ID: 1174296332

View in Genome Browser
Species Human (GRCh38)
Location 20:49547905-49547927
Sequence TGCCTATGCCATCTTCCTCA TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 242
Summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 216}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174296332_1174296335 0 Left 1174296332 20:49547905-49547927 CCATGAGGAAGATGGCATAGGCA 0: 1
1: 0
2: 0
3: 25
4: 216
Right 1174296335 20:49547928-49547950 TGGAAGTCGAGCCTGGTGCGAGG 0: 1
1: 0
2: 20
3: 364
4: 2624
1174296332_1174296340 30 Left 1174296332 20:49547905-49547927 CCATGAGGAAGATGGCATAGGCA 0: 1
1: 0
2: 0
3: 25
4: 216
Right 1174296340 20:49547958-49547980 ACCACCGCGTCGTAGGAGTGTGG 0: 1
1: 0
2: 0
3: 5
4: 259
1174296332_1174296334 -7 Left 1174296332 20:49547905-49547927 CCATGAGGAAGATGGCATAGGCA 0: 1
1: 0
2: 0
3: 25
4: 216
Right 1174296334 20:49547921-49547943 ATAGGCATGGAAGTCGAGCCTGG 0: 1
1: 0
2: 1
3: 7
4: 90
1174296332_1174296337 23 Left 1174296332 20:49547905-49547927 CCATGAGGAAGATGGCATAGGCA 0: 1
1: 0
2: 0
3: 25
4: 216
Right 1174296337 20:49547951-49547973 CTCCCACACCACCGCGTCGTAGG 0: 1
1: 0
2: 0
3: 1
4: 45

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174296332 Original CRISPR TGCCTATGCCATCTTCCTCA TGG (reversed) Exonic
903383669 1:22913359-22913381 TTGCTTTGCCATCTTCCTCCCGG + Intronic
903571407 1:24308427-24308449 TGCCCATGTCATCCCCCTCAGGG + Intergenic
904256093 1:29255839-29255861 TTCCTCTGCCCTCTTCCTCCTGG + Intronic
904320812 1:29696915-29696937 TGCCCATGCCAGCTTCACCACGG - Intergenic
904974246 1:34443548-34443570 TTTCTTTGCCATCTTCATCATGG + Intergenic
906183782 1:43844200-43844222 TGCCTATGTAATCCTCCACAGGG - Intronic
906668091 1:47635789-47635811 TGCCTTCCTCATCTTCCTCATGG + Intergenic
909108648 1:71446231-71446253 TGCCTATTACCTCTTCTTCATGG - Intronic
909398286 1:75195319-75195341 TGCCCATGCGCCCTTCCTCAAGG + Intergenic
911251751 1:95584433-95584455 TGGCTATGGTTTCTTCCTCAGGG + Intergenic
912050992 1:105527415-105527437 TGCCTCTGGCAACTGCCTCAGGG + Intergenic
915225216 1:154406411-154406433 TGCCTCTGCCCTCTCCCTCACGG - Intronic
916885489 1:169063798-169063820 TGTCTATTCCATCTTCCTGGAGG - Intergenic
917724838 1:177818511-177818533 TTCCCATCCCCTCTTCCTCATGG - Intergenic
918396308 1:184116655-184116677 TGCCTTTGCCACCTTCCCCAAGG + Intergenic
918689745 1:187465885-187465907 TGCTTATGCCAACTTCCTATGGG + Intergenic
919880898 1:201899860-201899882 TGCCATTGCCATCATGCTCAAGG - Exonic
919913012 1:202123350-202123372 TGCCTATGCCATCATGCTTCTGG + Exonic
920147456 1:203874175-203874197 TGCCTCTACCATGTTCATCAGGG - Intergenic
