ID: 1174296813

View in Genome Browser
Species Human (GRCh38)
Location 20:49551243-49551265
Sequence TTCAGGCCGTGGTGGGAAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 916
Summary {0: 1, 1: 5, 2: 102, 3: 277, 4: 531}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174296805_1174296813 20 Left 1174296805 20:49551200-49551222 CCGTCTCAAAAAAAATAAAATAA 0: 317
1: 1255
2: 95680
3: 82706
4: 97831
Right 1174296813 20:49551243-49551265 TTCAGGCCGTGGTGGGAAGTGGG 0: 1
1: 5
2: 102
3: 277
4: 531
1174296808_1174296813 -10 Left 1174296808 20:49551230-49551252 CCTGAAAGACTGGTTCAGGCCGT 0: 3
1: 75
2: 146
3: 381
4: 517
Right 1174296813 20:49551243-49551265 TTCAGGCCGTGGTGGGAAGTGGG 0: 1
1: 5
2: 102
3: 277
4: 531

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174296813 Original CRISPR TTCAGGCCGTGGTGGGAAGT GGG Intronic
900434285 1:2620901-2620923 TTCAGGCCATGATGGGAAGTGGG + Intronic
900721108 1:4176306-4176328 TTCAGGCCATGATGGGAAGTGGG + Intergenic
901056290 1:6450050-6450072 TGCAGGCTGTGGAGGGAAGAAGG - Intronic
902429712 1:16353339-16353361 TTCAGGCCATGACGGGAAGCAGG + Intronic
903054772 1:20627986-20628008 TTCAGGCCATGATAGGAAGGGGG + Intergenic
903206987 1:21789867-21789889 TTCAGGCCTTGACAGGAAGTGGG + Intergenic
903519220 1:23934802-23934824 TTCAGGCCATGATGGGAAGGGGG - Intergenic
904471719 1:30740411-30740433 TGCGGGGCGTGGTGGGGAGTGGG - Intronic
904712139 1:32438221-32438243 TTCAGGCCATGATGAGAAGTGGG + Intergenic
905799448 1:40834051-40834073 TTCAGACTGTGGGGGGTAGTGGG - Intronic
906508981 1:46400517-46400539 TGCAGGTGGTGGTGGGAAGGAGG + Intronic
908215695 1:61949352-61949374 TTTGGGGGGTGGTGGGAAGTGGG + Intronic
908239524 1:62177020-62177042 TTCAGGCCATCATGGGAAGAGGG + Intergenic
909014210 1:70365681-70365703 TTGAGGCCATGATGAGAAGTGGG + Intronic
909201290 1:72693039-72693061 TTCAGGCTGCGGGAGGAAGTGGG + Intergenic
909443253 1:75721155-75721177 TTCAGGCCATGATGGGAAGTGGG - Intergenic
909474176 1:76063416-76063438 TGCAGGCCATGATGGGAAGAGGG - Intergenic
911407613 1:97462501-97462523 TTCAGACCATGATGGGAAGGTGG + Intronic
912388609 1:109285830-109285852 TTCAGGCCATAATGGAAAGTGGG + Intergenic
912506232 1:110158420-110158442 TCCAGGGCGTTGTGGGATGTGGG + Intronic
912629903 1:111237797-111237819 TTCAGGTCATGATGGGAAGTTGG + Intronic
912940254 1:114038513-114038535 TTCAGGCCATGATGGGAGGTGGG + Intergenic
913051137 1:115117502-115117524 TTTAGGCCATGGTAGGAAGGGGG + Intergenic
913293514 1:117296980-117297002 TAAAAGCCGTGGTGGGAACTTGG - Intergenic
913652644 1:120933081-120933103 TTCAGACCATGATGGGAAGTAGG + Intergenic
913669100 1:121078621-121078643 TTCAGGCCATGATGGGAAGGGGG + Intergenic
913829957 1:123225580-123225602 TTGAGGCCTTCGTTGGAAGTGGG + Intergenic
913860140 1:123767008-123767030 TTGAGGCCTTGGTTGGAAATGGG + Intergenic
914020845 1:143866026-143866048 TTCAGGCCATGATGGGAAGGGGG + Intergenic
914080950 1:144411140-144411162 TTCAGACCATGATGGGAAGTAGG - Intergenic
914168455 1:145195968-145195990 TTCAGACCATGATGGGAAGTAGG - Intergenic
914175865 1:145279671-145279693 TTCAGACCATGATGGGAAGTAGG - Intergenic
914530584 1:148521156-148521178 TTCAGACCATGATGGGAAGTAGG - Intergenic
914642828 1:149627202-149627224 TTCAGACCATGATGGGAAGTAGG + Intergenic
914659343 1:149773968-149773990 TTCAGGCCATGATGGGAAGGGGG + Intergenic
915074262 1:153295875-153295897 TTCAGGCCATGTTGGGAAGTGGG + Intergenic
916226827 1:162497316-162497338 TTCAGTCCATGACGGGAAGTGGG - Intronic
917001574 1:170367146-170367168 TCCAGGCAGTGGTGTGATGTGGG + Intergenic
917257034 1:173126655-173126677 TTCTGGCCATGATGGGAAGGGGG - Intergenic
917458407 1:175205660-175205682 TTCAGGCCTTAATGGGAAGGAGG - Intergenic
917995469 1:180434113-180434135 TTCAGGCCATGATGGGAAGTCGG + Intronic
918460755 1:184774267-184774289 TTCAGGCCATGATGGAAAGTGGG + Intergenic
918542497 1:185647880-185647902 TTCAGGCCATGACAGGAAGTGGG - Intergenic
918767764 1:188510991-188511013 TTCAGCTCATGGTGGGAAGTTGG + Intergenic
919190738 1:194214892-194214914 TTCAGGCCATGATGGGAAGGGGG - Intergenic
919358730 1:196562394-196562416 TTCAGGCCATGATGGTAAGGAGG - Intronic
919596549 1:199570795-199570817 TTCAGGCCATGACAGGAAGTGGG + Intergenic
