenic
1154932674 18:21016723-21016745 CAGCTAAATGGGAGTGAGGGAGG - Intronic
1155087081 18:22469046-22469068 CAGCTGAAGTAGGGTGAGGCTGG + Intergenic
1155117892 18:22787635-22787657 CAGTGAAAGCAGAGTGAGCGGGG + Intergenic
1155247090 18:23920828-23920850 CAGCTGAAGCTGAGAGCAGGGGG + Intronic
1156076340 18:33283086-33283108 CAGCTGCAGCAGAGTGCTAGTGG - Intronic
1156450306 18:37262883-37262905 CAGCTGCAGCAGCGTGAGGCAGG + Intronic
1156511732 18:37642414-37642436 CAGCTGTGGCAGAGGGTGGGGGG + Intergenic
1156595413 18:38542730-38542752 CACATGAAGCAGAATGAGGGAGG - Intergenic
1157408077 18:47440526-47440548 GAGAAGAAGGAGAGTGAGGGAGG + Intergenic
1157702247 18:49769187-49769209 CAGCTGGAGCAGAGTGAGTGGGG - Intergenic
1159133268 18:64306025-64306047 TAGCTGGAGCTGAGTGAGAGGGG + Intergenic
1160236955 18:77093291-77093313 GAGCTGCAGCAGAGGGAAGGCGG + Intronic
1160695135 19:480220-480242 CAGCTGGAGCAGCGTGAGCAAGG + Intergenic
1161116406 19:2499302-2499324 CATCTGGAGCAGAGGGAGGGAGG - Intergenic
1161179758 19:2871956-2871978 CAGCCGAGGCAGAGAGAGAGAGG + Intronic
1161226158 19:3146918-3146940 TGGCTGGAGCAGAGTGAGGAGGG - Intronic
1161243053 19:3233655-3233677 TGGCTGGAGCAGAGTGAGGAGGG + Intronic
1161253090 19:3291727-3291749 TGGCTGGAGCAGAGTGAGGAGGG + Intronic
1161257915 19:3320138-3320160 TGGCTGGAGCAGAGTGAGGAGGG + Intergenic
1161273395 19:3402857-3402879 TGGCTGGAGCAGAGTGAGTGAGG + Intronic
1161274291 19:3406976-3406998 TGGCTGGAGCAGAGTGAGCGAGG + Intronic
1161316410 19:3619568-3619590 GAGCTGAAGCAGAGGCAGGCTGG + Intronic
1161345959 19:3768823-3768845 CGGCTGGAGCAGAGTGAGGAGGG - Intergenic
1161407659 19:4099412-4099434 CGGCTGCAGCAGAGCCAGGGAGG + Exonic
1161422021 19:4181171-4181193 TGGCTGGAGCAGAGTGAGGCAGG - Intronic
1161619216 19:5289594-5289616 CGGCTGGAGCAGAGGGAGGAGGG - Intronic
1161620913 19:5296680-5296702 TTGCTGGAGCAGAGTGAGGAAGG + Intronic
1161623205 19:5310064-5310086 TGGCTGGAGCAGAGTGAGGAGGG - Intronic
1161634217 19:5377170-5377192 TGGCTGGAGCAGAGTGAGGAAGG + Intergenic
1161642950 19:5435715-5435737 TGGCTGGAGCAGAGTGAGGAGGG - Intergenic
1161649338 19:5474753-5474775 TGGCTGGAGCAGAGTGAGGAAGG + Intergenic
1161649887 19:5477958-5477980 TGGCTGCAGCAGAGTGAGGAGGG - Intergenic
1161650361 19:5480546-5480568 TGGCTGGAGCAGAGTGAGTGAGG + Intergenic
1161663815 19:5563082-5563104 TGGCTGGAGCAGAGTGAGGAAGG + Intergenic
1161719745 19:5896218-5896240 TGGCTGGAGCAGAGTGAGGAGGG + Intronic
1161720584 19:5900108-5900130 CAGCTGGGGCAGAGTTGGGGTGG - Intronic
1161756423 19:6137447-6137469 TGGCTGCAGCAGAGTGAGGAGGG + Intronic
1161765033 19:6202799-6202821 TGGCTGGAGCAGAGTGAGGGAGG + Intergenic
1161815691 19:6498543-6498565 CGGCTGAAGCAGAGTGAGGGAGG - Intronic
1161854624 19:6756804-6756826 TAGCTGAAGCAGAGGGAATGAGG - Intronic
1161894055 19:7066941-7066963 CAGCCGAGGCAGAGAGAGAGAGG + Intergenic
1161979658 19:7623957-7623979 GGGCTGGAGCGGAGTGAGGGTGG - Intronic
1162182966 19:8883201-8883223 CACCTGAAGGAGAGGGAGGTAGG + Intronic
1162204571 19:9046130-9046152 CAGCTGAAACAGAGTGAACGAGG - Intergenic
1162365378 19:10245546-10245568 CAGATGATGAGGAGTGAGGGTGG + Intergenic
1162418142 19:10550587-10550609 TGGCTGCAGCAGAGTGTGGGAGG - Intronic
1162875282 19:13616830-13616852 TGGCTGGAGCAGAGTGAGTGAGG + Intronic
1163166393 19:15500917-15500939 AAGCTGCAGCAGAGTGAGTGAGG - Intergenic
1163479360 19:17545639-17545661 CAGCTGAGGCAGAGAGAGAGAGG + Intronic
1163498484 19:17661363-17661385 CAGTTGAAGGAGAGAGAAGGAGG + Intronic
1163704353 19:18803711-18803733 TGACTGGAGCAGAGTGAGGGAGG + Intergenic
1164058834 19:21647254-21647276 CAGCTAAAGCAGTGTTAAGGGGG - Intergenic
1164083475 19:21880538-21880560 CAGCTGAGGCAGAGAGGGAGAGG + Intergenic
1164084629 19:21889808-21889830 CAGCTGAGGCAGAGAGGGAGAGG + Intergenic
1164151514 19:22556966-22556988 CAGCTGGAGCAGAGGGAGCTAGG - Intergenic
1164739490 19:30565839-30565861 TAGCTGTTGCAGAGTCAGGGAGG + Intronic
1164955174 19:32376894-32376916 CAGCAGAGGCAGAGAGAGAGAGG + Intronic
1165323875 19:35102806-35102828 CGGCTGGAGCAGAGTGAGTGAGG - Intergenic
1165452261 19:35890422-35890444 CAGCTGAACCAGAGTGGGGTTGG + Exonic
1165794092 19:38508698-38508720 TAGCTGAAGCAGAGTCATCGAGG + Intronic