920613294 1:207463964-207463986 TGACTTACCCATCTTCCTCATGG + Intronic
922888968 1:229046039-229046061 TTCCTCTTTCATCTTCCTCATGG + Intergenic
923216481 1:231852745-231852767 TGCCAATTCCATCTTCCATATGG + Intronic
1063192034 10:3704558-3704580 TGCCTTTTCCTTCTTCCTCAAGG - Intergenic
1065034275 10:21621645-21621667 TGCCCCTGCCATCTCCCTCGTGG - Intronic
1065899881 10:30196840-30196862 TGCTTTTGGCATCTTCATCATGG - Intergenic
1068157867 10:53224013-53224035 TGCCTCAGCCCTCTCCCTCAGGG + Intergenic
1071260612 10:83915920-83915942 TACCTATTGCATCTTCCTCTGGG - Intergenic
1072258210 10:93641258-93641280 TGCCTCTGCCTTCTTCCTATAGG + Intronic
1073608213 10:104916828-104916850 TGCCAGTGCTTTCTTCCTCAAGG + Intronic
1074713643 10:116198660-116198682 TTCCTTTTCTATCTTCCTCAGGG + Intronic
1078316963 11:10302554-10302576 TGCCTATGCCAGCAACCTCTTGG - Intergenic
1078909560 11:15718208-15718230 TGCCTGTGCCATCTGCTTCTTGG - Intergenic
1079562698 11:21842601-21842623 TTCCAATGCCACCTACCTCAAGG + Intergenic
1081466810 11:43327162-43327184 TGCGTGTGCCATTTCCCTCATGG + Intronic
1081877055 11:46415757-46415779 TGCTAATGCCATCTTACTCAGGG + Intronic
1084036488 11:66514507-66514529 TGCTGCTGCCACCTTCCTCATGG + Exonic
1084798964 11:71528565-71528587 GGCCTCTGCCATCTTCCTTTGGG + Exonic
1088858212 11:113775499-113775521 TGCCATTTGCATCTTCCTCAGGG - Intergenic
1089329603 11:117680356-117680378 TCCCTGTGCCATGTCCCTCAGGG - Intronic
1089554416 11:119308210-119308232 TGCCAAGGCCCCCTTCCTCATGG + Intergenic
1090570425 11:128038763-128038785 AGCCTATTCCATCTTCCCTATGG + Intergenic
1094191245 12:27700467-27700489 TTCCTATTCCAGGTTCCTCAAGG - Intergenic
1097891804 12:64784136-64784158 AGCCTTTGCCCTCTTCTTCATGG + Intronic
1098038386 12:66329676-66329698 TGCCCAATCCATCATCCTCATGG - Intronic
1101877170 12:108603537-108603559 GGCCTCTGCCAGCGTCCTCAGGG - Intergenic
1102011229 12:109619800-109619822 CCACTCTGCCATCTTCCTCATGG - Intergenic
1103053728 12:117802458-117802480 TGCCCATGCCCTCATCCCCAGGG - Intronic
1103936186 12:124478179-124478201 TGGCTCTGCCATCTTTCACAGGG - Intronic
1105210749 13:18255445-18255467 AGCCTATACCACCTGCCTCAGGG - Intergenic
1106229108 13:27808098-27808120 TGCCTATCCCAGCTTCCTCGGGG - Intergenic
1106528054 13:30560801-30560823 TGACTTTGCCATCTCCTTCATGG - Intronic
1112082006 13:95982129-95982151 TGAGTATGCCAGCTTACTCAGGG - Intronic
1112092566 13:96097153-96097175 TGCTTCTGCCTTCTTCCTGATGG + Intronic
1112922915 13:104637349-104637371 TTCCTATGCCAGCTTCTTTATGG - Intergenic
1115675638 14:35670171-35670193 TTCTTCTGACATCTTCCTCATGG + Intronic
1116947418 14:50848705-50848727 TGCCTCTTCCATTTGCCTCATGG + Intergenic
