ID: 1174296330

View in Genome Browser
Species Human (GRCh38)
Location 20:49547900-49547922
Sequence ATGCCATCTTCCTCATGGAG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 177
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 161}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174296330_1174296337 28 Left 1174296330 20:49547900-49547922 CCTCTCCATGAGGAAGATGGCAT 0: 1
1: 0
2: 1
3: 14
4: 161
Right 1174296337 20:49547951-49547973 CTCCCACACCACCGCGTCGTAGG 0: 1
1: 0
2: 0
3: 1
4: 45
1174296330_1174296335 5 Left 1174296330 20:49547900-49547922 CCTCTCCATGAGGAAGATGGCAT 0: 1
1: 0
2: 1
3: 14
4: 161
Right 1174296335 20:49547928-49547950 TGGAAGTCGAGCCTGGTGCGAGG 0: 1
1: 0
2: 20
3: 364
4: 2624
1174296330_1174296334 -2 Left 1174296330 20:49547900-49547922 CCTCTCCATGAGGAAGATGGCAT 0: 1
1: 0
2: 1
3: 14
4: 161
Right 1174296334 20:49547921-49547943 ATAGGCATGGAAGTCGAGCCTGG 0: 1
1: 0
2: 1
3: 7
4: 90

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174296330 Original CRISPR ATGCCATCTTCCTCATGGAG AGG (reversed) Exonic
900005087 1:39992-40014 TTGCAAGCTGCCTCATGGAGGGG + Intergenic
900178226 1:1299978-1300000 CTGCCAGCTTCTTCATGTAGGGG + Exonic
901057763 1:6456738-6456760 TTGCCATCTTCCCAATAGAGTGG - Intronic
902622809 1:17660262-17660284 ATGCCATCTGCCTCCTCAAGGGG - Intronic
903036797 1:20498301-20498323 ATGCCAGCTTCCTGAGGCAGGGG + Intergenic
903790680 1:25890881-25890903 ATGCCATTTTCCAGATGGCGGGG - Intronic
907712164 1:56893717-56893739 CTGTCATCTGCCTCATAGAGTGG + Intronic
907923069 1:58931188-58931210 ATACTACCTACCTCATGGAGTGG - Intergenic
909167819 1:72250890-72250912 ATGCCATCTCCATAATGGGGAGG - Intronic
909945257 1:81656286-81656308 TTGGCATCTTTCACATGGAGAGG - Intronic
914931214 1:151935430-151935452 CAGCCATCTTCATCATGGAGAGG + Intergenic
918689746 1:187465890-187465912 ATGCCAACTTCCTATGGGAGTGG + Intergenic
924152288 1:241141542-241141564 AAGGCATCTTCCTCATAGGGTGG + Intronic
1064628612 10:17286380-17286402 CTCCCATCTGCCTCATAGAGAGG + Intergenic
1064779387 10:18818135-18818157 AAGCCATCTCTCTCATGTAGGGG + Intergenic
1066076343 10:31881640-31881662 TTAACAACTTCCTCATGGAGAGG - Intronic
1066447014 10:35492606-35492628 ATTGCATCTTGCTCATGGATAGG + Intronic
1067107036 10:43373376-43373398 ATAGTATCTTCCTCATGGGGAGG + Intronic
1069215600 10:65815145-65815167 ATGCTATCTGCCCCATGTAGGGG - Intergenic
1069556189 10:69400113-69400135 ATCTCATCTTCCTCATGAGGTGG + Intronic
1072962263 10:99940030-99940052 ACTCCATCTCCCACATGGAGTGG + Intronic
1073563475 10:104516470-104516492 GTTCCATCTTCTCCATGGAGTGG + Intergenic
1074483676 10:113852782-113852804 ATGCCTTTTTCCTCATTGATAGG - Exonic
1076363342 10:129905593-129905615 ATCCCTACTTCTTCATGGAGTGG - Intronic
