ID: 1174294981

View in Genome Browser
Species Human (GRCh38)
Location 20:49539539-49539561
Sequence CATGGGGGCCCCAGTGGGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 363
Summary {0: 1, 1: 0, 2: 27, 3: 23, 4: 312}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174294981_1174294993 5 Left 1174294981 20:49539539-49539561 CCCCACCCACTGGGGCCCCCATG 0: 1
1: 0
2: 27
3: 23
4: 312
Right 1174294993 20:49539567-49539589 TACCCACTGACAGGGAGCCACGG 0: 1
1: 0
2: 0
3: 11
4: 190
1174294981_1174294998 16 Left 1174294981 20:49539539-49539561 CCCCACCCACTGGGGCCCCCATG 0: 1
1: 0
2: 27
3: 23
4: 312
Right 1174294998 20:49539578-49539600 AGGGAGCCACGGGCCAGTTTGGG 0: 1
1: 0
2: 0
3: 8
4: 152
1174294981_1174294997 15 Left 1174294981 20:49539539-49539561 CCCCACCCACTGGGGCCCCCATG 0: 1
1: 0
2: 27
3: 23
4: 312
Right 1174294997 20:49539577-49539599 CAGGGAGCCACGGGCCAGTTTGG 0: 1
1: 0
2: 0
3: 11
4: 181
1174294981_1174294994 6 Left 1174294981 20:49539539-49539561 CCCCACCCACTGGGGCCCCCATG 0: 1
1: 0
2: 27
3: 23
4: 312
Right 1174294994 20:49539568-49539590 ACCCACTGACAGGGAGCCACGGG 0: 1
1: 0
2: 0
3: 15
4: 184
1174294981_1174294992 -3 Left 1174294981 20:49539539-49539561 CCCCACCCACTGGGGCCCCCATG 0: 1
1: 0
2: 27
3: 23
4: 312
Right 1174294992 20:49539559-49539581 ATGGTGCTTACCCACTGACAGGG 0: 1
1: 0
2: 0
3: 8
4: 122
1174294981_1174294991 -4 Left 1174294981 20:49539539-49539561 CCCCACCCACTGGGGCCCCCATG 0: 1
1: 0
2: 27
3: 23
4: 312
Right 1174294991 20:49539558-49539580 CATGGTGCTTACCCACTGACAGG 0: 1
1: 0
2: 0
3: 5
4: 87
1174294981_1174294999 17 Left 1174294981 20:49539539-49539561 CCCCACCCACTGGGGCCCCCATG 0: 1
1: 0
2: 27
3: 23
4: 312
Right 1174294999 20:49539579-49539601 GGGAGCCACGGGCCAGTTTGGGG 0: 1
1: 0
2: 0
3: 16
4: 176
1174294981_1174295001 26 Left 1174294981 20:49539539-49539561 CCCCACCCACTGGGGCCCCCATG 0: 1
1: 0
2: 27
3: 23
4: 312
Right 1174295001 20:49539588-49539610 GGGCCAGTTTGGGGAGCAGCCGG 0: 1
1: 1
2: 3
3: 34
4: 426

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174294981 Original CRISPR CATGGGGGCCCCAGTGGGTG GGG (reversed) Intronic
900294659 1:1942844-1942866 GAGGGGGGACCCAGAGGGTGTGG + Intronic
900302830 1:1986490-1986512 CCTGGTGCCCCCAGAGGGTGAGG + Intronic
900375438 1:2352344-2352366 ACTGGGGTCCCCAGTGGCTGGGG + Intronic
900589523 1:3453523-3453545 CATTGGGGGACTAGTGGGTGGGG + Intergenic
901040453 1:6360158-6360180 CCTGTGGGACCCAGTGCGTGTGG - Intronic
901314395 1:8296084-8296106 CATGGTGGCCCCACAGGCTGAGG + Intergenic
901327541 1:8377257-8377279 CAAGGGGGCCCTTGTGTGTGTGG - Intronic
901630663 1:10646713-10646735 CATGGGCGCCACCGTGGATGTGG + Intronic
901922741 1:12548325-12548347 CAGGTGGGCTCCAGTGAGTGAGG + Intergenic
902772764 1:18655381-18655403 CATTGGGGACTCAGTGGGGGAGG + Intronic
904437501 1:30508179-30508201 CAGGGAGGCCCCAGTGTGAGAGG - Intergenic
904451684 1:30617013-30617035 CAGGGAGGCCCAAGTGGCTGGGG + Intergenic
904824407 1:33265295-33265317 AATGGGGGGCCCAGAGGTTGAGG + Intronic
904897558 1:33828382-33828404 CATCAGGGCAGCAGTGGGTGAGG + Intronic
905626376 1:39492488-39492510 CATGGGGGCCCCCTGGGCTGCGG + Intronic
905632295 1:39525412-39525434 CATGGCAGCCCCAGGGTGTGGGG - Intronic
905670520 1:39787967-39787989 CATGGGGGCCCCCTGGGCTGCGG - Intronic
905740357 1:40364959-40364981 CATGGTGGCCAAAGTGGATGAGG + Intronic
907049169 1:51318131-51318153 TATCGGGGCTTCAGTGGGTGAGG + Intronic