919849905 1:201665596-201665618 CTCAGGAGGTGGTGGGCAGTGGG - Intronic
920415033 1:205793431-205793453 TGCAGCACGTGGTGGGAAGATGG - Intronic
920940001 1:210473363-210473385 TTCAGGCCATCATGGGAAGAAGG - Intronic
921776072 1:219101674-219101696 TTCAGGCCATGATGGGAAGGGGG + Intergenic
922015201 1:221638085-221638107 TTCAGGCAGAGGAGGGAAGCAGG - Intergenic
922075200 1:222236737-222236759 TTCAGGCCATGGTGGGAAGTGGG - Intergenic
922076048 1:222245738-222245760 TTCAGGCCATGATGGAAAGTGGG - Intergenic
922276396 1:224082818-224082840 TTTGGGCCATGATGGGAAGTTGG + Intergenic
922314952 1:224434396-224434418 GAGAGGCCGTGGTGGGAAGCCGG + Intronic
922914848 1:229248936-229248958 TCCAGGCAGTGGTAAGAAGTAGG + Intergenic
922979953 1:229817172-229817194 TTCAGGCCATGATGGGAAGTGGG + Intergenic
923175889 1:231464601-231464623 TTCAGGCCATGATGGGAAGGGGG - Intergenic
923328794 1:232903530-232903552 TTCAGGCCATGATGGGCAGTGGG - Intergenic
923882352 1:238117332-238117354 TTCAGGCCATGATGGGAAGTGGG + Intergenic
924272608 1:242349388-242349410 TTCAGGCCATGATGAGAAGTGGG - Intronic
924769511 1:247066654-247066676 TTCAGGCCACGATGGGAAGAGGG + Intronic
1062771174 10:102705-102727 TTCAGGCCGTGGAGGGAAGTGGG + Intergenic
1062953239 10:1521494-1521516 TTGAGGCAATGTTGGGAAGTCGG + Intronic
1063107052 10:3001489-3001511 TTCAGGTCATGAGGGGAAGTGGG - Intergenic
1063622087 10:7658926-7658948 TTCAGACCGTCACGGGAAGTGGG - Intronic
1063684085 10:8219788-8219810 GTCAGCCCCTGGTGGGAAGAAGG + Intergenic
1063848523 10:10159745-10159767 TCCTGGCCATGATGGGAAGTGGG - Intergenic
1064658990 10:17586953-17586975 TTCAGGCCATGACAGGAAGTGGG + Intergenic
1065006690 10:21386947-21386969 TTCAGGCCATGATGGGAAGGGGG + Intergenic
1065209898 10:23392957-23392979 TTCAGGCCATGATGGGAAGCAGG - Intergenic
1066102635 10:32131581-32131603 TTCAGGCCATGACAGGAAGTGGG + Intergenic
1066163698 10:32762213-32762235 TTCAGGGAGTGGAGGGAACTTGG + Intronic
1066192893 10:33072001-33072023 TTCAAGCTGTGATGGGAAGAGGG + Intergenic
1066290667 10:34011760-34011782 TTCAGGCCATTATGGGAAGTGGG + Intergenic
1066827789 10:39627266-39627288 TTGAGGCCTTCGTAGGAAGTGGG + Intergenic
1066844498 10:39984331-39984353 TTGAGGCCTTCGTTGGAAGTGGG + Intergenic
1066848788 10:40068858-40068880 TTGAGGCCTTCGTTGGAAGTGGG + Intergenic
1066850262 10:40098055-40098077 TTGAGGCCTTCGTGGGAAGCGGG + Intergenic
1066850616 10:40105184-40105206 TTGAGGCCTTCGTTGGAAGTGGG + Intergenic
1066859365 10:40278715-40278737 TTGAGGCCTTCGTTGGAAGTGGG + Intergenic
1066860548 10:40302140-40302162 TTGAGGCCTTCGTAGGAAGTGGG + Intergenic
1066861738 10:40325903-40325925 TTGAGGCCTTCGTTGGAAGTGGG + Intergenic
1066868244 10:40455606-40455628 TTGAGGCCTTCGTTGGAAGTGGG + Intergenic
1066870850 10:40506967-40506989 TTGAGGCCTTCGTTGGAAGTGGG + Intergenic
1066876439 10:40617966-40617988 TTGAGGCCTTCGTTGGAAGTGGG + Intergenic
1066887468 10:40835639-40835661 TTGAGGCCTTCGTTGGAAGTGGG + Intergenic
1066890678 10:40898770-40898792 TTGAGGCCTTCGTTGGAAGTGGG + Intergenic
1066891968 10:40924575-40924597 TTGAGGCCTTCGTTGGAAGTGGG + Intergenic
1066893651 10:40957662-40957684 TTGAGGCCTTCGTTGGAAGTGGG + Intergenic
1066898575 10:41055131-41055153 TTGAGGCCTTCGTTGGAAGTGGG + Intergenic
1066906530 10:41211352-41211374 TTGAGGCCTTCGTTGGAAGTGGG + Intergenic
1066909331 10:41266388-41266410 TTGAGGCCTTCGTTGGAAGTGGG + Intergenic
1066910575 10:41290849-41290871 TTGAGGCCTTCGTTGGAAGTGGG + Intergenic
1066917630 10:41429097-41429119 TTGAGGCCTTCGTTGGAAGTGGG + Intergenic
1066918215 10:41440654-41440676 TTGAGGCCTTCGTTGGAAGTGGG + Intergenic
1067016734 10:42762086-42762108 TGCAGTCGGTGGGGGGAAGTGGG - Intergenic
1067266048 10:44746183-44746205 TTCAGACCATGACGGGAAGTGGG - Intergenic
1067521736 10:47012914-47012936 TTCTGCCCATGATGGGAAGTGGG + Intergenic
1067538403 10:47134227-47134249 TTCAGGCCATGACTGGAAGTGGG - Intergenic
1067566939 10:47346298-47346320 CCCAGGCCGTGGGGGGATGTAGG - Intergenic
1068112014 10:52690944-52690966 TTCAGGCCATGATGGGAAGTGGG - Intergenic
1068164134 10:53305900-53305922 TTCAGGCCATGAAGGAAAGTGGG + Intergenic
1068540998 10:58294875-58294897 ATCAGGTCATGTTGGGAAGTGGG + Intergenic