1076509253 10:131000438-131000460 ATGCCATCTTCCTCCACGAGAGG + Intergenic
1076544946 10:131238916-131238938 ATGCCAACGTCCCCATGCAGTGG + Intronic
1077767729 11:5179262-5179284 ATGCCTTCTTCCACATTGATTGG + Intronic
1078492030 11:11778309-11778331 TGGGCATCTTCCTCTTGGAGAGG + Intergenic
1079677780 11:23252819-23252841 ATAACATCTTCCTCATAGAGAGG + Intergenic
1079888378 11:26017679-26017701 ATGACATTTTCCTTTTGGAGGGG - Intergenic
1080280328 11:30549760-30549782 AAGCTCTCTTCCTCATGAAGAGG + Intronic
1080756046 11:35200053-35200075 ATGCCCTCTTTCTTCTGGAGGGG + Intronic
1083122568 11:60530232-60530254 ATGCAAACTCCCTAATGGAGAGG - Intronic
1084056907 11:66640049-66640071 ATGCCTTCGTACACATGGAGCGG + Exonic
1084061239 11:66676720-66676742 ATGCCTTCGTACACATGGAGCGG - Exonic
1084711556 11:70847028-70847050 ATGCCATCTTGCTCAGGGATGGG - Intronic
1086871070 11:92037250-92037272 ATGCCATTTTCATCATGTAATGG + Intergenic
1087784948 11:102344013-102344035 ATGCCAACATACTCATGGATGGG + Intergenic
1088517704 11:110656545-110656567 AACCCATCTGCCTCTTGGAGAGG - Intronic
1088704371 11:112448227-112448249 CTGCCCACTCCCTCATGGAGTGG + Intergenic
1090838967 11:130473317-130473339 GTGTCATCTTCCCCACGGAGAGG - Exonic
1090956268 11:131515380-131515402 AGGCCATCTACCACAGGGAGAGG - Intronic
1091006758 11:131960672-131960694 AGGTCATTTTCCTCATGAAGAGG + Intronic
1091379069 12:44167-44189 TTGCAAGCTGCCTCATGGAGGGG + Intergenic
1094191243 12:27700462-27700484 ATTCCAGGTTCCTCAAGGAGAGG - Intergenic
1095551770 12:43450250-43450272 AGGACAGCTTCTTCATGGAGAGG - Intronic
1096422920 12:51475714-51475736 ATGCTATCTGCATCATGGAAAGG - Intronic
1101821274 12:108185967-108185989 CTGCCAGCTGCCTCATGGGGTGG + Intronic
1102721199 12:115017872-115017894 ATCCCATGTTCCTCTTGGACTGG - Intergenic
1103301158 12:119927499-119927521 ATGCCATCTTCCTAAGAGAAGGG + Intergenic
1103936496 12:124480211-124480233 AGGCCATCCTCCTCCTGCAGCGG - Intronic
1105790151 13:23790648-23790670 ACACCATCTGCCTCATGGAGTGG + Intronic
1106531588 13:30598068-30598090 ATGCCTTCTTCTTAATGGAAAGG - Intronic
1107112111 13:36709218-36709240 ATGCTGTCCTCCTCAGGGAGTGG - Intergenic
1108608969 13:52065228-52065250 ATGCCACCTTCCTCAGAGTGAGG - Exonic
1111852629 13:93596190-93596212 ATGCCATGATCCTTATTGAGAGG + Intronic
1112143536 13:96672658-96672680 ATGCCCTCTTTCTCAGGAAGCGG - Intronic
1113803847 13:113102020-113102042 ATGCCATCATCCACATGGAAAGG - Intergenic
1120938114 14:89918632-89918654 TTGCCTTTTTCTTCATGGAGAGG - Intronic
1123756213 15:23399482-23399504 AAGCTCTCTTCCCCATGGAGGGG - Intergenic
1125827847 15:42691272-42691294 AAGCCATCTTCATCAGGAAGGGG - Exonic
1127913190 15:63435217-63435239 ATTCCATCTCCCACATGGCGTGG + Intergenic