912528366 1:110302146-110302168 AATGGGGGTCCCATAGGGTGAGG - Intergenic
912995792 1:114531434-114531456 CATGTGGGCAACAGTGAGTGGGG + Intergenic
913186169 1:116372888-116372910 CAGGAGGTCCGCAGTGGGTGCGG - Intronic
915030734 1:152878627-152878649 CATGGGAGCCACTGGGGGTGGGG + Intronic
915137955 1:153746882-153746904 CAAGGGGTCCACTGTGGGTGGGG + Intronic
915574718 1:156767977-156767999 CCTGGGGTCTCCGGTGGGTGGGG - Exonic
916979361 1:170116528-170116550 GATGAGGGCAGCAGTGGGTGTGG + Intergenic
917447122 1:175115698-175115720 CATGCAGGCCACAGGGGGTGGGG + Intronic
918062391 1:181073202-181073224 CATGAAGGCACCAGTGGATGAGG + Intergenic
918413929 1:184287994-184288016 TGGGGGGGCCCCTGTGGGTGAGG - Intergenic
921002005 1:211053759-211053781 CATTGGGTCCCCAGTTGATGAGG - Intronic
922341010 1:224655159-224655181 CATGGGAGCTATAGTGGGTGGGG + Intronic
1062947942 10:1475020-1475042 CGTGGGGGTCCCCGTGGGCGTGG - Intronic
1063481202 10:6378155-6378177 GATGGGGGCAGCAGTGGGAGAGG - Intergenic
1063572385 10:7228179-7228201 CATGGCGGCACCAGCCGGTGGGG + Intronic
1063671428 10:8102991-8103013 CATGGGGTCCCCAATGGCTACGG + Intergenic
1067701476 10:48576152-48576174 TATGGGCTCCCCACTGGGTGTGG + Intronic
1067735702 10:48848592-48848614 GATTTGGGCCCCAGTGAGTGAGG + Intronic
1069719159 10:70539026-70539048 CCTGGGTCCCCCAGTGGGTTTGG + Intronic
1069742423 10:70693395-70693417 CATGGAAGCCCCAGTGGCTCAGG - Intronic
1070510674 10:77157936-77157958 CATGGGGGCACCAGAAGCTGTGG - Intronic
1072744729 10:97932110-97932132 GATGGGGGGCCCAGTGAGTCTGG - Intronic
1073044006 10:100625549-100625571 GGTGGGGGCCCGAGAGGGTGGGG + Intergenic
1074470389 10:113721575-113721597 CATGCGGGCGCCAGTGGGCCGGG - Intronic
1075654770 10:124153473-124153495 CAGGGGGGCCACAAAGGGTGTGG + Intergenic
1075746903 10:124734414-124734436 CAAGGAGGACACAGTGGGTGAGG + Intronic
1076449847 10:130549401-130549423 CAAGGGAGCCCCACTGTGTGAGG + Intergenic
1076629584 10:131844196-131844218 CATGGCGGCCTCGGTGGGGGCGG - Intergenic
1076670912 10:132120718-132120740 CAAGGGGGCCCCATTGGGACAGG - Intronic
1076873890 10:133206593-133206615 CAAGGAGGCCCCAGTGGGGTGGG + Intronic
1077184115 11:1228826-1228848 CTTGGGGGCCACTGGGGGTGGGG + Intronic
1077228781 11:1449572-1449594 GATGGGGGCCCCAGTGGGGCTGG + Intronic
1077283009 11:1754044-1754066 CATGGTGGGCCCGGTGGATGAGG - Exonic
1077309871 11:1883524-1883546 CCTGGGGGCCGCAGGGGCTGAGG + Exonic
1077342871 11:2033750-2033772 CATGAGGGCCCCAGGGCATGTGG - Intergenic
1077477076 11:2795579-2795601 CAGGTGAGCCCCAGTGGGTGTGG - Intronic
1078827932 11:14949671-14949693 CATGAGGGCAGCAGAGGGTGGGG - Intronic
1080587770 11:33697061-33697083 CATGCGGGTAGCAGTGGGTGTGG - Intergenic
1080896267 11:36450966-36450988 CATTGGTGGCCCAGTGGGAGAGG + Intronic
1081993369 11:47349419-47349441 CATGGGGGCACCAGCTAGTGGGG - Intronic
1083535563 11:63463876-63463898 AATGAGGGCCTCAGTGGCTGTGG - Intronic
1083661288 11:64252686-64252708 CCTGGGGGCCCCAGGGGCCGGGG + Intronic
1084310673 11:68314397-68314419 CCTGGGAGCCCCAGTGAATGTGG + Intronic
1084545372 11:69812665-69812687 CATGGTGTACCCAGTGTGTGGGG - Intronic
1084785178 11:71437974-71437996 CATGGGGGCCCCAGGAGGGCCGG - Intronic
1085309637 11:75508682-75508704 CATGGGGGCCACAGTGGGGGAGG - Intronic
1085741364 11:79080657-79080679 ACTTGGGGCCCCAGTGGGTCTGG - Intronic
1085834656 11:79939659-79939681 CATGGGGGTGGCAGTTGGTGAGG + Intergenic
1088728137 11:112657434-112657456 CTTGTGGGCCCCCCTGGGTGTGG - Intergenic