1068627741 10:59267610-59267632 TTCAGGCCACTGTGGGAAGCAGG + Intronic
1069170778 10:65226120-65226142 TTCTGGCCATGATGGGGAGTGGG + Intergenic
1069248716 10:66243031-66243053 TTCAGGCCATCATGGGAAGGAGG + Intronic
1070017282 10:72546022-72546044 TTCAGGCCATGTTGGGAAGGGGG - Intronic
1070171808 10:73938587-73938609 TTCAGGCCATGAGGGGAAGTGGG + Intergenic
1070201902 10:74215289-74215311 TGAAAGCCATGGTGGGAAGTTGG + Intronic
1070430822 10:76335940-76335962 TTCAGGCTATGATGGAAAGTCGG - Intronic
1071235779 10:83646647-83646669 TTCAGACCATGATGGGAAGATGG - Intergenic
1071858818 10:89651851-89651873 TTCAGGCCATGATGGGAAAGAGG - Intergenic
1071959469 10:90796125-90796147 TTCAGGCCATGATAGGAAGGGGG - Intronic
1072357685 10:94627678-94627700 TTCAGGCCATGACGGGAAGTGGG + Intergenic
1072700231 10:97635360-97635382 TTGAGGCCATGATGAGAAGTGGG - Intronic
1073483809 10:103804192-103804214 TTCAGGCCATGACAGGAAGTGGG - Intronic
1073541617 10:104319826-104319848 TTCATGCCATGATGGGAAGGAGG + Intronic
1073905759 10:108277356-108277378 TTCAGGCCATGCTGGGAAGTGGG - Intergenic
1074228068 10:111506864-111506886 TTCAGGCCATGATGGGAAAGGGG - Intergenic
1074463044 10:113656009-113656031 TTCAGGCCATGATGGAAAGGGGG + Intronic
1074997567 10:118770897-118770919 TTCAGGCCATGATGGGAGGAGGG + Intergenic
1075226079 10:120630409-120630431 TTCAGGCCATGATGAGAAGTGGG + Intergenic
1075505522 10:123018057-123018079 TTCAGGCCATGATGGGAAGTGGG - Intronic
1075848547 10:125567292-125567314 TTCAGGCCATGATGGGAACTGGG - Intergenic
1076378690 10:130010497-130010519 TTCAGGCTATGGTGGGAAGGGGG - Intergenic
1076471657 10:130723302-130723324 TTCAGGCCATGATGGGAAGTGGG - Intergenic
1076822893 10:132949807-132949829 TTCAGGCCATGATGGGAAGGGGG - Intergenic
1076902312 10:133345995-133346017 TTCAGGCCATAATGGGAAGTGGG - Intronic
1077540823 11:3145743-3145765 GGGAGGCCCTGGTGGGAAGTGGG + Intronic
1077671338 11:4160502-4160524 TTCAGGCCATGATGAGAAGTGGG - Intergenic
1077763855 11:5135516-5135538 TTCAGGCCATGAAGGGAAGTGGG + Intergenic
1077885068 11:6381392-6381414 TTCAGGCCATGATTGAAAGTGGG + Intergenic
1078395864 11:10981449-10981471 AGCAGGCAGTGGTGGGAAGAGGG - Intergenic
1079163703 11:18016895-18016917 TTCAGGCCATGACTGGAAGTGGG + Intergenic
1079229130 11:18634418-18634440 TATAGGCCGTGGAGGGAAGGGGG - Exonic
1080045280 11:27801482-27801504 TTCAGGCCATGATGGGAAAGGGG - Intergenic
1080650942 11:34222359-34222381 TTCAGGCCATGAATGGAAGTGGG - Intronic
1080708998 11:34727853-34727875 TTCAGCCTGTGTTGGGAAGCTGG - Intergenic
1080950470 11:37026483-37026505 TTCAGGTCATGATGGGAAGAGGG + Intergenic
1080988814 11:37505578-37505600 TTCAGGCCGTGATGGAAATGAGG + Intergenic
1081154053 11:39667218-39667240 TTCAGGCCATGATGGGAAGCAGG + Intergenic
1081534602 11:43987742-43987764 TTCGGGCTGTGTTGGGAAGTCGG - Intergenic
1082866396 11:57903632-57903654 TTCAGGCCACGATGGGAAGGTGG - Intergenic
1083096490 11:60256137-60256159 TTCAGGCCTTGATGGGAAGTGGG + Intergenic
1083105199 11:60350867-60350889 TTCAGGCCATGATGGAAAGTGGG + Intronic
1083191105 11:61052945-61052967 TTCAGGCCATGGTTGGGAGATGG - Intergenic
1083350940 11:62028489-62028511 TTCAGGCCATGATGGGAAGTGGG - Intergenic
1083539686 11:63503880-63503902 TTCAGACTGTGATGGGAAGTGGG + Intergenic
1084221557 11:67683592-67683614 TTCAGGCCAAGATGGGAAGCAGG + Intergenic
1084518567 11:69649328-69649350 TTCGGGCAGTTGTGGGAAGTTGG + Intronic
1085499187 11:77002923-77002945 ATCAGGGCCTGGTGGGGAGTAGG + Intronic
1085796164 11:79541864-79541886 TTCAAGCTATGATGGGAAGTGGG + Intergenic
1086127679 11:83365951-83365973 TTCAGGCCATGATAGGAAGTGGG - Intergenic
1086501967 11:87462985-87463007 TTCAGGCCATGATGGGAAGTGGG - Intergenic
1086782277 11:90922224-90922246 TTCAGTCCTTGATGGGAAGTGGG - Intergenic
1088087158 11:105995102-105995124 TTCAGGCCATGACAGGAAGTGGG - Intergenic
1088129290 11:106467647-106467669 TTCAGGCCATGATGGGAAGTGGG + Intergenic
1088330024 11:108641847-108641869 TTCAGGCCATGATGGGAAGTGGG + Intergenic
1088877704 11:113949577-113949599 TTCAGGCCATGATGGGCAGCGGG + Intergenic
1089194963 11:116688883-116688905 GGGAGGCCGAGGTGGGAAGTGGG + Intergenic
1089542582 11:119198801-119198823 TTCAGGCCGTGATGGGAAGGGGG + Intergenic