1166099909 19:40565733-40565755 TGGCTGCAGCAGAGTGAGTGGGG + Exonic
1166282039 19:41800684-41800706 CAGATGAGGCAGAGAGAGAGAGG - Intronic
1166433962 19:42751458-42751480 CAGCTGAGGCAGAGAGAGAGAGG + Intronic
1166449329 19:42884674-42884696 CAGCTGAGGCAGAGAGAGGGAGG + Intronic
1166453744 19:42922909-42922931 CAGGTGAGGCAGAGAGAGGGAGG + Intronic
1166483282 19:43191487-43191509 CAGCTGAGGCAGAGAGAGAGAGG + Intronic
1166492910 19:43274518-43274540 AAGCTGAGGCAGAGAGAGAGAGG + Intergenic
1167235819 19:48314245-48314267 CGGCAGAAGCAGAGAGAGAGAGG + Intronic
1167451738 19:49574528-49574550 CAGCTGGAGCAGACTGAGACAGG - Intronic
1167970277 19:53184911-53184933 CAGCCGAGGCAGAGAGAGAGAGG + Intronic
1167988842 19:53340804-53340826 TGGCTGGAGCAGAGGGAGGGAGG - Intronic
1167990965 19:53360300-53360322 CAGCCGAGGCAGAGAGAGAGAGG + Intergenic
1168443980 19:56395941-56395963 CAGCCGAGGCAGAGAGAGAGAGG + Intergenic
1168468501 19:56622639-56622661 CCGCTGGTGCACAGTGAGGGAGG - Exonic
1168468975 19:56625645-56625667 TGGCTGAAGCAGAGTGAGCAGGG - Exonic
925005605 2:440954-440976 CAGGTGGAGCAGAGGGTGGGGGG + Intergenic
925423082 2:3727248-3727270 CAGCTGAATCAGAGAGAAGGTGG - Intronic
925596021 2:5556148-5556170 AAGCGGAAGGAGTGTGAGGGAGG + Intergenic
928331308 2:30360003-30360025 CAGCTGAAGCTGAGTGCTTGTGG + Intergenic
928365522 2:30697786-30697808 CAGCCGAGGCAGAGAGAGAGAGG - Intergenic
928432567 2:31233243-31233265 AAGGTGAAAGAGAGTGAGGGAGG - Intronic
930546207 2:52770485-52770507 CAGCTAAAGCAGTGTGAAGAGGG + Intergenic
930897926 2:56467111-56467133 CAGCTAAAGCAGGGTGAGAAGGG + Intergenic
931163888 2:59724493-59724515 CAGGAGAAGCAGAGGGAGTGAGG + Intergenic
931426794 2:62178756-62178778 CAGCAGCAGGAGAGTAAGGGAGG + Intergenic
931522910 2:63119002-63119024 AAGCTGAAGAAGAATGAGGCTGG - Intergenic
932254288 2:70270496-70270518 CAGCTGAAGCAGAGTGATATGGG - Intronic
932438489 2:71717096-71717118 CAGCTGGAGCAGGGTGAGCAAGG - Intergenic
932782496 2:74569674-74569696 CAATAGAAGTAGAGTGAGGGAGG - Intronic
933694622 2:85208430-85208452 CAGATAAAGCAGAGTAAGGCAGG + Intronic
933819291 2:86095086-86095108 CAGCCAGAGCAGAGTGAGAGGGG - Intronic
934161657 2:89255241-89255263 CAGCTGAAGCAGGATGAGCAGGG + Intergenic
934205627 2:89927174-89927196 CAGCTGAAGCAGGATGAGCAGGG - Intergenic
935929688 2:108110774-108110796 CAGCTAAAGCAGAGTTAAGAGGG - Intergenic
935953539 2:108352448-108352470 CAGCTGTGGCAGAGGGATGGAGG + Intergenic
936003769 2:108863454-108863476 TAGCTGAAGCAGAGTTAGTGAGG + Intronic
936340097 2:111623500-111623522 CTGCTGAAGGAGAGTGGGTGTGG - Intergenic
937148138 2:119664998-119665020 CAGCTAAAGCAGTGTGAAGAGGG + Intergenic
937369340 2:121286650-121286672 CAGGAACAGCAGAGTGAGGGAGG - Intergenic
937387359 2:121447916-121447938 CAGCTGCAGCAGTGTGATGGTGG - Intronic
938105353 2:128526312-128526334 CAGGAGAACCAGAGGGAGGGTGG - Intergenic
938396176 2:130950102-130950124 CAGCTGAAGGAGGATGAGGAAGG + Intronic
938982594 2:136540576-136540598 CAGCTCAAGAAGGGAGAGGGAGG + Intergenic
939391420 2:141573434-141573456 CAGCTAAAGCAGTGTTAGGAGGG + Intronic
940437586 2:153672542-153672564 CAGCTAAAGCAGTGTGTAGGGGG + Intergenic
941122853 2:161551738-161551760 CAGATAATACAGAGTGAGGGAGG + Intronic
941328353 2:164144783-164144805 CAGCTTAAGCTAAGTGAGAGGGG + Intergenic
942058577 2:172207247-172207269 AGGATGAAGCAGAGTCAGGGAGG - Intergenic
942821673 2:180122629-180122651 CATCTGAGGCATAGTGAGAGTGG - Intergenic
943233776 2:185291628-185291650 TAGCTGAGGCAGAGAGAGAGAGG - Intergenic
943359665 2:186902107-186902129 AAGCTGAAGCAGGGGGTGGGAGG - Intergenic
943922624 2:193729016-193729038 CCGCTGAAGAAGAGTGAGGGAGG + Intergenic
944053309 2:195496011-195496033 TGGCTGGAGCAGAGTGAGTGGGG - Intergenic
944192489 2:197018339-197018361 CAGCTGGAACAGAGTGAGTGAGG - Intronic
944207176 2:197169098-197169120 TGGCTGAAGGAGAGTGAAGGAGG - Intronic
944586976 2:201181141-201181163 ATGCTGCAGCAGAGTGAGGAGGG - Intergenic
946175142 2:217917971-217917993 CGGCTGAAACAGAATGAGTGAGG + Intronic
946745107 2:222837662-222837684 TAACTAAAGCACAGTGAGGGTGG - Intergenic
946855740 2:223948084-223948106 AGGCTGGAGCAGAGTGAGTGAGG + Intergenic