1090671859 11:128953304-128953326 CATGGGTGCGACAGTGTGTGTGG + Intergenic
1090869565 11:130731229-130731251 GATTGGGGCCCCGCTGGGTGTGG + Intergenic
1202825857 11_KI270721v1_random:88939-88961 CATGAGGGCCCCAGGGCATGTGG - Intergenic
1091741659 12:2963887-2963909 CAGGCGGGCCCCCATGGGTGGGG + Intronic
1092262027 12:6957970-6957992 CATGGGGTCCCCAGTGAGCCTGG + Exonic
1092385444 12:8032973-8032995 CCGGGGTGCCCCAGAGGGTGGGG - Exonic
1094458652 12:30668728-30668750 TATGGGGGCCCTACTGTGTGTGG - Intronic
1095980612 12:47972408-47972430 AATGGGGGCCACAGTGGCGGGGG + Intergenic
1095984268 12:47989083-47989105 GATGGAGGGGCCAGTGGGTGGGG + Intronic
1096842708 12:54389332-54389354 CCTGGGGGTCCCTGGGGGTGGGG + Intronic
1101053053 12:100884368-100884390 CATGGGGGGCCCTGTGGAGGAGG - Intronic
1102050084 12:109855869-109855891 CATGGGCGCCCCAGAGGGAGTGG + Intronic
1102458833 12:113087661-113087683 CATTTGGGGCCAAGTGGGTGAGG - Intronic
1102646416 12:114406698-114406720 TCTGGTGGCCCCACTGGGTGGGG - Intronic
1103888794 12:124223057-124223079 CATGGGAGCCGCCGTGGGCGAGG - Intronic
1103910341 12:124348639-124348661 CATGTCGGCACCCGTGGGTGTGG - Intronic
1103925044 12:124418953-124418975 CCTGGGGTCCTCAGTGGCTGGGG - Intronic
1103988877 12:124785140-124785162 CGGGGAGGCCCCAGTGCGTGAGG - Intronic
1104755257 12:131265141-131265163 CATGGGGGTGCCAGGGGCTGGGG + Intergenic
1104977342 12:132558057-132558079 CATGGGGGGTCCAGATGGTGAGG - Intronic
1105071225 12:133235586-133235608 AAGGGGGGCCCCGGAGGGTGAGG - Exonic
1106564309 13:30871574-30871596 CAGGGAGGCCCCAGCTGGTGTGG + Intergenic
1110131760 13:72019562-72019584 TAGGAGGGCCCCTGTGGGTGGGG - Intergenic
1112341016 13:98553037-98553059 CAGGGGAGACCCCGTGGGTGTGG + Intronic
1113598068 13:111548270-111548292 AATGGGGCACGCAGTGGGTGTGG + Intergenic
1113738771 13:112696858-112696880 CAAGGGGGCCCCAGAGGGATGGG - Intronic
1113892484 13:113743725-113743747 CGTGGTGGCCGGAGTGGGTGGGG - Intergenic
1118324483 14:64771928-64771950 CAAGGGGGCCCCTGTTGCTGAGG - Intronic
1118899438 14:69974244-69974266 TTTGGGGGCCCCAGGGTGTGTGG + Intronic
1119773431 14:77235435-77235457 CAGGGGGACTGCAGTGGGTGGGG + Intronic
1119773488 14:77235611-77235633 CAGGGGGACTGCAGTGGGTGGGG + Intronic
1120978972 14:90274306-90274328 TATGAGAGCCCAAGTGGGTGAGG + Exonic
1121630402 14:95417808-95417830 CCTGTGTGCCCCAGTGGGTTAGG + Exonic
1121730027 14:96180291-96180313 CATGGGGGCCCTGGAGGGTAAGG - Intergenic
1121730224 14:96181661-96181683 CATGGAGTCCCCAGTGCCTGCGG + Intergenic
1122325634 14:100879473-100879495 CCTGGTGGCCTCAGTGGGGGTGG + Intergenic
1122981390 14:105193779-105193801 CATGGAGCCCACAGTGGCTGGGG + Intergenic
1124964665 15:34424055-34424077 CATGGGGGCCTTAGAGGATGTGG - Intronic
1124981282 15:34570281-34570303 CATGGGGGCCTTAGAGGATGTGG - Intronic
1126379225 15:48029015-48029037 GATGGGATCCCCAGTGGATGAGG - Intergenic
1126515973 15:49538473-49538495 CTTTGGGTCCCCAGGGGGTGAGG + Intronic
1128505939 15:68272788-68272810 CATAGGAGCCACACTGGGTGTGG - Intergenic
1128972057 15:72117283-72117305 CATGGGGGACGCAATGGGTTAGG + Intronic
1129473664 15:75768783-75768805 CATCTTGGCCCCAGTGGGTTGGG - Intergenic
1129709262 15:77812206-77812228 CATGGGGAGCCTGGTGGGTGGGG - Intronic
1130805279 15:87314245-87314267 CATGGGGTTCTCAGTGGCTGAGG + Intergenic
1131064761 15:89427177-89427199 CATGGGGCTCAAAGTGGGTGGGG - Intergenic
1131259940 15:90882973-90882995 AAAGGGGGTCCCAGTGGGAGGGG + Exonic