1118461798 14:65993995-65994017 GTCCTCTGCCATCTTCCTCCAGG - Intronic
1119591390 14:75891327-75891349 TGACTCTGCCATCTACCTCCTGG + Intronic
1123739379 15:23220953-23220975 TGACTCTGACATCTTCCTCCAGG + Intergenic
1124161714 15:27276197-27276219 AGCCTGTGCCAGCTTCCTCAAGG - Intronic
1124290598 15:28449905-28449927 TGACTCTGACATCTTCCTCCAGG + Intergenic
1124292638 15:28467641-28467663 TGACTCTGGCATCTTCCTCCAGG - Intergenic
1124665704 15:31590270-31590292 AGGCTATGCCATCTACTTCATGG + Intronic
1127522011 15:59752392-59752414 TTCCTATGTCGTCTTCCTCCAGG - Intergenic
1130353801 15:83112392-83112414 TGACTCTGCCACCTCCCTCAGGG - Intronic
1132416509 15:101624005-101624027 GGCCGATCCCATCCTCCTCAAGG - Intronic
1136103782 16:28014201-28014223 TGCAAATGTCATCTTCCTCCAGG - Intronic
1136708149 16:32207736-32207758 TGACTCTGACATCTTCCTCTGGG - Intergenic
1136759759 16:32721674-32721696 TGACTCTGACATCTTCCTCTGGG + Intergenic
1136808345 16:33148712-33148734 TGACTCTGACATCTTCCTCTGGG - Intergenic
1137001175 16:35232457-35232479 TGCCTATGTCACCATGCTCAGGG - Intergenic
1137913523 16:52403597-52403619 TTCCTATTCCTTCTTCCACAGGG - Intergenic
1141256808 16:82409910-82409932 CTCCCATGACATCTTCCTCACGG + Intergenic
1141940652 16:87273863-87273885 TGCCAATGACAGCTTCCTCCAGG + Intronic
1203061913 16_KI270728v1_random:981981-982003 TGACTCTGACATCTTCCTCTGGG + Intergenic
1143016893 17:3895564-3895586 AGCCCCTGCCATCTCCCTCAGGG - Intergenic
1143410774 17:6707123-6707145 TGCCTACGTCATCATCCTCATGG - Exonic
1144194006 17:12873318-12873340 TGCCTATGCCCTCCTCCTCCAGG + Intronic
1144217577 17:13069940-13069962 CGCTTCTGCCATCTTTCTCATGG + Intergenic
1145900768 17:28489225-28489247 CGCGTATGCCATCATCCTCATGG + Exonic
1145904958 17:28511202-28511224 TCCCAATGCCATCTTGCACAGGG - Intronic
1147993655 17:44350028-44350050 TCCCCATGCCATCTTGCTGAGGG + Intronic
1148102192 17:45099074-45099096 TGCCTCTGCCATCATCTTCTGGG + Intronic
1148870371 17:50655754-50655776 CAGCTAAGCCATCTTCCTCAAGG + Intronic
1150535368 17:66033574-66033596 TGCCTAAAGCATCTTCCTCCAGG + Intronic
1151290187 17:73144236-73144258 AGACTAATCCATCTTCCTCAAGG - Intergenic
1152403540 17:80083450-80083472 TGCCTACCCCAGCCTCCTCAGGG - Intronic
1153977224 18:10280194-10280216 TGCCTCTTCTCTCTTCCTCAAGG - Intergenic
1155268898 18:24120422-24120444 TGCCCATGCCCTCTAGCTCACGG - Intronic
1159424430 18:68266749-68266771 AGCCTATGCTAACTTTCTCAGGG - Intergenic
1160422741 18:78758733-78758755 TACCTATGCCCTTTTCCTCCTGG - Intergenic
1164744620 19:30601933-30601955 TGCCTTTGCCATGTGGCTCAAGG + Intronic
1167324894 19:48818384-48818406 AGCCTCTGCCCTCCTCCTCAGGG + Intronic