1090196781 11:124823358-124823380 TTCAGGACATGATGGAAAGTGGG - Intergenic
1090244223 11:125204202-125204224 TTCATGGCTTGGTGGCAAGTTGG + Intronic
1090290052 11:125535347-125535369 TCCAGGCCATGATGGGAAGGGGG + Intergenic
1091104250 11:132903510-132903532 TTCAGGCTATGATGGGAATTGGG + Intronic
1091229754 11:133980734-133980756 TGATGGCCGTGGTGGGGAGTGGG - Intergenic
1091386178 12:96779-96801 TTCAGGCCATGATGGGAAGTAGG - Intronic
1092304039 12:7281265-7281287 TTCAGGCCATAATGGGAAGTGGG + Intergenic
1092594348 12:9985233-9985255 TTCAGGCCATGATGGAAAGTGGG - Exonic
1092645719 12:10569887-10569909 TTGAGGCCATGATGGGAAGGAGG + Intergenic
1092722010 12:11450676-11450698 TTCAGACCATGAAGGGAAGTGGG - Intronic
1092895610 12:13007421-13007443 TTCAGGCCATGATGGGAAGTGGG + Intergenic
1093581927 12:20793078-20793100 CTCAGGCCATGATGGGAAGTGGG + Intergenic
1093623756 12:21322758-21322780 TTTAGGCCATGATGGGAAGGAGG - Intronic
1093812211 12:23504803-23504825 TTCAGGCCATGATGGGAATGTGG + Intergenic
1094009695 12:25794420-25794442 TTCAGGCCATGATGGGACGGGGG - Intergenic
1094017119 12:25876852-25876874 CTCAGACCATGATGGGAAGTGGG - Intergenic
1094133542 12:27100273-27100295 TTTAGGCCATGATGGGAAGGGGG + Intergenic
1094183687 12:27618310-27618332 TTTAGGCCGTGATGGGAAGGGGG + Intronic
1094385168 12:29886043-29886065 TTCAGGCCATGACAGGAAGTGGG - Intergenic
1095143339 12:38693802-38693824 TTCATGTAGTGGAGGGAAGTGGG + Exonic
1095268096 12:40183545-40183567 TTCAGGCCATGATGGGAAGAGGG + Intergenic
1095497615 12:42801829-42801851 TTCAGGCCATGATGGGAAGTGGG - Intergenic
1095779589 12:46044665-46044687 TTCAGGCCATTATGGGAAGGGGG + Intergenic
1095979155 12:47961100-47961122 TTCAGGCCATGATGGGAAGGGGG - Intergenic
1096353934 12:50924305-50924327 TTCAGGCCATGAGGGGAAGTGGG - Intronic
1096363175 12:51005914-51005936 TTCAGGCCATGATGGGAGGGAGG + Intronic
1096966901 12:55635745-55635767 TGCAGGACGTGGTGGGGAGGTGG - Intergenic
1097157242 12:57021797-57021819 GTCAGGCCATGATGGGAAGGGGG + Intronic
1097608224 12:61782197-61782219 TTCAGGCCATGATGAGAAGAGGG + Intronic
1097909949 12:64958859-64958881 TTCAGGCTTTGGTGGGGACTTGG + Intergenic
1097931345 12:65190298-65190320 TTCAGGCCATGATGGGAAGTGGG + Intronic
1098159086 12:67630942-67630964 GGCAGGCACTGGTGGGAAGTGGG + Intergenic
1098291696 12:68962648-68962670 CTCAGGCCATGATGGGAAGGGGG + Intronic
1098296156 12:69006140-69006162 TTCAGGCCATTATGGAAAGTGGG + Intergenic
1098831113 12:75364231-75364253 TTCAGGCCATGATGGGAAAGGGG - Intronic
1099802013 12:87469474-87469496 TTCAGGCCATGATGGGAGGTAGG + Intergenic
1099850057 12:88082587-88082609 TGCAGGCTGAGGTGGGAAGATGG + Intronic
1100129979 12:91480121-91480143 TTCATGCCTAGGTGGGAAATTGG - Intergenic
1100299095 12:93290754-93290776 TTCAGGCCATGATGGGAAGGAGG + Intergenic
1100367180 12:93932607-93932629 TTCCAGCCATGATGGGAAGTCGG + Intergenic
1101505793 12:105345036-105345058 GTCAGGCCATGATGGGAAGTGGG + Intronic
1101920967 12:108932649-108932671 TTCCGGCCATGATGGGAAGGAGG + Intronic
1102444272 12:112989732-112989754 TTCAGGCCATGATGGGAAGGAGG - Intronic
1102499994 12:113345411-113345433 TTGAGTCCATGATGGGAAGTGGG + Intronic
1103436217 12:120929062-120929084 GACAGGCCCTGGAGGGAAGTGGG - Intergenic
1103564771 12:121810159-121810181 TTCCGGGGGTGGAGGGAAGTGGG - Exonic
1104307800 12:127625193-127625215 TTCAGGCCATGACGGGAAGTGGG - Intergenic
1104355324 12:128080129-128080151 TTCAGGCCATGATGGGAATTAGG + Intergenic
1104556795 12:129807445-129807467 CTCGGGCCGTGGTGGGGATTGGG - Intronic
1104694065 12:130850121-130850143 TTCAGGCCATGATGGGAAGTGGG + Intergenic
1104707618 12:130959154-130959176 GTGTGGCCGTGGTGGAAAGTAGG - Intronic
1104781815 12:131426453-131426475 TTCAGGCCATGATGGGAAGGGGG + Intergenic
1104809994 12:131614387-131614409 TTCAGGCCCTGATGGGAAGGGGG + Intergenic
1105031724 12:132888627-132888649 TTCAGTCCCTGATGGGAAGCAGG + Intronic
1106081290 13:26502079-26502101 TTCAGGGCTTGCTTGGAAGTGGG + Intergenic
1106123047 13:26877853-26877875 CTCAGGCCATGATGGGAAGTGGG - Intergenic
1106434501 13:29711995-29712017 TTTAGGCCATGATGGGAAGGGGG - Intergenic
1106505963 13:30370671-30370693 TTCAGGCCATGGGGGGAACCAGG - Intergenic
1107079136 13:36355748-36355770 TTCAGGCCATGATGGGAAGTGGG + Intronic