1132379332 15:101355728-101355750 CATGGGGGCCCCAGGTCATGAGG + Intronic
1132603243 16:783139-783161 GAGCAGGGCCCCAGTGGGTGGGG - Intronic
1132690027 16:1178110-1178132 CATGGGGTCCCCAGGGAGAGGGG - Intronic
1132697317 16:1207721-1207743 CATGAGGGGCCCCGTGAGTGGGG - Intronic
1132765014 16:1530026-1530048 CACTGGGGCCTCAGTGCGTGAGG + Intronic
1133398389 16:5466368-5466390 CATGGGGGCTGCATTTGGTGAGG + Intergenic
1134494840 16:14724704-14724726 GATGGGGGCCCCACTGGGTGGGG - Intronic
1134500223 16:14763824-14763846 GATGGGGGCCCCACTGGGTGGGG - Intronic
1134526765 16:14950436-14950458 GATGGGGGCCCCACTGGGTGGGG - Intronic
1134545641 16:15105912-15105934 GATGGGGGCCCCACTGGGTGGGG + Intronic
1134580356 16:15365226-15365248 GATGGGGGCCCCACTGGGTGGGG + Intronic
1134714342 16:16348913-16348935 GATGGGGGCCCCACTGGGTGGGG - Intergenic
1134722217 16:16392277-16392299 GATGGGGGCCCCACTGGGTGGGG - Intronic
1134945210 16:18319592-18319614 GATGGGGGCCCCACTGGGTGGGG + Intronic
1134952474 16:18359745-18359767 GATGGGGGCCCCACTGGGTGGGG + Intergenic
1135548256 16:23379862-23379884 CATGCGTGCCCCCGTGAGTGGGG - Intronic
1137354551 16:47748229-47748251 CATGGGGGACCCTGGGGCTGAGG - Intergenic
1137568323 16:49548151-49548173 CTTGGAGGACCCACTGGGTGAGG - Intronic
1139023317 16:62780309-62780331 TGAGGGGGCCCCAGGGGGTGGGG - Intergenic
1139942205 16:70613385-70613407 CATGGCGGCCACACTGGATGGGG + Intronic
1139975106 16:70803832-70803854 CACTGGGCCCCCAGTGAGTGTGG - Intergenic
1140025744 16:71289142-71289164 CACTGGGGCCCCAGTGGGCGTGG - Intronic
1141538391 16:84699698-84699720 CAGGTGGCCCCCAGTAGGTGAGG + Intergenic
1142130228 16:88428816-88428838 CAGGGGGCCCCCAGGAGGTGTGG - Exonic
1142245161 16:88966982-88967004 CATGTGGGCCCCAGGGGACGAGG + Intronic
1142308083 16:89296799-89296821 GGTGGGGGCCCCAGGGAGTGTGG + Intronic
1143030625 17:3965062-3965084 CAGAGGGGCCCGAGAGGGTGGGG + Intergenic
1143451414 17:7038898-7038920 AATGGGGTTCCCAGGGGGTGAGG + Intronic
1143492512 17:7292675-7292697 CATAAGAACCCCAGTGGGTGGGG + Intronic
1143499205 17:7329227-7329249 GGTGGGGGCCCCAGCGGGAGCGG - Exonic
1144645705 17:16972167-16972189 CATGGGGGCGGGAGTGGGTGTGG - Intergenic
1145203750 17:20969414-20969436 CATGGGGGCGGGAGTGGGTGTGG + Intergenic
1145235095 17:21202560-21202582 CAGGGGGGCCGGAGGGGGTGAGG - Intronic
1146001533 17:29133410-29133432 CCTGGGGGCTGCAGTGGGTTAGG - Intronic
1146671028 17:34737869-34737891 CAGGCAGGCCCCAGTGTGTGCGG + Intergenic
1147818104 17:43224710-43224732 CTTGGGTGTCACAGTGGGTGAGG - Intergenic
1148735541 17:49862813-49862835 CAGAGGGGCCCAAGGGGGTGGGG - Intergenic
1151250417 17:72829732-72829754 CATGGGGGCCCATGAGGATGGGG - Intronic
1151816103 17:76472154-76472176 CATGGGGACCCCTGAGGCTGAGG + Intronic
1151903866 17:77035226-77035248 CAAAGGGGCTCCTGTGGGTGAGG + Intergenic
1152545867 17:80999879-80999901 CATGGGGGTCCCCGCGGCTGGGG + Exonic
1152607960 17:81302528-81302550 AATTGGGGCCCCAGTGGGCTTGG + Intergenic
1152898616 17:82927682-82927704 CCTCGGGGCCCCGGTGTGTGTGG + Intronic
1153073606 18:1135251-1135273 AATGGGGGCACCTGTGAGTGGGG - Intergenic
1155846615 18:30716084-30716106 CCTGGAGGCCCAAGTGTGTGGGG - Intergenic
1156351887 18:36309093-36309115 CCTGGGGGCTCTCGTGGGTGGGG + Intronic
1157393894 18:47325987-47326009 CATGCGGGGGCCAGTGGATGTGG + Intergenic
1157563248 18:48663368-48663390 CATGGGCTCCCCAGTGGGCCTGG + Intronic
1159953978 18:74506697-74506719 CCTGGCTGCCCCAGTGGGGGTGG + Intronic