924967089 2:87949-87971 TGCCTCTGACATCTTTCTGACGG + Intergenic
925266609 2:2570685-2570707 TGCCCACGGCATCTGCCTCAGGG - Intergenic
926862164 2:17321085-17321107 TGCCTCTGCCTCCTTCCACACGG + Intergenic
926933005 2:18059265-18059287 TGCCTAAACCATCTTCATAAAGG + Intronic
928441262 2:31294171-31294193 TCAATATGCCATCTTTCTCATGG + Intergenic
928581761 2:32715114-32715136 TGCTTTTGGCATCTTCATCATGG + Intronic
931258732 2:60598319-60598341 TGCTTCTGCCATCCTCTTCATGG - Intergenic
932457784 2:71860589-71860611 AGCCTAGGTCACCTTCCTCAAGG + Intergenic
932505079 2:72221392-72221414 CGCCTATTTCATCTCCCTCAAGG + Intronic
936493314 2:112994796-112994818 TTGCTCTGCCATCTTGCTCAAGG - Intergenic
936605333 2:113946726-113946748 TGCTTTTGCCATCTTCATCATGG + Intronic
937467780 2:122149765-122149787 TGCCTATACCATTTTACACACGG - Intergenic
937750603 2:125472333-125472355 TCCCTCTCCCATATTCCTCAAGG - Intergenic
938607971 2:132915853-132915875 TCCCTAAGCCATCTGCCTCTGGG - Intronic
940046632 2:149416715-149416737 GGCCCATGCCATCTTCCTATTGG + Intronic
940321423 2:152381379-152381401 TGCCTGTGCCCTCTTCCAGAAGG + Intronic
940579214 2:155555711-155555733 TGCATATGACATATTCATCAGGG + Intergenic
940957168 2:159740568-159740590 TTCATATGCCATCATCATCAAGG - Intronic
946213775 2:218167749-218167771 GGCCTATGCCGTCAGCCTCAGGG - Intergenic
948209377 2:236181089-236181111 TACCTATTCAATCTTCCGCAGGG + Intergenic
948862852 2:240761264-240761286 GGGCAACGCCATCTTCCTCAAGG - Exonic
1169179822 20:3553941-3553963 TGCCTTTGCCAAGTTCTTCAAGG + Intronic
1169622475 20:7523490-7523512 TGCCTAGGCCTTTTTCTTCAAGG - Intergenic
1171078691 20:22155687-22155709 TTCCTTTCCCATCTTACTCATGG - Intergenic
1171291891 20:23987134-23987156 AGCCTATACCACCTGCCTCAGGG - Intronic
1171949260 20:31406246-31406268 TGGCTCTGCCATGCTCCTCAAGG - Exonic
1172114532 20:32565649-32565671 TTCTTGTTCCATCTTCCTCATGG + Intronic
1173722416 20:45271100-45271122 TGCCTATGGAACCTGCCTCAAGG + Intergenic
1174296332 20:49547905-49547927 TGCCTATGCCATCTTCCTCATGG - Exonic
1174532727 20:51226953-51226975 GGCTTATGCAATCTTCCACAGGG - Intergenic
1174583684 20:51591364-51591386 TTCCAATGCCATCAGCCTCATGG + Intergenic
1175164909 20:57036535-57036557 TGCCTATGTCTTCAGCCTCATGG + Intergenic
1175390461 20:58624173-58624195 TCCCTTTCCCATCGTCCTCAAGG - Intergenic
1175922733 20:62457618-62457640 TGCCTTTGTCATTTTCCTCCGGG + Intergenic
1179441329 21:41396561-41396583 TGCCTTTCCCATCTTCTCCAGGG + Intronic
1180765506 22:18343972-18343994 AGCCTATACCACCTGCCTCAGGG + Intergenic
1180780811 22:18518420-18518442 AGCCTATGCCACCTGCCTCAGGG - Intergenic