946913488 2:224490323-224490345 CAGCCGAGGCAGAGAGAGAGGGG - Intronic
946964944 2:225027608-225027630 CAGGAGAAGGAGAGAGAGGGAGG - Intronic
947120327 2:226807633-226807655 CAGTGGGAGCAGAGTGAGGAAGG + Intergenic
948205562 2:236161115-236161137 CCGCTGGGGCAGAGGGAGGGTGG - Intergenic
948220779 2:236268011-236268033 CAGCTGACCCAGAGTGGGGAGGG - Intergenic
948738960 2:240030494-240030516 CAGCTGAGGCAGAGAGAGAGTGG + Intergenic
949019327 2:241732354-241732376 CAGCCGAGGCAGAGAGAGAGAGG + Intergenic
1168840198 20:905153-905175 CAGGTGGAGTAGAGTGGGGGTGG - Intronic
1168857705 20:1020353-1020375 TGGATGAAGCAGAATGAGGGAGG + Intergenic
1169898969 20:10534071-10534093 CAGCCGAGGCAGGGTGAGGGTGG + Intronic
1170207550 20:13814869-13814891 TTGCAGAAGCAGTGTGAGGGTGG - Intronic
1170220360 20:13935609-13935631 TAACTGGAGCAGAGTGAGTGGGG + Intronic
1170368246 20:15620004-15620026 TAGCTGAGGCAGAGGCAGGGAGG + Intronic
1170770464 20:19328201-19328223 TGGCTGGAGCAGAATGAGGGAGG + Intronic
1170876889 20:20258453-20258475 AAGCTGAAGCACAGCGAGGGAGG + Intronic
1170942877 20:20863581-20863603 CTGTGGAAGCAGAGAGAGGGCGG + Intergenic
1171200679 20:23239290-23239312 CAGCTAAAGCAGTGTGAAGAGGG - Intergenic
1171389035 20:24789499-24789521 GAGCTGAAGCAGAGGGCAGGGGG - Intergenic
1171519001 20:25761323-25761345 CAGAAGAAGCAGAGGGAGGGAGG - Intergenic
1172477800 20:35252059-35252081 CAGGAAAAACAGAGTGAGGGTGG - Intronic
1172577207 20:36018535-36018557 CAGCTGTAGGAGAATGAGAGTGG + Intronic
1174202219 20:48814693-48814715 CACCTCCAGCAGAGTGAGGATGG + Intronic
1174293004 20:49522136-49522158 CAGCTGAAGCAGAGTGAGGGAGG - Intronic
1174428104 20:50447795-50447817 CAGCTGGAGAAGAGTGAGTGAGG + Intergenic
1174441815 20:50561733-50561755 CAGCTGAAGCAGAGTATAGCAGG + Intronic
1174584699 20:51599093-51599115 CAGCAGAAGCAGAATGAAGATGG - Exonic
1174943938 20:54964007-54964029 TGGCTGAAGTATAGTGAGGGAGG + Intergenic
1175100189 20:56573916-56573938 CCTCTGAAGCAGAGGGAGGCAGG - Intergenic
1175129654 20:56779855-56779877 CAGCTGTAGCAGAGTATGCGGGG - Intergenic
1175948769 20:62571534-62571556 CAGGGGAGGCTGAGTGAGGGAGG + Intergenic
1176801633 21:13436002-13436024 CTGGTGCAGCAGAGAGAGGGAGG - Intergenic
1178705375 21:34868534-34868556 CAGAGAAAGCAGAGTGAGGAAGG - Intronic
1178792236 21:35711299-35711321 CAGTTGAGGCAGAGTGATGCTGG + Intronic
1179109316 21:38432715-38432737 CAGATGAAGCACAGAGAGGTTGG + Intronic
1179169894 21:38964609-38964631 CAGCTCAGTGAGAGTGAGGGTGG - Intergenic
1180186743 21:46144055-46144077 TAGCTGAGGCAGAGAGAGAGAGG - Intronic
1180656197 22:17422994-17423016 CATCGGAAGCAGACTGAGAGAGG - Intronic
1180798377 22:18619238-18619260 GAGCTGAAGGAGAGGGAGTGAGG + Intergenic
1180863073 22:19098394-19098416 CAGCTGTGGCAGAGAGAGGGTGG - Intronic
1180959662 22:19756885-19756907 CAGGTGAAGAGGAGTGTGGGCGG + Intronic
1180987471 22:19913299-19913321 CAGCTGAAGCTGAGTGAGAATGG + Intronic
1181223341 22:21376027-21376049 GAGCTGAAGGAGAGGGAGTGAGG - Intergenic
1181255399 22:21559599-21559621 GAGCTGAAGGAGAGGGAGTGAGG + Intronic
1181619460 22:24078831-24078853 CAGCTTCAAGAGAGTGAGGGAGG - Intronic
1181729876 22:24837289-24837311 CAGCTGAGGCAGAGAGAGAGAGG + Intronic
1181837854 22:25625825-25625847 CAGCCGAGGCAGAGAGAGAGAGG - Intronic
1182351153 22:29700750-29700772 CATCTCCAGCAGAGAGAGGGAGG + Intergenic
1183002033 22:34868578-34868600 CAGGTGAAGCAGAGGGAGTGAGG - Intergenic
1183960928 22:41411480-41411502 CAGCTAAGGTAGAGTCAGGGTGG + Intergenic
1183968798 22:41460351-41460373 CAGCTGCAGCAGACTGATGTTGG + Exonic
1184148220 22:42623775-42623797 CCCCTGAAGGTGAGTGAGGGAGG - Exonic
1184351619 22:43947782-43947804 CAGCTGAGGCAGAGAGAGAGAGG + Intronic
1184448347 22:44567534-44567556 CAGCTGCAGCCGAGTGACGTTGG - Intergenic
1184489844 22:44802230-44802252 CAGATGACTCAGAGTGAGGTGGG - Intronic
1184715825 22:46281231-46281253 CAGCTGAGGCCCAGAGAGGGCGG + Intronic
1184773961 22:46613976-46613998 CGGCTGCAGCAGTGTGAGGAGGG + Intronic
1185014052 22:48333257-48333279 AAGGGGAAGCAGAGTGAGGCTGG - Intergenic
1185121407 22:48973814-48973836 CAGCAGGAGCAGAGTGGGGACGG + Intergenic
1185264525 22:49893400-49893422 AACCTTAAGCAGAGGGAGGGAGG + Intergenic