1160514066 18:79468955-79468977 CCTGGGGGTCCCAGAGCGTGAGG - Intronic
1161148141 19:2691975-2691997 CCTGGAGCCCCCAGGGGGTGGGG + Intronic
1161306322 19:3570908-3570930 CGTGTGGGTGCCAGTGGGTGGGG - Intronic
1161361997 19:3855687-3855709 CATGGCGGGCCTGGTGGGTGAGG + Intronic
1161399208 19:4060038-4060060 GATGGGGCCCCGGGTGGGTGTGG - Intronic
1161796985 19:6392974-6392996 CATGGCGGCCCTAGTGAGTGTGG - Exonic
1162029750 19:7912275-7912297 CCTGTGGGCCCGAGGGGGTGGGG - Exonic
1163268697 19:16236208-16236230 CATGGGGGCTCCACAGGGTGGGG - Intronic
1163571532 19:18085049-18085071 CACGGGGATCCCAGTGGCTGAGG - Intronic
1163575555 19:18109322-18109344 CTTGAAGGCCCCAGTGGTTGGGG + Intronic
1165657349 19:37545356-37545378 TATGGGTGTCCCAGTGGGTCAGG + Intronic
1166385511 19:42378392-42378414 CATGGGGGCCACTGAGGTTGGGG + Intronic
1166796421 19:45428845-45428867 CAGGGGGGCCCGAGTGGAGGGGG + Intronic
1167598223 19:50438393-50438415 GATGGGTGCCTCAGTAGGTGGGG + Intronic
1167707343 19:51089418-51089440 AGTGGGGGGCCAAGTGGGTGAGG + Intergenic
1167791903 19:51688531-51688553 CTTTGAGCCCCCAGTGGGTGGGG + Intergenic
1168707258 19:58477222-58477244 CATGGGGGACCCAGAGGGGATGG - Exonic
925023335 2:588475-588497 CAGGTGTGCACCAGTGGGTGTGG - Intergenic
925146669 2:1587201-1587223 CAGGGAGGGCCCTGTGGGTGGGG - Intergenic
925212412 2:2061266-2061288 TGTGGGGGCCGCAGTGGCTGAGG + Intronic
925396249 2:3535648-3535670 CAGGGGGACACCTGTGGGTGTGG + Intronic
927472178 2:23385099-23385121 CACGGGCGCCCGAGTGGGCGGGG - Intergenic
927702500 2:25277064-25277086 CAGGAGGGCCACCGTGGGTGCGG + Intronic
932103458 2:68922355-68922377 CATGGGGGACCCAGTGTATCAGG - Intergenic
932403681 2:71499840-71499862 CATGTGGGCTGCAGGGGGTGTGG + Intronic
933784402 2:85827512-85827534 CAGGTGGCCCCCAGTGGGTCTGG - Intergenic
935631471 2:105216017-105216039 CATGGAGGCCCTAGTTTGTGTGG + Intergenic
937223710 2:120356424-120356446 CATAGGGGCCCCTGAGGGTCTGG + Intergenic
937316927 2:120937594-120937616 GGTAGGGCCCCCAGTGGGTGGGG - Intronic
937979656 2:127607461-127607483 GGCTGGGGCCCCAGTGGGTGAGG + Intronic
938501230 2:131832129-131832151 CATGCAGCCCCCACTGGGTGTGG - Intergenic
939933362 2:148258816-148258838 CATGGGGGCCCCCCTGTGGGTGG + Intronic
946277704 2:218643525-218643547 CTTAGGGGCCTCCGTGGGTGAGG + Exonic
947601871 2:231456380-231456402 CAGGTGGGGCCCAGTGGATGGGG + Intronic
948228740 2:236334358-236334380 CATGGGAGCCCCAGAGGCTGTGG + Intronic
1168805866 20:672006-672028 GATGGGGGCCCCGGTCTGTGGGG + Intronic
1170830775 20:19838853-19838875 CTCGGGGACCCCAGTGTGTGGGG - Intergenic
1173193801 20:40897078-40897100 CATGGGTGCCCAGGTGGTTGGGG - Intergenic
1174114798 20:48219556-48219578 CAAGGAGGCCCCTGTGGTTGAGG + Intergenic
1174294981 20:49539539-49539561 CATGGGGGCCCCAGTGGGTGGGG - Intronic
1174353841 20:49985672-49985694 AATGGTGGGCCCAGTGGGTGGGG + Intronic
1174390633 20:50216500-50216522 CATGGGGGCACTGGGGGGTGGGG + Intergenic
1175066186 20:56290729-56290751 GATGGGGGCACCCGTGGATGAGG + Intergenic
1175374316 20:58514300-58514322 CATGGGGGTCTCAGTGGGCCTGG + Intronic
1175484351 20:59334623-59334645 TGTGGGGGCCCCTGTGGGAGAGG + Intergenic
1175591932 20:60200313-60200335 CAGGGAGGCCCTATTGGGTGAGG + Intergenic
1175755573 20:61527719-61527741 CCTGGTGTCCCCAGTGAGTGAGG + Intronic
1175790640 20:61738058-61738080 GAGGTGGGCCCCAGAGGGTGGGG - Intronic
1176108389 20:63400017-63400039 GCTGGGGGCCACAGTGAGTGAGG - Intergenic
1176231218 20:64034060-64034082 CATGGCTGGCCCAGAGGGTGTGG + Intronic