1180813524 22:18775727-18775749 AGCCTATGCCACCTGCCTCAGGG - Intergenic
1181199708 22:21210057-21210079 AGCCTATACCACCTGCCTCAGGG - Intronic
1181400054 22:22645801-22645823 AGCCTATACCACCTGCCTCAGGG + Intronic
1181649310 22:24249989-24250011 AGCCTATACCACCTGCCTCAGGG - Intergenic
1181702028 22:24626899-24626921 AGCCTATACCACCTGCCTCAGGG + Intronic
1182937618 22:34240661-34240683 TGGCTATGCCATATACCTAATGG - Intergenic
1183262484 22:36804534-36804556 TGCCTTTCCTATCTGCCTCAGGG + Intronic
1185341130 22:50291650-50291672 TGCCTCTGAGCTCTTCCTCAGGG + Intronic
1203227127 22_KI270731v1_random:84862-84884 AGCCTATGCCACCTGCCTCAGGG + Intergenic
1203263624 22_KI270734v1_random:1409-1431 AGCCTATACCACCTGCCTCAGGG - Intergenic
949308938 3:2673950-2673972 TGCCTCTGTCCTCTTCCACATGG - Intronic
950010268 3:9718081-9718103 CGCCTATGCCATGGCCCTCAAGG + Exonic
952037300 3:29217990-29218012 TGCCTTTGCTGTCTTTCTCAGGG - Intergenic
952698709 3:36302656-36302678 AGCCTTTGCCTTCTTCCCCATGG - Intergenic
952814659 3:37436688-37436710 TGCCTGGGCCTTCTTCCTCTTGG + Intergenic
952925842 3:38318624-38318646 TGTCTAACCCATCTTCCTCCAGG - Intergenic
954449240 3:50562833-50562855 TGCCTAGGCCCTCATCTTCAAGG - Intronic
956623702 3:71246348-71246370 TGCCTGTGCCCTTTTGCTCATGG - Intronic
957328903 3:78734194-78734216 TGCCTATGCTGCCTTCCACATGG - Intronic
958582757 3:96047366-96047388 TCCCTATGCCATCATCTTGAGGG - Intergenic
962254710 3:133862439-133862461 TTCCTATAGCATCATCCTCAGGG - Intronic
962631930 3:137285553-137285575 TGCGTTTGCCATCTTACTGAGGG + Intergenic
962902870 3:139776213-139776235 TACCTTTGCCATCCTCCTCTGGG - Intergenic
963915826 3:150858127-150858149 AGCCCATGCCATCGCCCTCACGG + Intergenic
964158242 3:153612922-153612944 TGCCAATGTCATCTTCATAAAGG - Intergenic
965881597 3:173395271-173395293 TGCCTTTGGCCTCTTCCTCCTGG - Intergenic
967236756 3:187392581-187392603 TTCCCATTCCAGCTTCCTCATGG - Intergenic
967596441 3:191330204-191330226 TGACTTTCCCACCTTCCTCAAGG + Intronic
969093934 4:4718261-4718283 TGAATATCCCAACTTCCTCATGG + Intergenic
969134857 4:5021328-5021350 TCCCTATGTCATCTTGCTAAAGG - Intergenic
977051265 4:92130613-92130635 TGCCTTTGCCATCCTCTTCCAGG - Intergenic
978337731 4:107687895-107687917 AGCATTTGCCATCTTCCTTATGG + Intronic
979353716 4:119676807-119676829 ACCCTATGTCACCTTCCTCAAGG - Intergenic
980521104 4:133935411-133935433 TGCCTATACCTACCTCCTCAGGG + Intergenic
982791664 4:159599245-159599267 TGCCCATCCCATTTTCCCCATGG + Intergenic
983100099 4:163614935-163614957 TCCCCATGCCACCTTCCTCAGGG - Intronic
985750684 5:1672548-1672570 TGCATCTGCCTTCTTCCCCAGGG + Intergenic