1128731548 15:70024867-70024889 GTGCCAGCTTCCTCGAGGAGTGG - Intergenic
1128805854 15:70530758-70530780 AAGCCATCTGCCTCCTAGAGTGG - Intergenic
1129100248 15:73255439-73255461 CTCCCGTCTTCCTCAAGGAGGGG + Intronic
1131135551 15:89932230-89932252 ATGTCATCTTCCTCATCGTCTGG + Intergenic
1131863013 15:96674822-96674844 ATGCTCACTTCCTCATGGACAGG - Intergenic
1132242772 15:100272321-100272343 AAGCCATCATGTTCATGGAGTGG - Intronic
1132448426 15:101950952-101950974 TTGCAAGCTGCCTCATGGAGGGG - Intergenic
1134460122 16:14423239-14423261 AAGCTCTCTTCCCCATGGAGGGG + Intergenic
1135183364 16:20293801-20293823 ATGCTATCTGCCTTATGAAGTGG + Intergenic
1139033906 16:62919539-62919561 AGGCAATCCACCTCATGGAGAGG + Intergenic
1141038762 16:80653964-80653986 GAGCCATCTTCCTCATGCATGGG + Intronic
1141203414 16:81914383-81914405 ATGCCACCTGGCTCAGGGAGGGG - Intronic
1144355828 17:14445298-14445320 ATGCCATCCTACCCATGGTGGGG + Intergenic
1147030674 17:37632792-37632814 CTGCCGTATTCCTGATGGAGAGG - Intronic
1147160438 17:38566445-38566467 CTGCCATCTCCCTTATGGTGGGG - Intronic
1156358342 18:36361923-36361945 ATGCCGTCTTTCTCACGCAGTGG - Intronic
1156539499 18:37895629-37895651 ATACCATCAACCTCATGGGGTGG - Intergenic
1156747427 18:40409440-40409462 TTGTCATCTTCCTCTTGGATGGG - Intergenic
1158206295 18:54996726-54996748 ATGCCATCTTCATCCTGTATAGG + Intergenic
1160636840 19:81601-81623 TTGCAAGCTGCCTCATGGAGGGG + Intergenic
1160989641 19:1855313-1855335 ATGCCCCCTTGCTCGTGGAGGGG - Intronic
1161435433 19:4259975-4259997 GTGTGATCTTCATCATGGAGGGG + Intronic
1162084736 19:8241644-8241666 AGCCCCTCTTCCACATGGAGTGG - Intronic
1162894737 19:13758325-13758347 AAGCCAACTTGCTCATGGAAAGG - Intronic
1164625620 19:29725767-29725789 ATGCCAGCTTCCTCATCAAGAGG - Intergenic
1164893138 19:31842338-31842360 ATGCCATGTTGCTCCTGAAGTGG - Intergenic
1166888078 19:45973528-45973550 CGGCCATCATCCTCATGGTGGGG + Exonic
1167197329 19:48039311-48039333 GTGCCATCTTCCTCAGTGGGTGG - Exonic
1167382425 19:49146288-49146310 ATGCCATCATCCCCATGGGGGGG + Intronic
925031255 2:651411-651433 ATTCTATCTTCCTCATGCATGGG + Intergenic
925869025 2:8253335-8253357 ATGCCTTGTTCCTCATGGTGTGG + Intergenic
925986242 2:9217440-9217462 AAGCCATCTTCAGCATGGAGTGG - Intronic
927637406 2:24826158-24826180 CTGTCATCTGCCTCCTGGAGGGG + Intronic
927912197 2:26907615-26907637 AGGGCATCTTCCTGATGGATGGG - Intronic
927963922 2:27257623-27257645 ATGCTACCTACCTCATGGGGTGG + Intronic
932072492 2:68635246-68635268 AGGCCATATTTCTCAAGGAGGGG + Intergenic
932581638 2:72996035-72996057 ATGGCTTCTCCCCCATGGAGAGG - Intronic
932949070 2:76271695-76271717 TTTCCATCTTCATCATGTAGAGG + Intergenic