1176238475 20:64065084-64065106 CCTGGGGGTCCCAGTGCCTGAGG + Intronic
1176239437 20:64069124-64069146 CATGAGGTCCCCAGTGGGTCAGG - Intronic
1176429146 21:6565222-6565244 CATGGGGGTCCCAGTGCCTCAGG - Intergenic
1178892763 21:36533818-36533840 CAGGTAGGCCCCAGTGTGTGTGG - Intronic
1179704636 21:43173538-43173560 CATGGGGGTCCCAGTGCCTCAGG - Intergenic
1179996055 21:44974938-44974960 CATGGGGGCACCGAGGGGTGCGG - Intronic
1180082965 21:45494923-45494945 CCTGGGGTCTCCAGTGGGGGCGG + Intronic
1180084615 21:45502199-45502221 GATGGGGGGCCCTGGGGGTGTGG + Intronic
1180978782 22:19868903-19868925 GTGGGGGCCCCCAGTGGGTGGGG - Intergenic
1180983459 22:19890589-19890611 CTTAGGGGCCGCGGTGGGTGTGG - Intronic
1181936940 22:26445775-26445797 CATCGGGACAGCAGTGGGTGTGG + Intronic
1183183557 22:36278126-36278148 TATGGGGTCCCCAGGGGCTGTGG - Intergenic
1183187326 22:36299593-36299615 CATGGGAGCCCCAAAGGCTGGGG - Intronic
1185057391 22:48588065-48588087 AATGGGGGCTCCAGTGGTTTGGG + Intronic
1185098073 22:48822407-48822429 CATGGGTGGGCCTGTGGGTGAGG - Intronic
1185098104 22:48822508-48822530 CATGGGTGGGCCTGTGGGTGAGG - Intronic
1185344966 22:50307116-50307138 CAAGCAGGCCCCAGGGGGTGCGG + Intronic
950433898 3:12967449-12967471 CATGGCGGCCGCAGTGGGAGCGG + Exonic
950999157 3:17538142-17538164 CCTGGGGGCAACAGGGGGTGGGG - Intronic
952491323 3:33876455-33876477 CATGGGGGCCCCTCTGGGCCTGG + Intergenic
954332155 3:49896842-49896864 CACCGTGGCCCCAGGGGGTGTGG + Exonic
955707399 3:61742658-61742680 CATGGTGGCCAAAGTGGGTGAGG - Intronic
956629697 3:71304070-71304092 GATGAGGGCCCCAGAGGATGAGG - Intronic
959585320 3:108020257-108020279 CATGGGGGCAGGAGTGGGAGGGG + Intergenic
961002272 3:123382021-123382043 CAGGGGGGCCCCAGGAGATGAGG - Intronic
961344071 3:126250182-126250204 TGTGGGGGCGGCAGTGGGTGGGG + Intergenic
961354508 3:126327492-126327514 GCTGTGGGCCACAGTGGGTGAGG + Intergenic
961380862 3:126495852-126495874 CATGGTGGCCACACTGGGAGGGG - Intronic
961383088 3:126508552-126508574 CATTGGGCCCCCAGGGGATGGGG - Intronic
961443055 3:126964074-126964096 CTGGGGGGCTCCAGTGGATGGGG + Intergenic
961829455 3:129615991-129616013 CACAGGGGCTCCACTGGGTGCGG + Intergenic
962326106 3:134433608-134433630 CAAGGGGGATGCAGTGGGTGTGG - Intergenic
967302285 3:188026729-188026751 CATGGGGCTCCCAGTGCCTGAGG + Intergenic
967967466 3:194973476-194973498 CCTGGGAGCACCTGTGGGTGGGG - Intergenic
968222153 3:196947444-196947466 CCTGGGGGCACCAGTGGAGGTGG - Exonic
968276943 3:197447210-197447232 GACTGGGGCCCCAGAGGGTGTGG + Intergenic
968483453 4:847507-847529 ACTGGGTGCCCTAGTGGGTGCGG + Intergenic
968488416 4:876434-876456 CGTGGGAGCCCCAGGGGGAGTGG - Intronic
968500929 4:949739-949761 CCTGGGGGCCGCGGTGGGCGTGG - Intronic
968540815 4:1167439-1167461 CCGGGGGGCCCCAGGGGCTGCGG + Exonic
969020078 4:4134004-4134026 CATGTGGGCCCAACTGGGGGTGG + Intergenic
969081742 4:4624493-4624515 GCTGGGGGACCCAGGGGGTGAGG - Intergenic
969311516 4:6355578-6355600 CAAGGAGGCCCCAGGGTGTGAGG + Intronic
969330387 4:6471148-6471170 GGTGGGTGCCCCAGTGGGAGGGG - Intronic
969733777 4:8973408-8973430 CATGTGGGTCCAACTGGGTGTGG - Intergenic
969793365 4:9507468-9507490 CATGTGGGCCCAACTGGGGGTGG - Intergenic
971169991 4:24224140-24224162 CCTGGGGGCTGCAGTGGGTTGGG + Intergenic
972445222 4:39136935-39136957 CATCTGGGCCGGAGTGGGTGTGG + Intergenic
974402944 4:61427594-61427616 CACTGGGGCCCCAGGGCGTGGGG - Intronic