985932764 5:3071985-3072007 TGCTTTTGGCATCTTCGTCATGG + Intergenic
986729269 5:10623329-10623351 TGTCCCTGCCATCTTCCTTAAGG + Intronic
989187128 5:38636390-38636412 TGGCTATGCCATCTTGCCAAGGG + Intergenic
989405086 5:41051360-41051382 GGCCTTTGCCATTTTCTTCAGGG + Intronic
990000103 5:50882794-50882816 TGCCACTGCCATGTTCTTCAGGG + Intergenic
990775105 5:59297850-59297872 TGTCTATGCCATTCTTCTCAAGG - Intronic
991900576 5:71455868-71455890 TGCCTCCGCCATGTTCCGCAGGG + Exonic
991991941 5:72348101-72348123 AGCCTATGTCATCTTCCTCGGGG + Intronic
993971037 5:94420163-94420185 TTCATCTCCCATCTTCCTCATGG - Intronic
994585622 5:101705612-101705634 TGCCTTTGTCATCTTCGTCATGG + Intergenic
997639031 5:135436521-135436543 TGCCCCTCCAATCTTCCTCAGGG - Intergenic
998042544 5:138961416-138961438 TGCCTCTGCCTTCTCTCTCAAGG - Intronic
998757302 5:145394928-145394950 TGTCTTTGCCATCATCATCATGG + Intergenic
998988080 5:147783882-147783904 TGTCTTTGCCATCATCATCATGG - Intergenic
1000105036 5:158051629-158051651 TCCTTATTCCATGTTCCTCAAGG + Intergenic
1006779210 6:36620744-36620766 TGGGTATGCCACCTTCCCCATGG - Intergenic
1007092331 6:39191903-39191925 GGACTATCCCATCTTCCTCAAGG + Intronic
1007367302 6:41403933-41403955 TGGGTAGGCCATTTTCCTCATGG - Intergenic
1009044265 6:58218706-58218728 TGCCTATTCCTTCTTCCTAAAGG - Intergenic
1009220091 6:60972971-60972993 TGCCTATTCCTTCTTGCTAAAGG - Intergenic
1009462507 6:63931345-63931367 TACCTATAGCTTCTTCCTCAAGG + Intronic
1011414745 6:87106468-87106490 TGGCTATGCCATCTTCAACATGG - Intergenic
1013290779 6:108717234-108717256 TTCCTATGCAGTCTTCCTCGAGG - Intergenic
1013981911 6:116140572-116140594 CCCCTATGCCATCTCCCTGATGG + Intronic
1014104325 6:117545944-117545966 TTCCTATCTCACCTTCCTCAGGG - Intronic
1014462511 6:121713759-121713781 TGCCTATGCCATATCCTTCCAGG - Intergenic
1016793332 6:148089862-148089884 TGCCTCTGCTTTTTTCCTCAGGG - Intergenic
1020508149 7:9019351-9019373 AGCCCATGCCATCACCCTCATGG + Intergenic
1021809175 7:24386680-24386702 TCCCTGTGCCATCTTTCTCAGGG + Intergenic
1021943120 7:25699447-25699469 TGCCTCTGCCATCTTCAACAGGG + Intergenic
1024131472 7:46356998-46357020 TGCCGATGCCAACTTCCTCTAGG - Intergenic
1026424102 7:70272573-70272595 TGCCTAAGCCAAATTACTCAGGG + Intronic
1027619234 7:80462516-80462538 TGCCTATGACATGGTCCTCGTGG - Exonic
1028900001 7:96087211-96087233 TTCGTATGCCCACTTCCTCAAGG - Intronic
1032173449 7:129605145-129605167 TGGCAATGTCATCTACCTCAAGG - Intergenic
1033954326 7:146826101-146826123 TCTCCATGCCATCTGCCTCAGGG - Intronic
1036203853 8:6791250-6791272 TGCCTTGGCCTTCATCCTCAGGG - Intergenic
1037260968 8:17007829-17007851 TGCTTTTGGCATCTTCATCATGG - Intergenic