1185336665 22:50273916-50273938 CAGCCGAGGCAGAGAGAGAGAGG - Intergenic
949977503 3:9474503-9474525 CCTCCGAAGCAGCGTGAGGGTGG + Exonic
950399687 3:12760400-12760422 TTACTGGAGCAGAGTGAGGGAGG - Intronic
950622218 3:14215131-14215153 CAGCTGGAGAAGAGGGAGGGTGG - Intergenic
950649890 3:14400874-14400896 TAGCTGAAGCAGAGGGATGTGGG + Intergenic
950908918 3:16567052-16567074 TGGTTGAAGTAGAGTGAGGGAGG - Intergenic
950995567 3:17492744-17492766 CAGCTGAAGCAGTGTTAAGATGG - Intronic
951623742 3:24636264-24636286 CAGCTAAAGCAGTGTTAGGAGGG + Intergenic
952086605 3:29829572-29829594 TAGCTGAAGCAGAATGGGGGAGG + Intronic
952356021 3:32584836-32584858 CAGCTGGAGCAGTGAGAGGAGGG - Intergenic
952506210 3:34008937-34008959 CAGCTTGTTCAGAGTGAGGGTGG + Intergenic
952694862 3:36252904-36252926 CAGCTAAAGCAGAGTTAAGAGGG + Intergenic
953067650 3:39489054-39489076 TGGCTGAAGCACAGTGAGGGAGG - Intronic
953455071 3:43034521-43034543 CAGATAAAGCTCAGTGAGGGTGG + Intronic
954761246 3:52875923-52875945 CTGGAGAAGCAGTGTGAGGGTGG + Intronic
954899037 3:54003345-54003367 CAGATGAAGCAGCTTGGGGGTGG - Intergenic
954973755 3:54673979-54674001 CTGATGAAGCAGAGCAAGGGAGG + Intronic
956220357 3:66895988-66896010 CAGCTAAAGCAGTGTGTAGGGGG + Intergenic
956371775 3:68571020-68571042 CAGGTAAAGCAGCATGAGGGAGG - Intergenic
956423834 3:69112452-69112474 AACCTGAAGCAGAATGTGGGAGG + Intronic
956504214 3:69920578-69920600 CAGCTGAGGCAGAGAGGGAGAGG - Intronic
956762444 3:72455905-72455927 AAGATAAAGCAGGGTGAGGGTGG - Intergenic
957538406 3:81535959-81535981 AAGCTGGGGCTGAGTGAGGGTGG - Intronic
957680631 3:83428580-83428602 CAGCTGAGGCAGGCTGAGGCAGG + Intergenic
957757029 3:84503484-84503506 AAGAAGAAGCAGAGTGAAGGTGG - Intergenic
958636192 3:96750319-96750341 CTGCAAAGGCAGAGTGAGGGAGG - Intergenic
958657275 3:97018539-97018561 CAGCTGAGGCAGAGAGGGAGAGG + Intronic
959084198 3:101834181-101834203 CAGCTGAAGGAGAGTTGGGGAGG - Intronic
960224026 3:115148139-115148161 CAGCTGAGGCAGCGGGATGGAGG + Intergenic
960476978 3:118142427-118142449 CAGCTAAAGCAGTGTTAAGGGGG - Intergenic
960541447 3:118866242-118866264 CAGCTGAAGCACATGCAGGGAGG - Intergenic
960957241 3:123041728-123041750 CAGCTAAAGCCGTGTGAAGGGGG + Intergenic
961410348 3:126715980-126716002 CAACTGAAGCAGTGACAGGGAGG - Intronic
961454798 3:127018610-127018632 GAGCTGAAGCAGGGTGGGGGCGG - Intronic
962187022 3:133270910-133270932 AAGCTGCACCAGAGTGAGTGAGG - Intronic
962698686 3:137975824-137975846 TGGCTGCAGCAGAGTGAGGTGGG - Intergenic
963184179 3:142394478-142394500 AAGTTGAAGTAGAGTGAAGGAGG - Intronic
963774878 3:149428611-149428633 CAGGAGAAAGAGAGTGAGGGAGG + Intergenic
964782262 3:160353254-160353276 CAGCTGAAAAACAGTGAGGTTGG - Intronic
965643998 3:170860775-170860797 CAGCTGAGGCAGAGAGAGAGAGG - Intergenic
966632835 3:182097478-182097500 CTGAAGAAGCAGAGAGAGGGAGG + Intergenic
966815573 3:183887215-183887237 CAGCCGAGGCAGAGAGAGAGAGG - Intergenic
966863552 3:184243814-184243836 CAGCAGGAGCAGGGTGAGGTGGG + Exonic
968289498 3:197527632-197527654 TGGCTGAAGCAGAATGAGGGGGG - Intronic
968350930 3:198051366-198051388 CAGCCAAGGCAGAGAGAGGGGGG - Intergenic
969271819 4:6108226-6108248 CAGAAGCAGCAGAGTGAGGCTGG + Intronic
969491089 4:7499658-7499680 CAGCTGGGGCAAAATGAGGGGGG - Intronic
971507879 4:27386257-27386279 TAGCTGAAGCAGAGTGAATAGGG - Intergenic
972425269 4:38927023-38927045 TGGCTGCAGCAGAGTGAGGCAGG - Intronic
972933607 4:44104624-44104646 CAGTGGAAGGAGAGTGTGGGTGG + Intergenic
972952503 4:44344925-44344947 AAGCTGAAGAACAGTGAGGAGGG - Intronic
973245241 4:48004156-48004178 CAGCTGAGGCAGAGAGAGAGAGG - Intronic
973816412 4:54623418-54623440 CTGCTGGAACAGAGTGAGGAAGG - Intergenic
974339791 4:60601017-60601039 CAGCTAAAGCAGTGTTAAGGGGG - Intergenic
974493407 4:62595828-62595850 CAGCGGAGGCAGAGAGAGAGAGG - Intergenic
975230475 4:71926819-71926841 CAGATGAAGCACAGTGAAGGAGG - Intergenic
975490131 4:74978949-74978971 CAGCTAAAGCAGTGTTAGGAGGG + Intronic
975632293 4:76416147-76416169 CAGCTGAGGCAGAGAGAGAGAGG - Intronic
976096450 4:81513315-81513337 GAGCTATAGCAGAGGGAGGGAGG - Intronic
976254449 4:83085398-83085420 TAGCTGAAGCAGAGAGAAGGTGG - Intergenic