934636407 2:95992815-95992837 ATTTCAACTTCCTCACGGAGTGG - Intergenic
934797238 2:97112611-97112633 ATTTCAACTTCCTCACGGAGTGG + Intergenic
934836170 2:97590831-97590853 ATTTCAACTTCCTCACGGAGTGG - Intergenic
935274363 2:101463493-101463515 ATGCCAGCTCTTTCATGGAGAGG - Intronic
935742060 2:106158436-106158458 CGGCCATCTCCCTCATGGTGTGG - Intronic
936564636 2:113573440-113573462 TTGCAAGCTGCCTCATGGAGGGG - Intergenic
938578707 2:132627141-132627163 ATCCCATGTTCATCACGGAGGGG + Intronic
940134480 2:150420968-150420990 ATTCCATCTTCATCAGAGAGTGG + Intergenic
940816595 2:158304167-158304189 AAGCCATCTTCTGCATGAAGAGG - Intronic
942219837 2:173758285-173758307 ATGGCACCTGCCTCATGGAGTGG + Intergenic
942288193 2:174442873-174442895 ATCCCATTTTCCTCTTGGGGAGG - Intronic
946599475 2:221343802-221343824 ATGCTATATGCCCCATGGAGTGG - Intergenic
1170953172 20:20955192-20955214 ATGCCATCTGACTCCTGGACAGG + Intergenic
1171460213 20:25293852-25293874 ATGCCACATTCCTAGTGGAGAGG - Intronic
1173426035 20:42944289-42944311 ATGCCGGCTTCCACATGGAGAGG + Intronic
1174296330 20:49547900-49547922 ATGCCATCTTCCTCATGGAGAGG - Exonic
1174650606 20:52121754-52121776 ATGGCATCTTCCTCCAGTAGGGG - Intronic
1174841322 20:53904048-53904070 ATGCCAGATGCCTCATTGAGTGG - Intergenic
1175390458 20:58624168-58624190 TTCCCATCGTCCTCAAGGAGAGG - Intergenic
1178807520 21:35851832-35851854 ATGCCATTTTGCTCATGGGTAGG - Intronic
1179453199 21:41479700-41479722 ATGCCAACTTTCTCACCGAGTGG + Intronic
1179952865 21:44721056-44721078 ATTCCCTCTTCTTCATGGGGAGG - Intergenic
1180080899 21:45487125-45487147 ATTCCATATTCCGCATGGTGGGG + Intronic
951420701 3:22480937-22480959 ATGCCATCTACCTCATAGTGTGG + Intergenic
951985076 3:28610481-28610503 ATACCACCTTCATCATGAAGTGG + Intergenic
952098906 3:29988565-29988587 ATGCCTTGTTCCTCAAAGAGTGG + Intronic
953407416 3:42666331-42666353 AAGCCTTCTTCCTCGGGGAGGGG - Intergenic
955382580 3:58451789-58451811 ATGTCTTCTTCCTCATGGTCTGG + Intergenic
958858568 3:99417473-99417495 ATGCCCTATTTCTCAGGGAGGGG + Intergenic
964614126 3:158644028-158644050 ATGCAGTCTTCCACATGGACAGG + Intergenic
964689056 3:159429638-159429660 ATGCCACCTGCTTCATGGTGGGG - Intronic
965858966 3:173124079-173124101 ATGCCATTTTCCTCATTTGGTGG - Intronic
971604082 4:28634972-28634994 ATGCCAAATTCCTCAGGGAAAGG + Intergenic
972573767 4:40333513-40333535 CTGCCATCATCCTCCTGGAATGG + Intergenic
973637200 4:52871251-52871273 ATGGCACCTGCCTCATGGGGGGG - Intergenic
974977150 4:68905546-68905568 ATGCCATGTTCATCATGCACTGG + Intergenic
978651037 4:111005571-111005593 ATGTTATCTTCATCATAGAGTGG + Intergenic
981153957 4:141412423-141412445 AGGGCATCTTCCTTGTGGAGAGG - Intergenic
981175382 4:141676905-141676927 ATGTCTTCTTCCTCATAGTGTGG - Intronic