1107133975 13:36924250-36924272 GTCAGGCCAGGGTGGCAAGTGGG - Intergenic
1107155811 13:37165978-37166000 TTCAGGCCATGATGGGAAGAGGG + Intergenic
1107530583 13:41278884-41278906 TTCAGGCCATGATGGGAAGGGGG + Intergenic
1107911268 13:45107827-45107849 TTCAGGTCGTGATTGGAAGGGGG - Intergenic
1108100241 13:46946591-46946613 TTAAGGCCATGATGGGAACTGGG + Intergenic
1108248416 13:48540821-48540843 TTCAGGCCATGATGGGAAGGAGG + Intergenic
1108258116 13:48630038-48630060 TTCAGGCCATGATGGGAAGTGGG - Intergenic
1108315982 13:49238062-49238084 TTCAGGCCATGATGGGAAGGAGG - Intergenic
1108390964 13:49947290-49947312 TTCAGGCCATGATGGGAAGAGGG + Intergenic
1108613666 13:52109240-52109262 TTCAGGCCATGATGGGAAGCAGG + Intronic
1108919011 13:55654507-55654529 TTCAGGCCATAATGGGAAGTGGG - Intergenic
1109157516 13:58929054-58929076 TTCAGGCCATGATGGGAAGGGGG - Intergenic
1109570363 13:64180151-64180173 TTCAGGCCTTGCTGGGAAGTAGG - Intergenic
1109805090 13:67429263-67429285 TTCAGGCCATGAAGGGAAGAGGG + Intergenic
1110784621 13:79509557-79509579 TTCAGGCCATGATGAGAAGAGGG - Intronic
1110928381 13:81184615-81184637 TTCAGGCCATGATGGGAAGTTGG + Intergenic
1110982425 13:81918012-81918034 TTCTGGCCATGATGGGAAGGAGG + Intergenic
1111564977 13:90002313-90002335 TTCAGGCCATGACAGGAAGTAGG + Intergenic
1112079561 13:95954347-95954369 CTCAGGCCATGATGGGAAGGGGG + Intronic
1112281387 13:98065781-98065803 TTCAGCCCATGATGGGAAGGGGG - Intergenic
1112366081 13:98756548-98756570 TCCAGGCCATGATGGGAAGTGGG + Intergenic
1112408083 13:99138419-99138441 TTCAGGCCACGATGGGAAGAGGG - Intergenic
1112515758 13:100051597-100051619 TTCTGGCCATGATGGGAAGGGGG - Intergenic
1113229541 13:108196660-108196682 TTCAAGCCATGATGAGAAGTGGG - Intergenic
1113390383 13:109890787-109890809 TTCAGGCCATGATGGGAAGTGGG - Intergenic
1113479505 13:110610198-110610220 TTCAGGCCATGATGGAAAGCTGG + Intergenic
1113479769 13:110611968-110611990 TTCAGGCCGAGATGGAAAGGGGG + Intergenic
1113535635 13:111064194-111064216 TTCAGGCTATGATGGGAAGCAGG + Intergenic
1113748585 13:112763282-112763304 TTCAGGCTCTGATGGGAAGAGGG + Intronic
1113804286 13:113104311-113104333 TTCAGGACGTGGAGGGGAGGGGG - Intergenic
1113859536 13:113472347-113472369 TTCAGGCCGTGGTGGGGTCGCGG - Intronic
1113971855 13:114197429-114197451 TTCAGGCCATGATGGGAAGTGGG - Intergenic
1113978865 13:114254801-114254823 TTCAGGCCATGATGGGAAGTGGG + Intronic
1114387516 14:22270330-22270352 TTCAGGCCAGAATGGGAAGTGGG - Intergenic
1114520907 14:23335201-23335223 TTCAGGCTATTATGGGAAGTGGG + Intergenic
1114521906 14:23344756-23344778 TGCAGGTCATGATGGGAAGTGGG + Intergenic
1115617779 14:35112657-35112679 TTCAGGGCATGATGGGAAGTGGG + Intronic
1116395896 14:44448444-44448466 TTCAGGCCATGATGGGAAGGGGG - Intergenic
1117969239 14:61235962-61235984 TTCAGGCCATGATGGGAAGCAGG + Intronic
1118158605 14:63266363-63266385 TTCAGGCTATGATGGGAAGCGGG - Intronic
1118395133 14:65329797-65329819 TTCAGGCCATGATGGGAAGGGGG - Intergenic
1118441311 14:65814276-65814298 TTCAGGCCATGATGGGAAGTGGG - Intergenic
1118474020 14:66100508-66100530 CTCAGGCCATGATGAGAAGTGGG + Intergenic
1118895188 14:69939953-69939975 TTCATGCAGAGGTGGGAAGAAGG + Intronic
1119471697 14:74904427-74904449 TTCGGGCCATGGTGGGAAGAGGG - Exonic
1120267712 14:82272613-82272635 TTCAGGCCATGATGGGAAGTAGG - Intergenic
1120268005 14:82275781-82275803 CTCAGGCCCTGATGGAAAGTGGG - Intergenic
1120402008 14:84043951-84043973 TTCAGGCCATGATGTGAAGGAGG + Intergenic
1121425015 14:93844375-93844397 TTTAGGCCATGATGGAAAGTGGG - Intergenic
1121663186 14:95651095-95651117 TCCATGCCCTGGTGAGAAGTTGG - Intergenic
1122351412 14:101095487-101095509 TTCAGCCCATGGTGGGAAGCTGG + Intergenic
1122351423 14:101095537-101095559 TTCAAGCCATGATGGGAAGTTGG + Intergenic
1122988588 14:105225361-105225383 TTCAGACCATGATGGGAAGTGGG + Intronic
1123035277 14:105469391-105469413 CTGAGGCCGTGGTGGGCGGTGGG + Intronic
1123099031 14:105783250-105783272 TTTGGGCCTTGGTGGGGAGTAGG + Intergenic
1124075720 15:26442770-26442792 TTCAGGCTATGATGGGAAGAAGG - Intergenic
1124075948 15:26444352-26444374 TTCAGGCCATGATGGGAAGCAGG - Intergenic