976527578 4:86112365-86112387 CAGCTAAAGCAGTGTCAGGAGGG - Intronic
976607148 4:86994757-86994779 CAGCTGGAGCAGAGGGAAAGGGG + Intronic
976718765 4:88150416-88150438 AGGCTGAAGCAGAGTGAGGGAGG + Intronic
977040070 4:92004634-92004656 CAGCTGAAGTAGTGTTATGGGGG + Intergenic
977862560 4:101982079-101982101 CAGCTGCAGCAGACCCAGGGAGG - Intronic
978904621 4:113991168-113991190 CTGCTGAAGCACAGGAAGGGAGG + Intergenic
979562563 4:122116908-122116930 CAATGGAAGCAGAGTGAGGAAGG + Intergenic
980091431 4:128447242-128447264 TGGCTGAAGCAGAGTGAATGAGG + Intergenic
980184928 4:129449053-129449075 CAGCTAAAGCAGTGTTAGGAGGG + Intergenic
980381490 4:132025524-132025546 CAACTCAAGCAGAGTGAAGACGG + Intergenic
980397044 4:132227592-132227614 CAGCCGAGGCAGAGAGAGAGAGG + Intergenic
980610282 4:135151534-135151556 CATCTGGAGCAGAGTGAGCAAGG - Intergenic
981145024 4:141313913-141313935 CAGCTACAGCAGAGCCAGGGAGG - Intergenic
982048593 4:151475622-151475644 TGGCTGAAGTAGAGTGAGGGAGG + Intronic
982071835 4:151702342-151702364 CAGCTGGAGAAGAGGGAGGGAGG + Intronic
982509252 4:156260720-156260742 CAGCTGAAGGAGAGAGTTGGGGG - Intergenic
982763383 4:159315709-159315731 CAGCCGAGGCAGAGAGAGAGAGG + Intronic
983487507 4:168349608-168349630 CAGCTAAAGCAGTGTGACGAGGG - Intergenic
984436470 4:179716815-179716837 TAGATAAAGAAGAGTGAGGGAGG + Intergenic
984624949 4:181996486-181996508 CAGCTGAAGCAGAGAGTGAAAGG + Intergenic
985045524 4:185936811-185936833 GAGCAGAAGCTGAGTGTGGGAGG - Intronic
985091117 4:186363599-186363621 CAGCTGAGGCAAAGAGAGAGAGG - Intergenic
985718261 5:1475120-1475142 AGGATGAAGCAGAGTGAGGCGGG + Intronic
985895441 5:2748200-2748222 CAGAATTAGCAGAGTGAGGGCGG - Intronic
985989725 5:3545735-3545757 CAGCTGAGGCCTAGAGAGGGTGG + Intergenic
987359701 5:17095661-17095683 CAGCTGAGGCAGAGAGAGAGAGG + Intronic
987553286 5:19411528-19411550 CAGCTAAAGCAGTGTTAAGGGGG - Intergenic
988447774 5:31307050-31307072 CAGCTGGAAGAGAGTGAGAGAGG + Intronic
990029983 5:51246678-51246700 CAGCTGAAGCAGAGAAAGCATGG + Intergenic
992197830 5:74357259-74357281 CCTCAGAAGCAGAGTGAGGAGGG - Intergenic
993096947 5:83490365-83490387 CAGCTTGACCACAGTGAGGGAGG - Exonic
993491629 5:88558569-88558591 CAGCAAAAGCATAGTGGGGGAGG - Intergenic
994285626 5:97962196-97962218 AAGCTGAAGCAGAGTAAGGCAGG - Intergenic
995110744 5:108426001-108426023 CAGCTAAAGCAGTGTTAAGGGGG - Intergenic
995468852 5:112479107-112479129 CACCTCAACCTGAGTGAGGGGGG - Intergenic
995695384 5:114873309-114873331 CAGCTGAAGCAGAAGGAATGGGG - Intergenic
995890378 5:116944418-116944440 CAGCTGGGGCAGAGTTAGGCAGG - Intergenic
996245915 5:121263630-121263652 CAGTTGGAGGAGAGTGCGGGTGG + Intergenic
996350845 5:122539838-122539860 CAGCTGAACCTGAGTGATAGCGG + Intergenic
996640020 5:125740872-125740894 CAGCTTAAGCAGATTTTGGGCGG - Intergenic
996869684 5:128175085-128175107 CAGAGGTAGGAGAGTGAGGGTGG - Intronic
997060660 5:130498529-130498551 CAGCTGAAGAATAATGAGGTTGG - Intergenic
997241670 5:132312424-132312446 CAGGTGAAGGGGACTGAGGGCGG - Intronic
997454360 5:134006075-134006097 CAGCTGATACAGAGTGGGAGTGG + Intergenic
997741700 5:136260549-136260571 GGGCTGAAACAGAGTGAGTGAGG + Intronic
997971957 5:138410793-138410815 CAGCCGAGGCAGAGAGAGAGAGG + Intronic
998497105 5:142600550-142600572 AAAATAAAGCAGAGTGAGGGTGG + Intronic
998672659 5:144371174-144371196 TTGTTGAAGCAGAGTGAGGCAGG - Intronic
998732775 5:145099639-145099661 CAGCTGAAGAAATTTGAGGGTGG - Intergenic
1000304759 5:159985049-159985071 TGGCTGAAGTGGAGTGAGGGAGG - Intergenic
1000816328 5:165927134-165927156 GAGCTGGAGCAGGGTGAGGGGGG - Intergenic
1001016869 5:168149806-168149828 TGGCTGTAGCAGAGTGAGTGAGG - Intronic
1001130891 5:169062519-169062541 CACCTGGAGCACAGTGAGTGAGG - Intronic
1001372340 5:171218041-171218063 CAGCTAAAGCAGTGTTAGGTGGG - Intronic
1001402738 5:171455595-171455617 CAGATGAAGCAAAGTCAAGGAGG - Intronic
1001571335 5:172732462-172732484 CAGATGCTGCAGAGGGAGGGAGG + Intergenic
1001584466 5:172824017-172824039 CAGCTGGAGCCGAGTGAGCAAGG + Intergenic
1001751838 5:174137253-174137275 CAGCTGTAACAGGGTGAGGGTGG + Intronic
1001763965 5:174230387-174230409 TAGCTGCAGCAGAGTGAGTTTGG - Intronic