974838203 4:67275329-67275351 CATGGGAGCCCATGGGGGTGGGG + Intergenic
985680350 5:1252799-1252821 GATGGGGGCCCCAGCTGGGGTGG - Intergenic
985789007 5:1915471-1915493 CTTGGGGGCAGCAGTGGGAGTGG - Intergenic
986296824 5:6446339-6446361 CAGGGGGTCCCCGCTGGGTGTGG + Intergenic
987158847 5:15118865-15118887 CATGGGGGTCGCATGGGGTGGGG - Intergenic
989674702 5:43960110-43960132 CACCGGGGCCTCAGGGGGTGGGG - Intergenic
990940719 5:61200537-61200559 CAAGGAGGCCCCACTGGTTGAGG + Intergenic
993354076 5:86884431-86884453 CATGGTGGCCAAAGTGGATGAGG - Intergenic
994956940 5:106544921-106544943 CCTAGGGGCCCTAGTGAGTGTGG + Intergenic
994995580 5:107058258-107058280 CAAGGTGGGCACAGTGGGTGTGG + Intergenic
995518802 5:112980942-112980964 GATGGGGGCAATAGTGGGTGTGG - Intronic
995554032 5:113309348-113309370 CATGGGAGACTCAGTGGGGGAGG - Intronic
997621861 5:135304400-135304422 CATGGGCTCCCCAGTGGGGCAGG + Intronic
999286791 5:150398955-150398977 GGTGGGGGCAGCAGTGGGTGGGG + Intronic
1001425512 5:171619583-171619605 CTCGAGGGCCCCAGTGGGTTGGG + Intergenic
1001777127 5:174337346-174337368 CTTGGGGGCTCCACTGTGTGTGG + Intergenic
1002447536 5:179298474-179298496 GATCGGGGCGCCAGTGGGTTTGG - Intronic
1002652493 5:180710420-180710442 AATGGGAGTCCCAGGGGGTGAGG + Intergenic
1002832622 6:836627-836649 CATGGGGCCCACGCTGGGTGGGG + Intergenic
1005811339 6:29518612-29518634 AATGGGGGGCCCTGTGGGTGGGG + Intergenic
1006637397 6:35470297-35470319 CATGGTGGCCAAAGTGGATGAGG + Exonic
1006907587 6:37543458-37543480 GAAGGGGGCCACAGTGCGTGTGG - Intergenic
1006920468 6:37624457-37624479 CCTGGGGGCTCCAGTGGAAGTGG - Intergenic
1010272449 6:73929524-73929546 CATGTGGGCCACAGAGGGTAGGG + Intergenic
1010802627 6:80194947-80194969 CCTGGGAGCAACAGTGGGTGAGG - Intronic
1011728477 6:90234985-90235007 GATGGGTGCCCCAGTTGGTATGG - Intronic
1014783160 6:125587842-125587864 CATAGGCTCCCCGGTGGGTGGGG + Intergenic
1018167478 6:161112094-161112116 CGTGGGAGCCCAAGTGTGTGAGG - Intronic
1018743692 6:166748570-166748592 AATGGGGGCCCGAGGAGGTGGGG - Intronic
1018743775 6:166748762-166748784 AATGGGGGCCCAAGGGGATGGGG - Intronic
1018743821 6:166748873-166748895 AATGGGGGCCCAAGGGGATGGGG - Intronic
1018743868 6:166748985-166749007 AATGGGGGCCCAAGGGGATGGGG - Intronic
1018991114 6:168675144-168675166 CAAGGAAGCCCCAGTGGGTCTGG + Intergenic
1019579325 7:1752277-1752299 CATGGTGGCCCCTCTGGGTGGGG - Intergenic
1019701957 7:2478347-2478369 CATCAGGGGCCCTGTGGGTGGGG + Intergenic
1019723389 7:2587034-2587056 GATGGGGGCAGCAGTGGGTGTGG + Intronic
1019757471 7:2783454-2783476 AATGGGGACCTCAGAGGGTGAGG - Intronic
1021503009 7:21350584-21350606 CAGGGGTGGCCCAGTGGATGTGG - Intergenic
1023519212 7:41033896-41033918 CTTGGGGGGCCAAGTAGGTGAGG + Intergenic
1024219673 7:47277796-47277818 CATGGGGACCCTAGGGGGTGGGG + Exonic
1026602915 7:71791528-71791550 CAAGTGGGCCCCAGTGTCTGTGG - Intronic
1026985698 7:74554023-74554045 CCTGGGGTCCCCAGTAGATGAGG - Intronic
1028018763 7:85745360-85745382 CAAGGAGCCTCCAGTGGGTGGGG - Intergenic
1028522493 7:91747509-91747531 CATGGTGGCCCCATTGGTTGAGG - Intronic
1029544065 7:101201213-101201235 CACCTGGGACCCAGTGGGTGGGG - Intergenic
1030401650 7:109059174-109059196 CATGGGGGCCACTGTGGTTGGGG + Intergenic
1035433559 7:158840706-158840728 GATATGGGCCCCAGTGGGGGAGG + Intergenic
1035636694 8:1152592-1152614 CATGGGGGGCCCAGCAGGGGAGG + Intergenic
1039057869 8:33550999-33551021 CAGGAGGGCCCCAGCAGGTGAGG - Intronic
