ID: 1174296337

View in Genome Browser
Species Human (GRCh38)
Location 20:49547951-49547973
Sequence CTCCCACACCACCGCGTCGT AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 47
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 45}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174296330_1174296337 28 Left 1174296330 20:49547900-49547922 CCTCTCCATGAGGAAGATGGCAT 0: 1
1: 0
2: 1
3: 14
4: 161
Right 1174296337 20:49547951-49547973 CTCCCACACCACCGCGTCGTAGG 0: 1
1: 0
2: 0
3: 1
4: 45
1174296332_1174296337 23 Left 1174296332 20:49547905-49547927 CCATGAGGAAGATGGCATAGGCA 0: 1
1: 0
2: 0
3: 25
4: 216
Right 1174296337 20:49547951-49547973 CTCCCACACCACCGCGTCGTAGG 0: 1
1: 0
2: 0
3: 1
4: 45

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174296337 Original CRISPR CTCCCACACCACCGCGTCGT AGG Exonic
919141965 1:193583613-193583635 CTCCCACAATTCCGTGTCGTGGG - Intergenic
1070841762 10:79492318-79492340 GTCTCACACCACCGGGTCCTGGG + Intergenic
1081693414 11:45093647-45093669 CTCCCACACCGCCGCTTCTGTGG - Intergenic
1082559873 11:54605686-54605708 CCCCCACCCCACCAAGTCGTGGG + Intergenic
1083872364 11:65497010-65497032 CTCCCTCACCCCCGGGTCTTTGG - Intergenic
1089695485 11:120213565-120213587 CTCCAACTCCACCCCGTCCTAGG - Intronic
1096461274 12:51822329-51822351 CTCCTCCACCACCCCGTCGCCGG - Intergenic
1132573983 16:656426-656448 CTCCCACACCGCCCCGGTGTTGG + Exonic
1134512333 16:14858669-14858691 CTCACACCCCACCGGGGCGTAGG + Intronic
1135587026 16:23679254-23679276 CTCGCCCACCAGCACGTCGTAGG + Exonic
1135607259 16:23835740-23835762 CCCCCACCCCACCCCGTCCTCGG - Intergenic
1140720176 16:77764514-77764536 CTCCCAAAACACCACGTCATGGG + Intergenic
1141694674 16:85613842-85613864 CCCCCACACCCCCGCTTCCTCGG - Intronic
1143448757 17:7023416-7023438 GTTCCACACCGCGGCGTCGTTGG - Intronic
1144892429 17:18501589-18501611 CGCCCACACCACGGCCTCCTTGG + Intergenic
1145139785 17:20442699-20442721 CGCCCACACCACGGCCTCCTTGG - Intergenic
1145796075 17:27655979-27656001 CGCCCACACCACGGCCTCCTTGG + Intergenic
1147741103 17:42671350-42671372 CTCCCACACCACGGCGGGGGAGG - Exonic
1148323835 17:46772067-46772089 TCCCCACACCACCGCCGCGTGGG - Intronic
1151612144 17:75183083-75183105 GTCCCACGCCACCGCGTCCTGGG + Intergenic
1152503413 17:80729024-80729046 CCCCCACACATCTGCGTCGTTGG + Intronic
1152865836 17:82722454-82722476 CCCCCACACCCCCGCGTGTTGGG + Intronic
1160885874 19:1347628-1347650 CTCCCACAACACGGAATCGTGGG + Intergenic
1161081554 19:2312979-2313001 CTCCCACCCCACCGCCTGGGAGG + Intronic
1163158527 19:15451844-15451866 CTCCAAGACCCCCGCGTCCTTGG + Exonic
1163369082 19:16892133-16892155 CTCAGACACCAGTGCGTCGTGGG - Exonic
1168224820 19:54987137-54987159 CCCCCACCCCACCCCGCCGTCGG + Intronic
932385919 2:71332268-71332290 TTCCCTCACCACCGCTTCCTCGG - Intronic
933654978 2:84879997-84880019 CCCCCCCACCCCCGCGTCGCGGG + Intronic
947384270 2:229575634-229575656 CTCCAACACCACCGCAGCCTGGG + Intronic
948681066 2:239635003-239635025 CTCCCACACCTGTCCGTCGTTGG + Intergenic
1169074381 20:2752176-2752198 CACCCACACCCCGCCGTCGTGGG + Exonic
1174296337 20:49547951-49547973 CTCCCACACCACCGCGTCGTAGG + Exonic
1175336050 20:58197082-58197104 CTCCCACTCCACCCCGTCACCGG + Intergenic
1176809322 21:13520807-13520829 CTCCCAGACCAGCACATCGTTGG + Intergenic
1179646629 21:42779927-42779949 CTCCCTCACCACCGAGTCCCTGG + Intergenic
1184219497 22:43090306-43090328 CTCCCACACAACCGCCTCCCAGG + Intergenic
956662875 3:71616639-71616661 TTCACACACCACCGCCTCTTTGG + Intergenic
982019502 4:151189488-151189510 CTCCCACAATTCCGTGTCGTGGG + Intronic
987310083 5:16673681-16673703 CTCCCACACCACCGCTGGGGAGG - Exonic
1008382417 6:50849964-50849986 CCCACACCCCACCCCGTCGTGGG - Intergenic
1024247192 7:47479481-47479503 CTCCCCCACCCCCCCGTCGGCGG + Intronic
1036609696 8:10339201-10339223 CTCCAACATCATCGCTTCGTGGG - Intronic
1041383880 8:57279180-57279202 CTCCGAGAGCTCCGCGTCGTGGG - Intergenic
1199772287 X:150982939-150982961 CTCCCACCGCACCGCGGCCTTGG - Intronic
1200107855 X:153724654-153724676 CTCCCGCACCACAGAGACGTGGG - Intronic
1200279362 X:154763256-154763278 GTCCCACGCCACCGCGGGGTGGG - Intronic