1001956054 5:175848908-175848930 TGGCTGAAGCAGAGTGAGCCGGG + Intronic
1002167249 5:177355853-177355875 CAGCTGAAGGAGAAAGAGGGAGG + Intergenic
1002576866 5:180178970-180178992 GGGCTGAAGCAGGATGAGGGAGG + Intronic
1002775900 6:327322-327344 CAGCTGGAGGAGAGTGAAGGTGG + Intronic
1004077922 6:12362257-12362279 TAGCTGAAGCAGAGGGAGCTGGG + Intergenic
1005403117 6:25455861-25455883 CATCTGAAGCACAGAGATGGAGG + Intronic
1005461413 6:26073108-26073130 CACTTGAAGCACAGTGATGGAGG - Intergenic
1006916148 6:37595069-37595091 CACCTGCAGGGGAGTGAGGGAGG + Intergenic
1007278602 6:40693592-40693614 CAGGTGAGGAAGGGTGAGGGTGG - Intergenic
1007547942 6:42708453-42708475 AAGCTGGAGCAGTGTGAGGGGGG + Intronic
1007736336 6:43984622-43984644 AGGCTGGAGCAGAGTGAGCGAGG + Intergenic
1008859154 6:56128251-56128273 CAGCTGAAGCAGGGTGTAGCAGG + Intronic
1010351197 6:74876618-74876640 CAGCTGGAGTAGAGTGAGCAAGG + Intergenic
1010447076 6:75960159-75960181 GAGCTGAAGCAGGGTGGGGTGGG - Intronic
1010821263 6:80418792-80418814 CAGCTGCAGCAGAGTGCTAGTGG + Intergenic
1011388922 6:86829397-86829419 TACCTGAAGCAGAGTGAATGAGG + Intergenic
1011423829 6:87203925-87203947 AAGCCTAAGCAGAGTGAGGAGGG + Intronic
1012339671 6:98104550-98104572 CAGATGAAGCAGAGTGCTAGTGG + Intergenic
1013050812 6:106533312-106533334 CGGCTGAAGCTGAGTGAAGTAGG + Intronic
1013570356 6:111417547-111417569 CCAGTGAAGCAGAGTGAGGAGGG - Intronic
1013896927 6:115100337-115100359 CAGCTAAAGCAGTGTTAGGAGGG - Intergenic
1014288701 6:119533599-119533621 CAGATGAAGGAGGGAGAGGGAGG + Intergenic
1014422627 6:121263927-121263949 CAGCTAAAGCAGTGTTAGGAGGG + Intronic
1014629900 6:123775352-123775374 CAGCTAGAGCAGAGTGAATGAGG - Intergenic
1014885442 6:126775101-126775123 CATCTGAAGCAGAGTTTGCGGGG + Intergenic
1015519124 6:134114122-134114144 ATGCTGCAGCAGAGTGAGGAGGG - Intergenic
1016695750 6:146992942-146992964 CTGCTGATGAAGAGTGAGGAAGG - Intergenic
1016969117 6:149746321-149746343 CAGCTCAACCGGAGAGAGGGAGG + Intronic
1017080801 6:150666420-150666442 CAGCCGAAGCAGAGGGAGTGTGG - Intronic
1019179789 6:170178956-170178978 CAGCTGATGCAGGGTGGGGTTGG - Intergenic
1019186240 6:170222075-170222097 CAGGTGCATCAGAGTCAGGGTGG - Intergenic
1019332331 7:466591-466613 AGGGTGAAGGAGAGTGAGGGAGG - Intergenic
1019335764 7:481754-481776 CAGGTGAAGCACAGAGAAGGTGG - Intergenic
1019664351 7:2243957-2243979 CAGCAGGAGCAGAGTGGGTGGGG + Intronic
1019943980 7:4312209-4312231 GAGCAGAAGCAGAGGGAGGGAGG - Intergenic
1019960229 7:4452918-4452940 AAGCTCAAGCAGAGAGAGAGAGG - Intergenic
1020707738 7:11566951-11566973 CAGCTGTGGGAGAGTGGGGGGGG + Intronic
1021362503 7:19733446-19733468 CACCTGTTGCAGAGTAAGGGAGG + Intronic
1022134999 7:27438764-27438786 AAGCTGAAGCAGAGAGATGCTGG + Intergenic
1022177844 7:27889177-27889199 CAGCTGAATCAGAGTGGCTGTGG + Intronic
1022530230 7:31062404-31062426 AAGATGAAGTAGAGTGAGGTAGG + Intronic
1022817127 7:33924472-33924494 CAGCTGGAGCACGGTGAGAGGGG - Intronic
1023813677 7:43931780-43931802 CAGTTGAACCAGAGAGACGGAGG - Intronic
1024099800 7:46018405-46018427 CAGCTAAAGCAGTGTTAAGGGGG + Intergenic
1024106477 7:46093000-46093022 CAGCTGAAGCAGTGTTAAGAGGG - Intergenic
1024130130 7:46343052-46343074 CTGCTGAAGAAGAATGAGGAAGG - Intergenic
1024684148 7:51726631-51726653 GACCTGAAGCAAAGAGAGGGTGG + Intergenic
1025159078 7:56637152-56637174 CAGCTGTAGCAGAGTGCTAGTGG - Intergenic
1025608495 7:63056615-63056637 CACATGAAGCAGAGAGGGGGAGG - Intergenic
1025760514 7:64385491-64385513 CAGCTGAATTAGAAAGAGGGAGG - Intergenic
1026487613 7:70834990-70835012 CAGGAGCAGGAGAGTGAGGGGGG + Intergenic
1027587686 7:80078091-80078113 TAGCTAAAGAACAGTGAGGGAGG + Intergenic
1028896242 7:96045316-96045338 TAGCTGAAGTCTAGTGAGGGTGG + Intronic
1028973959 7:96891519-96891541 AAGCTGTGGCAGAGTGTGGGGGG - Intergenic
1029151921 7:98486322-98486344 GAGGTGAAGCTGGGTGAGGGGGG - Intergenic
1029335007 7:99891510-99891532 CAACATAGGCAGAGTGAGGGGGG + Exonic
1029664612 7:101987056-101987078 GAGCTGAGGCACAGGGAGGGAGG - Intronic
1029699661 7:102237927-102237949 CAGCCGAGGCAGAGAGAGAGAGG + Intronic
1029756029 7:102574161-102574183 CAGCCGAGGCAGAGAGAGAGAGG - Intronic