1039075803 8:33689602-33689624 GATGGGGGCTTCAGTGGGCGGGG - Intergenic
1039390827 8:37179744-37179766 TATGGGGACAACAGTGGGTGGGG + Intergenic
1039415093 8:37386609-37386631 CATGGTGGCCCAGGAGGGTGGGG - Intergenic
1039846301 8:41328111-41328133 CATGGGTGCAGCAGTGGATGGGG + Intergenic
1041690940 8:60686465-60686487 CATGCAGGCCCCTGTGGATGTGG + Intronic
1044973713 8:97644122-97644144 CACGTGGGCGCCAGTGGGCGGGG - Intergenic
1046870954 8:119205523-119205545 CATGGGGGTGGCAGTGGGGGAGG + Intronic
1049241963 8:141542532-141542554 CATGGAAGGCCCAATGGGTGGGG + Intergenic
1049342959 8:142123570-142123592 CCTGGGAGCCCCTGGGGGTGAGG - Intergenic
1049591693 8:143465684-143465706 TGTGGGGGCCCGAGTGGGCGGGG - Intronic
1050513044 9:6413972-6413994 CCTGGGGCCCCCAGAGGGCGGGG + Intronic
1052856202 9:33408149-33408171 CATGTGGGCCCCAGGGAGAGTGG + Intergenic
1053297125 9:36923059-36923081 CAGAGGGGCCCCCGTGGGTGGGG - Intronic
1053504474 9:38629879-38629901 CCTGGGGAGCCCGGTGGGTGTGG - Intergenic
1055909102 9:81326999-81327021 CCTGAGGTCCCCAGTGGGTGAGG + Intergenic
1056721818 9:89078613-89078635 CAGGAGGACCCCAGAGGGTGAGG + Intronic
1057700804 9:97361976-97361998 CGTGGGAACCCCAGTGTGTGGGG - Intronic
1060403666 9:123362326-123362348 CAAGGAGGCCCCAGAGGGTGAGG - Intronic
1060734062 9:126055172-126055194 CCTGGGGTCCCCAGTTGCTGTGG - Intergenic
1060965874 9:127712091-127712113 GATGGGGGCCCCTGTGGGCTTGG + Intronic
1061400161 9:130364157-130364179 CATGGCGGCCCCATCAGGTGGGG + Intronic
1061670800 9:132187140-132187162 CAGGGGGGCCACAGTGGGCATGG - Intronic
1061682738 9:132250936-132250958 CCAGGGGGCCCCAGGAGGTGAGG - Intergenic
1062232597 9:135490429-135490451 CATGGGGGCAGGAGTGGGAGAGG - Intergenic
1062359444 9:136180671-136180693 CCTGGGGGCCCCAAGGGGAGGGG + Intergenic
1062494129 9:136823668-136823690 GGTGGGTGCCCCAGTGGGTTCGG + Intronic
1062565319 9:137161637-137161659 CGTGGGGGTCGGAGTGGGTGGGG + Intronic
1185469999 X:376534-376556 CATGGCGGCCCCACTGGGTGTGG - Intronic
1185470015 X:376595-376617 CATGGCGGCCCCACTGGGTGTGG - Intronic
1185470031 X:376656-376678 CATGGTGGCCCCACTGGGTGTGG - Intronic
1185470047 X:376717-376739 CATGGTGGCCCCACTGGGTGTGG - Intronic
1185470091 X:376892-376914 CATGGCGGCCCCACTGGGTGTGG - Intronic
1185470107 X:376953-376975 CATGGCGGCCCCACTGGGTGTGG - Intronic
1185470123 X:377014-377036 CATGGCGGCCCCACTGGGTGTGG - Intronic
1185470139 X:377075-377097 CATGGTGGCCCCACTGGGTGTGG - Intronic
1185470169 X:377193-377215 CATGGTGGCCCCACTGGGTGTGG - Intronic
1185470199 X:377311-377333 CATGGCGGCCCCACTGGGTGTGG - Intronic
1185470229 X:377429-377451 CATGGTGGCCCCACTGGGTGTGG - Intronic
1185470259 X:377547-377569 CATGGTGGCCCCACTGGGTGTGG - Intronic
1185470288 X:377665-377687 CATGGCGGCCCCACTGGGTGTGG - Intronic
1185470304 X:377726-377748 CATGGTGGCCCCACTGGGTGTGG - Intronic
1185470320 X:377787-377809 CATGGTGGCCCCACTGGGTGTGG - Intronic
1185470335 X:377848-377870 CACGGCGGACCCACTGGGTGTGG - Intronic
1185470351 X:377909-377931 CATGGTGGCCCCACTGGGTGTGG - Intronic
1185550602 X:980602-980624 CATGGCAGCCCCAGTGGGTGAGG - Intergenic
1185550635 X:980706-980728 CATGGCAGCCCCAGTGGTTGAGG - Intergenic
1185689391 X:2140695-2140717 CAGTGGGGGCCCAGTGGGAGAGG + Intergenic
1187298999 X:18029979-18030001 CATGTGGCCACCAGAGGGTGGGG - Intergenic
1197623751 X:128780757-128780779 CTTGGAGGCCCCAGGGGGAGGGG - Intergenic
1201291247 Y:12421788-12421810 CAAGGGGGCCGCGGTGGGCGAGG - Intergenic