1124603412 15:31152547-31152569 TTCAGGCCATGACGGGAAGCAGG + Intronic
1124664196 15:31578132-31578154 TTCAGGCCAAGGTGGGAAGTAGG + Intronic
1124821976 15:33055041-33055063 TTCAGGCCATGATGGGAAGTGGG + Intronic
1126662285 15:51044972-51044994 TTCAGGCCATGAAGGGAAGTGGG + Intergenic
1127575300 15:60286065-60286087 TTCAGGCCATGATAGGAAGGGGG - Intergenic
1127901260 15:63342649-63342671 TTCAGGCCATGATGGGAAGAGGG - Intronic
1127947008 15:63765428-63765450 TTCAGGCCAGGACGGGAAGTGGG + Intronic
1127972802 15:63974995-63975017 TTCAGGCCATGGTGGGAAGAGGG - Intronic
1128603481 15:69016936-69016958 TTCAGGCCATCATGGGAAGGAGG + Intronic
1130170405 15:81506470-81506492 ATCAGGCTGGGGAGGGAAGTAGG + Intergenic
1130695047 15:86122791-86122813 TTCAGGCCATGATGGGAAGTGGG + Intergenic
1130889776 15:88123966-88123988 TTCAGACCATGATGGGAAGCAGG - Intronic
1131001035 15:88940504-88940526 TTCAGCCCATGATGGGAAGCAGG - Intergenic
1131008349 15:88996878-88996900 GTCAGGCCATGATGGGAAGTAGG + Intergenic
1131360686 15:91788194-91788216 TTCGGGGGGTGGAGGGAAGTGGG - Intergenic
1132716834 16:1294743-1294765 TTCAGGCCACGCTGGGAAGGGGG + Intergenic
1132906174 16:2283906-2283928 TGGAGGCGGTGGTGGGGAGTAGG + Intronic
1133000063 16:2845781-2845803 CTCAGGCCATGATGGGAAGAGGG + Intergenic
1133101423 16:3482396-3482418 CTCTGGCTGTCGTGGGAAGTCGG + Intronic
1134171487 16:11973243-11973265 TTCAGGCCATGATGGGAAATGGG - Intronic
1134338680 16:13325416-13325438 TTCAGGCCATGATGGGAAGGTGG - Intergenic
1135204721 16:20473743-20473765 TTCAGGCCATGATAGGAAGTGGG + Intronic
1135214170 16:20550069-20550091 TTCAGGCCATGACAGGAAGTCGG - Intronic
1135256571 16:20946083-20946105 TTCAGGCCATGACGGGAAGTGGG + Intronic
1135912559 16:26574695-26574717 TTCAGACCGTGATGGGAAGAGGG + Intergenic
1136289591 16:29263496-29263518 TTCAGGCTGTGATGGGAAGTGGG - Intergenic
1136615394 16:31395383-31395405 TTCAGGAGGCGGTGGGAGGTGGG - Intronic
1137837043 16:51602436-51602458 TTGAGGCAGGGGTGGGGAGTGGG - Intergenic
1137903956 16:52300241-52300263 TACAGGCCATGGTGGGTGGTGGG - Intergenic
1138031612 16:53563703-53563725 TTTAGGCCATGATGGGAAGTGGG - Intergenic
1138322278 16:56125808-56125830 TTCAGGCTTTGGTGGGAGGTGGG - Intergenic
1138632312 16:58307673-58307695 CTCAGGCCATGATGGGAAGAGGG + Intronic
1138748246 16:59388721-59388743 TTCAGACCATGATGGGAAGAGGG - Intergenic
1138955171 16:61962754-61962776 TTCAGGCAGAGTTGGGAGGTTGG - Intronic
1139058638 16:63220900-63220922 TTCAGACCATGATGGGAAGTGGG + Intergenic
1139924560 16:70479013-70479035 CTCAGGCAGTCCTGGGAAGTGGG + Intronic
1139939730 16:70596562-70596584 CTGAGGCAGTGGTGGGAAATGGG - Intronic
1140500625 16:75430899-75430921 TTTGGGCCATGATGGGAAGTGGG - Intronic
1140782378 16:78308341-78308363 TTCAGGCAGTGATGGGAAGAGGG + Intronic
1141055409 16:80809415-80809437 TTCAGGTAGTGATGTGAAGTAGG + Intergenic
1141259737 16:82441636-82441658 TTCAGGCCATGATGGGAAGTGGG - Intergenic
1141411901 16:83840825-83840847 TTCAGGCCATGATGGGAAGCAGG - Intergenic
1141719588 16:85748829-85748851 TTCAGGCCATGATGAGAAGTGGG - Intronic
1141939642 16:87266366-87266388 TTCACACAGTGGTGGGGAGTGGG - Intronic
1142095325 16:88236476-88236498 TTCAGGCTGTGATGGGAAGTGGG - Intergenic
1142285725 16:89170771-89170793 TTCTGGCCGAGGTGGCAAGGAGG + Intergenic
1142298604 16:89243128-89243150 TTCTGGCCGAGGTGGCAAGGAGG + Intergenic
1143116015 17:4582263-4582285 CCCAGGCCTTGGTGGGAGGTTGG + Intergenic
1143175157 17:4950991-4951013 TTCAGGCTGTAGTGGGCACTTGG + Intronic
1143288715 17:5812210-5812232 TTCAGGCCATGATGGGAAGAGGG + Intronic
1143822130 17:9573160-9573182 TTCAGGCCATGATGGGAAGAGGG + Intronic
1144096850 17:11907529-11907551 TTCAGGCCATGATGGGAAGGGGG - Intronic
1144189794 17:12834037-12834059 ATCAGGCCCTGATGGGAAGGGGG - Intronic
1144299930 17:13913705-13913727 CTCAGGCCATGATGGGAAGGGGG + Intergenic
1145024424 17:19457283-19457305 TTCAGGCCATGATGAGAAGGGGG - Intergenic
1146146612 17:30424415-30424437 TTCAGGCCATGATGGGAAATGGG - Intronic
1146465856 17:33086124-33086146 TTCTGGGCTGGGTGGGAAGTCGG - Intronic
1146513087 17:33467467-33467489 TTCAGGCTATGATGGGAAGGAGG + Intronic
1146602250 17:34227929-34227951 TTCAGGCCATGATGGGAAGGGGG + Intergenic