1029773971 7:102673233-102673255 CAGCCGAGGCAGAGAGAGAGAGG - Intergenic
1030160360 7:106502159-106502181 CTGCAGAAGCAGAGTCAGGAGGG - Intergenic
1030925700 7:115451522-115451544 CTGATGAAGCAGAGAGTGGGAGG - Intergenic
1031415788 7:121495174-121495196 CATCTGTAGCAGAGAGGGGGTGG + Intergenic
1031876489 7:127147524-127147546 CAGCTGAAGCAAGGTGAGTGGGG - Intronic
1032513885 7:132493002-132493024 TACCTGAAGCAGGGGGAGGGAGG + Intronic
1032825205 7:135561944-135561966 CAGCCTGGGCAGAGTGAGGGAGG - Intronic
1033574056 7:142663039-142663061 CAGCCGAGGCAGAGAGAGAGAGG - Intergenic
1033623791 7:143088442-143088464 GAGCTGAAGCAGGGTGAGGCAGG + Intergenic
1033798849 7:144877978-144878000 CATCTGAAGCGGAGAGAGGAGGG - Intergenic
1034250477 7:149686594-149686616 AAGGTGAAACAGAGAGAGGGAGG + Intergenic
1034889501 7:154827613-154827635 AAGCCCAAGCAGAGTGAGGAGGG + Intronic
1034889519 7:154827677-154827699 CAGCCCAAGCAGAGTGAGGAGGG + Intronic
1034970857 7:155418285-155418307 CAGCTGAGGCAGCCTGAAGGAGG + Intergenic
1035141795 7:156769768-156769790 CAGCTAAAGAACAGTGAGCGTGG + Intronic
1036548204 8:9792430-9792452 CAGCTGAAGGAGGCTGAGGCAGG + Intergenic
1036727685 8:11234067-11234089 GAGCTTAGGCTGAGTGAGGGTGG - Intergenic
1037624959 8:20598580-20598602 AACCTTAAGCAGAGTGAGGAGGG - Intergenic
1039103275 8:33963611-33963633 CAGCTTAAGCAGATTTTGGGCGG + Intergenic
1039580002 8:38657727-38657749 CAGCTCAAGCAGAGTGAGAATGG - Intergenic
1039823511 8:41154389-41154411 CAGATGGAGCAGAGAGAAGGAGG + Intergenic
1039866770 8:41511811-41511833 CAGCTGCAGCAGAGTGACATTGG - Intergenic
1039907042 8:41794281-41794303 TGGTTGAAGCAGAGTGAGGCAGG - Intronic
1040105002 8:43536521-43536543 CAGCTGAGGCAGAGAGAGAGAGG + Intergenic
1040365476 8:46710764-46710786 CAGCTTTAGAAGATTGAGGGAGG - Intergenic
1042011429 8:64249696-64249718 CTTCGGCAGCAGAGTGAGGGAGG - Intergenic
1042473393 8:69216996-69217018 CAGCTAAAGCAGAGTTAAGAGGG + Intergenic
1043851538 8:85221596-85221618 CAGCTCAGGCAGAGTGAAGTAGG - Intronic
1044113572 8:88305777-88305799 CAGCTAAAGCAGTGTTAAGGGGG + Intronic
1044159834 8:88899365-88899387 TAGCTGAGGCAGAGAGAGAGAGG - Intergenic
1045055705 8:98366718-98366740 CAGCTGAAGCCAGGTGGGGGTGG - Intergenic
1045595275 8:103648069-103648091 CAGCTAAAGCAGTGTTAGGGGGG - Intronic
1045718319 8:105074905-105074927 CAGCAGCAGCAGCGGGAGGGAGG - Intronic
1045863614 8:106840180-106840202 AAGCTGGAGTACAGTGAGGGAGG - Intergenic
1047437010 8:124843113-124843135 AAGCTAAAGCAAAGTGAGGGAGG - Intergenic
1047599568 8:126412709-126412731 GAGTGGAAGCAGTGTGAGGGAGG + Intergenic
1048047404 8:130785850-130785872 CAGCTGGAGCAGAGTGAGAGAGG - Intronic
1048182891 8:132212749-132212771 GAGGTGAAGCAGAGTGAGGCGGG - Intronic
1048317697 8:133374527-133374549 GAGCAGAAGGAGAGTGAGAGCGG - Intergenic
1048317703 8:133374578-133374600 GAGCAGAAGGAGAGTGAGAGCGG - Intergenic
1048384650 8:133900901-133900923 GAGCCTAAGCAGAGTGAGGAGGG - Intergenic
1048967606 8:139625689-139625711 CAGCTGCAGCAGAGAGATGAAGG - Intronic
1049064085 8:140299235-140299257 TAGCTAAACCAGAGTGATGGTGG + Intronic
1049251963 8:141594015-141594037 TAGCTGGAGCAGAGTGAGCCAGG + Intergenic
1049338041 8:142096862-142096884 CAACTAAAGCAAAGAGAGGGAGG - Intergenic
1049369128 8:142255112-142255134 CGGCTGAAGGGGAGTGAGGCAGG + Intronic
1049516222 8:143058422-143058444 CAGCTGAGGCAGAGAGAGAGAGG + Intronic
1049586583 8:143435262-143435284 CAGCAGGAGCAGGGTGGGGGTGG - Intergenic
1049664261 8:143836013-143836035 CACCAGAAGCAGAGTGAGCTGGG + Exonic
1049666243 8:143844519-143844541 CAGCCGAGGCAGAGAGAGAGAGG - Intergenic
1049975786 9:860448-860470 CAGAGTAAGAAGAGTGAGGGAGG - Intronic
1050185633 9:2969901-2969923 ATGCTGGAGCAGAGTGAGTGAGG + Intergenic
1050405926 9:5308746-5308768 TTGCAGGAGCAGAGTGAGGGAGG - Intergenic
1050973632 9:11909598-11909620 CAGCTAAAGCAGTGTTAAGGGGG - Intergenic
1051729920 9:20130545-20130567 TAGCTGAAGCAGAATTAGGAAGG + Intergenic
1052142414 9:25003854-25003876 CAGCTGAGGCAGAGGGTGGCGGG + Intergenic
1052200032 9:25766867-25766889 CAGCTAAAGCAGTGTTAAGGGGG + Intergenic
1052269575 9:26613651-26613673 CAGCTGAGGCAGAGAGAAAGAGG + Intergenic