986326078 5:6675650-6675672 ACCCCATCTTGCTCTTGGAGAGG + Intergenic
997505061 5:134410898-134410920 TTGCCACCTTCCTCATGGAGGGG + Intronic
1000029330 5:157388760-157388782 ATGGCATCTACCTCATGGGATGG + Intronic
1003627677 6:7758115-7758137 TTGGCATCTTCCCCATGCAGGGG - Intronic
1004630050 6:17412365-17412387 ATTCCTTCTTCCTCATTCAGTGG - Intronic
1005732726 6:28714206-28714228 GTGCCAGGTTCCTCAAGGAGAGG + Intergenic
1006272779 6:32976941-32976963 ATCCCATCTGCCCCATGCAGTGG - Intronic
1006779208 6:36620739-36620761 ATGCCACCTTCCCCATGGGCAGG - Intergenic
1006813531 6:36836398-36836420 TTGCCTTCCTCCTCATGAAGGGG - Intronic
1013849166 6:114493190-114493212 AAGCCAGCTTTCTCATGCAGAGG + Intergenic
1016186367 6:141202478-141202500 ATGCAAGCTTCCTCATCCAGAGG - Intergenic
1023518984 7:41031941-41031963 ACTCCATCATGCTCATGGAGTGG + Intergenic
1026195671 7:68171300-68171322 ATGCCACCTTCCTCTTAGAAAGG - Intergenic
1030029933 7:105359606-105359628 ATGTCATCTTCCTCATCGTCTGG + Intronic
1031437149 7:121746701-121746723 ATGCCTTTTTACTCATGGTGGGG + Intergenic
1031728617 7:125268878-125268900 ATGCCATCTATCTTATGTAGTGG + Intergenic
1031988144 7:128177205-128177227 CTGCCATCCTCCTCATCAAGAGG - Intergenic
1033452630 7:141475191-141475213 ATGCCATCTTCCAGCTGGTGTGG + Exonic
1033820410 7:145128075-145128097 CAGGCATCTTCCTCAAGGAGAGG + Intergenic
1037183893 8:16038722-16038744 ATGCCCTCTTCATGAGGGAGAGG + Intergenic
1037740376 8:21604200-21604222 ATACCACCTCCCCCATGGAGAGG + Intergenic
1039044360 8:33436337-33436359 ATGCCTTCTTACACATGGAGCGG - Intronic
1039151992 8:34516598-34516620 ATGAAAGGTTCCTCATGGAGAGG - Intergenic
1039919155 8:41881120-41881142 ATGGCAGTTTCCTCATGAAGGGG + Intronic
1041630635 8:60083136-60083158 ATGCACTGTTCCTCATGGAATGG + Intergenic
1045832174 8:106475747-106475769 ATGCCTTCTTCCTCATTGTCTGG + Intronic
1048984452 8:139727341-139727363 ATGCCAACTTCCACTTTGAGGGG - Intergenic
1049306306 8:141906116-141906138 ATGCCATCTGCTTCCTGGTGGGG + Intergenic
1049887782 9:39774-39796 TTGCAAGCTGCCTCATGGAGGGG + Intergenic
1050240479 9:3629399-3629421 ATGTCATCTTTGTCATGAAGAGG + Intergenic
1056223384 9:84471525-84471547 ATGGTAACTTCCTCATGGGGAGG - Intergenic
1061711017 9:132487963-132487985 ATACCATTTTGCTCATGGGGGGG - Intronic
1187056674 X:15747282-15747304 ATTCCATCTCCCACATGGTGTGG - Intronic
1189339236 X:40192034-40192056 AGGCCAACTGCCTCAGGGAGAGG - Intergenic
1194301756 X:92195923-92195945 GTGCCAGTTTCCCCATGGAGAGG + Intronic
1194768909 X:97876679-97876701 TTGGCATCTTCCTCAGGGAAGGG - Intergenic
1198700060 X:139387143-139387165 CTGCCATATTCCTCATGTATTGG + Intergenic
1199910587 X:152282545-152282567 ATGGCACCTTCCTGATAGAGAGG - Intronic