1146929538 17:36767808-36767830 TTCAGGCTGAGGTGGGGAGGGGG + Intergenic
1148368012 17:47071366-47071388 TTCAGGCCATGACAGGAAGTGGG - Intergenic
1149170465 17:53804005-53804027 TTCAGGCCATGATGAGAAGTGGG - Intergenic
1149829095 17:59855494-59855516 TTCAGGCCATGATGGAAAGGGGG - Intergenic
1150124388 17:62627285-62627307 TTCACGGCGTGGTGGGACCTGGG - Intergenic
1150397157 17:64830699-64830721 TTCAGGCCATGACAGGAAGTGGG + Intergenic
1152137476 17:78513147-78513169 TTCAGGCCATGACGGGAAGGAGG + Intronic
1152823899 17:82451650-82451672 CTCAGGCAGTGATGGGAAGGGGG + Intergenic
1153182132 18:2446798-2446820 TTCAGGCCATGATGAGAAGAAGG - Intergenic
1153345390 18:4020223-4020245 TTCAGGCCATGACAGGAAGTCGG - Intronic
1153572596 18:6488076-6488098 TTCAGGCCATGATGGGAAGCGGG + Intergenic
1154113535 18:11591095-11591117 TTCAGGCTGGGATGAGAAGTGGG - Intergenic
1154151067 18:11907052-11907074 TTTAGGCCATGATGGGAAGTGGG + Intronic
1154373926 18:13793195-13793217 TGCAGGCCATGGCAGGAAGTGGG + Intergenic
1154375967 18:13810120-13810142 TTCAGGCCACGATGGGAAGGTGG - Intergenic
1155736304 18:29226675-29226697 TTCAGGCCATGATGGAAAGTTGG + Intergenic
1155850492 18:30768465-30768487 TTCAGGCAATGATGGGAAGTGGG + Intergenic
1156133212 18:34003851-34003873 TTCAGGGCATGATGGGAAGTGGG + Intronic
1156185661 18:34660272-34660294 TTCAGGCCGTGAGAGGAAGTGGG + Intronic
1157671038 18:49528921-49528943 TTCAGGTCATGATGGGAAGTGGG + Intergenic
1157712261 18:49858144-49858166 TTCAGGCCACGATAGGAAGTGGG + Intronic
1157721095 18:49925055-49925077 TTCAGGCCATGCTGGGAATGGGG + Intronic
1157783059 18:50457314-50457336 TTCAGGCCATGATGGGAATGGGG - Intergenic
1158166753 18:54548839-54548861 TTCAGGCCATGATGGGAAGGAGG - Intergenic
1158917754 18:62152409-62152431 TTCAGGCCATAAGGGGAAGTGGG - Intronic
1159291928 18:66434444-66434466 TTTAGGCAGGGGTTGGAAGTAGG - Intergenic
1159324362 18:66895054-66895076 TTCAGGCCATGATGGGAAGAGGG - Intergenic
1159786295 18:72718442-72718464 TTCAGGCCATGATGGGAAGTGGG + Intergenic
1160465218 18:79070524-79070546 TTCAGTGCTTGGTTGGAAGTGGG + Intronic
1160517964 18:79488863-79488885 TGCAGGCCCAGGTGGGAAGCAGG + Intronic
1160799366 19:960660-960682 CTGAGGCCCTGGTGGGAAGAGGG - Intronic
1163060872 19:14760718-14760740 TTCAGGCTATGGTGGGAAGTGGG + Intronic
1164564086 19:29313645-29313667 CTCAGGGGGTGGTGGGAGGTTGG - Intergenic
1164889616 19:31812230-31812252 TTCAGGCCATAAAGGGAAGTGGG - Intergenic
1164966968 19:32493686-32493708 TTCAGGCCATGATGGGAAGGGGG - Intergenic
1165142423 19:33708457-33708479 TTCAGCACGTGCTGGGAACTGGG - Intronic
1166209524 19:41297271-41297293 TTGGGGCCATGGTGGGAATTTGG + Intronic
1167137259 19:47624270-47624292 TGCAGGCCGAGGTGGGGAGGCGG - Intronic
1167201110 19:48066181-48066203 TTCAGTCCCTGATGGGAAGTGGG - Intronic
1167501688 19:49851693-49851715 TTCGGGCCGGGGTGGGGGGTTGG + Intronic
1168043425 19:53777061-53777083 TGGAGGCCGTGGTGGGAGGATGG - Intergenic
1168360245 19:55733696-55733718 TTCACGCCATGATGGGAAGTGGG + Intronic
924979187 2:205145-205167 TTCAGGCCATCATGGGAAGGTGG + Intergenic
925291107 2:2749315-2749337 CTCAGCCCGTGGTGTGAAGGAGG - Intergenic
925357590 2:3252978-3253000 TTTAGGCCATGATGGGAAGTGGG + Intronic
925479528 2:4254629-4254651 TGCAGGCTGGGGTGGGAAGTAGG - Intergenic
927164150 2:20300112-20300134 TTCAGGCTGTGATGGGAAGTAGG - Intronic
927589168 2:24338044-24338066 TTCAGGCCGTGATGGGAAGTGGG + Intronic
927746227 2:25623948-25623970 TTAAGGCCATGATGGGAAGCTGG + Intronic
927748686 2:25646098-25646120 TTCAGGCCATGATAGGAAGTTGG + Intronic
927844281 2:26463415-26463437 GTTGGGCCGTGGTGGGAAGTGGG + Intronic
927950490 2:27165092-27165114 TTCAGGCCATGATGGGAAGGGGG - Intergenic
928018537 2:27681884-27681906 TTCAGAGGTTGGTGGGAAGTAGG + Intronic
928243087 2:29603565-29603587 TTCAGACCATGATGGGAAGGAGG - Intronic
928499890 2:31879956-31879978 TTAAGGGAGTGGTGGGATGTGGG - Intronic
928519279 2:32072520-32072542 TTCAGGCCATAATGAGAAGTGGG - Intronic
928540781 2:32281646-32281668 TTTAGGCTGAGGTGGGCAGTTGG + Intronic
928604732 2:32935243-32935265 TTCAGGCCATGATGGGAAAGGGG + Intergenic
928671580 2:33608644-33608666 TTCAGGCCATGATGGGAAGTGGG + Intergenic
929098300 2:38285167-38285189 TTCAGGCCATGATAGGAAGTGGG - Intergenic