1052323911 9:27196726-27196748 CAGGAGCAGAAGAGTGAGGGGGG + Intronic
1052678682 9:31659980-31660002 CAGCTAAAGCAGTGTTAAGGGGG - Intergenic
1053350407 9:37410312-37410334 TAGATGAGGCAGAGTGAGGGAGG + Intergenic
1054840335 9:69731621-69731643 CTACTAAAGCAGAATGAGGGTGG - Intronic
1055712681 9:79081599-79081621 CAGATGAAACAGAGAGAAGGGGG + Intergenic
1056934013 9:90902098-90902120 CAGCCGAGGCAGAGAGAGAGAGG - Intergenic
1057010999 9:91601162-91601184 CAGGTGAAGCTGAGTGGGGACGG - Intronic
1057554488 9:96076838-96076860 CAGCCGAGGCAGAGAGAGAGAGG - Intergenic
1057697997 9:97341068-97341090 CAGCCGAGGCAGAGAGAGAGAGG - Intronic
1057734076 9:97637064-97637086 GTGCTGGAGCAGAGTGAGTGAGG + Intronic
1060628975 9:125139004-125139026 AAGGTGGAGCAGAGGGAGGGTGG + Intronic
1060706464 9:125806277-125806299 TGGCTGGAGCAGAGGGAGGGAGG + Intronic
1060877896 9:127096287-127096309 CAGCTGGAGCAGAGCGCCGGTGG + Intronic
1060960978 9:127680455-127680477 TGGCTGATGCAGAGTGAGCGAGG - Intronic
1061188775 9:129070102-129070124 CAGAGGAAGCAGTGGGAGGGAGG + Intronic
1061470849 9:130824311-130824333 CAGCTCAAGCAGGCAGAGGGAGG + Intronic
1061483055 9:130906596-130906618 CAGCAGCAGGAGAGTCAGGGAGG - Intronic
1061535399 9:131245294-131245316 CAGCCGAGGCAGAGAGAGAGAGG - Intergenic
1061835853 9:133329116-133329138 CAGCCGAGGCAGAGAGAGAGAGG + Intergenic
1062039820 9:134399169-134399191 CAGCTGAAGGTGGGTGAGGTGGG + Intronic
1062183906 9:135206120-135206142 CAGCCGAGGCAGAGAGAGAGAGG + Intergenic
1062312383 9:135945877-135945899 CAGCTGAACCAGTGCGTGGGGGG - Exonic
1062683751 9:137799306-137799328 CAGCTGATGGAGAGCAAGGGAGG - Intronic
1188240788 X:27786804-27786826 CATCTGAAGCAGTGAGAGGTGGG - Intergenic
1188314824 X:28660065-28660087 AAGCAGAAGCAGAGTGAGGATGG + Intronic
1189482738 X:41405727-41405749 CAGCTGGAGCAGAGTGAGCCGGG - Intergenic
1190232207 X:48590797-48590819 CAGATCAAGCAAAGCGAGGGCGG + Intronic
1190506352 X:51130095-51130117 CAGCTGAAGCAGAATGTTTGTGG + Intergenic
1190992810 X:55569515-55569537 CAGCTAAAGCAGTGTTAGGAGGG + Intergenic
1191172432 X:57461641-57461663 CAGCTGAAGCAGTGTTAAGAGGG + Intronic
1191713879 X:64180569-64180591 TGGCTGAAGTAGAGTGAGTGAGG - Intergenic
1192034134 X:67545408-67545430 CAGCAGCAGCAGGGTGAGGATGG + Exonic
1192261366 X:69507420-69507442 CAGCTGAGGCTGAGGGAGGCGGG - Intronic
1192397102 X:70793523-70793545 CAGAAGAAAGAGAGTGAGGGTGG - Intronic
1193233285 X:79074539-79074561 CAGCTAAAGCAGTGTTAAGGGGG + Intergenic
1194055410 X:89126646-89126668 CAGCTGCAGCAGAGTGCTAGTGG + Intergenic
1194737214 X:97526803-97526825 AAGCAGAAGCAGAGTGGGTGTGG - Intronic
1195013041 X:100752098-100752120 GAGCCCAAGCAGAGTGAGGAAGG + Intergenic
1195072604 X:101294733-101294755 AAACTGAAGCATAGTTAGGGAGG - Intergenic
1195345837 X:103950349-103950371 CAGCTGGGGCAGAGTGAGTGAGG + Intronic
1195361761 X:104089088-104089110 CAGCTGGGGCAGAGTGAGTGAGG - Intergenic
1195469324 X:105214951-105214973 CAGCTGAAGCAGTGTTAAGAGGG + Intronic
1196120007 X:112039771-112039793 CTGCTGAATCAGAGTCAGTGAGG + Intronic
1196804995 X:119575312-119575334 CAGATGAAGCAGGGAGAAGGGGG + Intronic
1196810804 X:119627654-119627676 TAACTGAGGCAGGGTGAGGGTGG + Intronic
1196830611 X:119772786-119772808 TGGCTGGAGCAGAGTGAGGGAGG - Intergenic
1196940235 X:120768434-120768456 AGGCTGAAGCAGAGTGAATGAGG + Intergenic
1197460780 X:126737937-126737959 CAGCTCCAGGAGAGGGAGGGAGG - Intergenic
1198344691 X:135747862-135747884 CAGCTGAGGCAGAGAGAGAGAGG + Intergenic
1198625006 X:138561283-138561305 CAGCTGTTGCAGAGAGAGGCTGG - Intergenic
1199538707 X:148933249-148933271 CAGCTGAAGCAGAGTAAGCAAGG + Intronic
1199743962 X:150760283-150760305 CAGGTGAGGCAGAGAGAAGGAGG + Intronic
1200250103 X:154548217-154548239 TAGCTGGAGCAGAGTGAGGGAGG + Intronic
1200337633 X:155366820-155366842 CAGCTTAAGATGAGTGAGGAAGG - Intergenic
1200348837 X:155474407-155474429 CAGCTTAAGATGAGTGAGGAAGG + Intergenic
1200571062 Y:4830038-4830060 CAGCTGAAGCAGAATTAAGAGGG + Intergenic
1201543803 Y:15138498-15138520 CAGCTGAGGCAGAGAGAGAGAGG - Intergenic
1201707598 Y:16954363-16954385 CAGCCAAGGCAGAGAGAGGGAGG - Intergenic
1201708168 Y:16959634-16959656 CAGCTGTGGCAGAGAGAGAGAGG - Intergenic