1039922316 8:41902128-41902150 TGACAATGGCATCTGCCTCATGG - Intergenic
1040603679 8:48909569-48909591 TGGCTGTGCCATCTTCCCCCAGG + Intergenic
1042030458 8:64470422-64470444 TGCCTCTGCCTTTTTCTTCAGGG - Intergenic
1042166797 8:65953398-65953420 TGCCTATGCCACTCTCCTTAGGG - Intergenic
1043334592 8:79159214-79159236 TCCCTCTCTCATCTTCCTCATGG + Intergenic
1046971853 8:120231594-120231616 TTCCTATGACTTCTTCCTCAGGG - Exonic
1048767693 8:137862706-137862728 TGCCTCTGCCACCTTGCTTATGG + Intergenic
1048928558 8:139292326-139292348 TCCCTATCTCATCTACCTCAAGG + Intergenic
1050078175 9:1887164-1887186 TGGAGATGCCATCATCCTCATGG - Intergenic
1050127857 9:2378144-2378166 TGACTATGCTTTATTCCTCAGGG + Intergenic
1050734025 9:8742868-8742890 TGACTTTGCCCTCTCCCTCAGGG + Intronic
1052211501 9:25909546-25909568 TGCCTAATGCATTTTCCTCATGG + Intergenic
1055351081 9:75389057-75389079 AGACCATGCCACCTTCCTCAAGG - Intergenic
1056315857 9:85389172-85389194 TGCCTATGTCACTCTCCTCAAGG - Intergenic
1056435686 9:86573970-86573992 TGGATATGACATCTGCCTCAAGG - Intergenic
1056694426 9:88834084-88834106 TGCTTATGTCATCTCCCTCCAGG + Intergenic
1056947265 9:91009012-91009034 TTCTTATGCCTTCTTACTCAGGG + Intergenic
1058098192 9:100887375-100887397 TTCCTATGCCATGGTCATCATGG - Intergenic
1058717010 9:107731522-107731544 TGCTTATGCCAGTTTCCTGATGG + Intergenic
1061397770 9:130352862-130352884 GGCCTCTGGCATCTTCCCCAGGG - Intronic
1061770955 9:132920905-132920927 TGACTATACCATCCTCCCCAGGG - Intronic
1062094153 9:134694470-134694492 TCCCTAGGCCACCCTCCTCAGGG + Intronic
1062412014 9:136430413-136430435 TGCCTCTGCAATCTTCCCAAAGG - Exonic
1062514499 9:136925853-136925875 GGACGATGCCATCTTCATCAAGG + Exonic
1186943202 X:14535342-14535364 TGTCTATTCCATATTCCTGATGG + Intronic
1188163610 X:26833237-26833259 TGACTATGCCTTCTTACACAAGG - Intergenic
1192286980 X:69748621-69748643 ATGCTATGCCATCTTCCTAAAGG - Intronic
1194071312 X:89329191-89329213 TGCCCATGCCACTTTCCTCTGGG + Intergenic
1194310952 X:92305722-92305744 TGCATATGCCAGCTTCCTCTAGG - Intronic
1194768911 X:97876684-97876706 TACATTTGGCATCTTCCTCAGGG - Intergenic
1195142246 X:101973600-101973622 TGCTTTTGGCATCTTCATCATGG + Intergenic
1197454024 X:126654904-126654926 TGACTATGCCATCATAGTCATGG - Intergenic
1198169891 X:134095236-134095258 AGGCAATGCCATGTTCCTCAAGG + Intergenic
1198302084 X:135343221-135343243 TTTATCTGCCATCTTCCTCAAGG - Exonic
1200619227 Y:5419997-5420019 TGCATATGCCAGCTTCCTCTAGG - Intronic
1200725543 Y:6664929-6664951 TGCCCATGCCACTTTCCTCTGGG + Intergenic
1201685483 Y:16697281-16697303 TGCCTCAGCCTTCTTTCTCAGGG - Intergenic