930488335 2:52036976-52036998 TTCAGGCTATGCTGGGAAGCAGG + Intergenic
930653903 2:53989574-53989596 TCTAGGTCTTGGTGGGAAGTAGG + Intronic
931042187 2:58313142-58313164 TTCAGGCCATGATGGGATGTAGG - Intergenic
931446439 2:62331137-62331159 TTCAGGCCATGATGGAAAGGAGG - Intergenic
932078504 2:68689487-68689509 TTCAGTCCATGATGGGAAGGGGG - Intronic
932563855 2:72893630-72893652 TTCATGACGTGGTGGGTGGTGGG + Intergenic
932841839 2:75090334-75090356 TTCAGGCCATGAAGGGAAGTGGG + Intronic
932873970 2:75431472-75431494 TTCAGGCCATTGCAGGAAGTGGG - Intergenic
933079899 2:77972703-77972725 TTCAGGCCATGACAGGAAGTGGG + Intergenic
933228623 2:79779883-79779905 TTCAGGCCATGATGGGAGGTGGG + Intronic
933939087 2:87230733-87230755 TTCAGGCCATGATGGAAAGCAGG - Intergenic
934463371 2:94235820-94235842 ATGAGGCCGAGGTGGGAAGATGG - Intergenic
934881364 2:97983352-97983374 TTCAGGCCATGATGGGAAGAGGG - Intronic
934918111 2:98317401-98317423 TTCAGGCCCTGAGGGGAAGTGGG + Intergenic
935242039 2:101187310-101187332 TTCAGGCCATGATGGAAAGGAGG - Intronic
935807293 2:106761593-106761615 GTCAGGTCATGATGGGAAGTGGG + Intergenic
936165484 2:110116206-110116228 TGCAGGCCGTGGTGGGCACCCGG - Exonic
936354047 2:111735042-111735064 TTCAGGCCATGATGGAAAGCAGG + Intergenic
937850088 2:126624246-126624268 CTCAGGCCATGATGGGAAGTGGG - Intergenic
937933118 2:127220549-127220571 TTTTGGCCATGGTTGGAAGTGGG - Intergenic
939164005 2:138620738-138620760 TGCAGGCTGTGATGGGAAGGGGG + Intergenic
939768903 2:146289963-146289985 TTCAGGCCATGGTGGGAATGGGG - Intergenic
940144056 2:150526271-150526293 TTCAGGCCATGAAGGGAAATGGG - Intronic
941596635 2:167485074-167485096 TTCAGGCCATGATGGGAAGTGGG - Intergenic
941863637 2:170310920-170310942 TTCAGGCCATGATGGGAAGTGGG - Intronic
942097745 2:172549242-172549264 TTCAGGCCATGATGGGAAGGCGG + Intergenic
942172738 2:173303651-173303673 TTCAGGCTATGATGTGAAGTAGG - Intergenic
942605036 2:177681703-177681725 TACAGGCCATGATGGGAAGTGGG + Intronic
943309248 2:186306540-186306562 TTGAGGCCATGATGGGAAGGGGG + Intergenic
943548251 2:189308245-189308267 TTCAGGCCATGATGGGAAGGAGG + Intergenic
943578631 2:189658992-189659014 TTCACCCCGTTTTGGGAAGTGGG - Intergenic
943730015 2:191292660-191292682 TTCAGGCCATGATGGGAAGTGGG - Intronic
944124984 2:196282826-196282848 TTCAGGCCATGATGGAAAGTGGG - Intronic
944431046 2:199633935-199633957 TCTAGGCCCTGTTGGGAAGTAGG + Intergenic
944659728 2:201911384-201911406 TTCAGGCCATGAAGGGAAGCAGG - Intergenic
945115230 2:206401805-206401827 TTCAGGCCATAATGGGAAGTGGG - Intergenic
945811334 2:214553748-214553770 TTCAGGCTGTGATGGGAAGTGGG - Intronic
946402401 2:219475516-219475538 TTCTGGCCGTGCTGTGAAGATGG + Intronic
947267048 2:228294432-228294454 TTCAGGCCATGATGGGATGTGGG - Intergenic
947294387 2:228614704-228614726 TTCAGGCCATAATGGGAAGTAGG + Intergenic
947618173 2:231571880-231571902 TTCAGGCCATGATGGGAAGCGGG - Intergenic
947814663 2:233028368-233028390 TTCAGACCATGATGGGGAGTGGG + Intergenic
947949716 2:234136569-234136591 TTCAGGCCATGATGGGAGGCAGG + Intergenic
948091086 2:235296373-235296395 TTCAGGCCATGATGGGAAAGGGG - Intergenic
948321033 2:237069888-237069910 TTCAGGCCATAATGGGAAGGGGG + Intergenic
948437432 2:237963166-237963188 TTCAGGCCATGATGGGAAGGAGG + Intergenic
948620264 2:239230181-239230203 TTCAGGCCCTGATGGGAATGGGG - Intronic
948654338 2:239467125-239467147 GTCAGGGCGTGGGGGGAAGCTGG + Intergenic
948717969 2:239877871-239877893 TTCAGGCTGTGGTGGGAAGGTGG - Intergenic
1168837741 20:888910-888932 TGCAGGCCATGGTGAGAACTGGG - Intronic
1168843931 20:929178-929200 TTCTGGCCATGATGGGAAGAGGG - Intergenic
1168845863 20:944396-944418 TTCAGGCCATGATGGAAAGTGGG - Intergenic
1169302811 20:4459249-4459271 TTCAGACCATGATGGGAAGAGGG + Intergenic
1170538749 20:17367535-17367557 TTTAGGCTGTGGGGTGAAGTTGG - Intronic
1170654227 20:18271000-18271022 TTCAGGGCATCTTGGGAAGTGGG + Intergenic
1170663442 20:18364340-18364362 TGCAGGCCATGGTGGAAAGGGGG - Intergenic
1170823766 20:19776162-19776184 CTCAGGCCATGATGGGAAGTGGG + Intergenic
1170936675 20:20816228-20816250 TTCAGGCCATGATGGGAAGAGGG - Intergenic
1171165215 20:22964222-22964244 TTCAGGCCATAATGGGAAGTAGG - Intergenic
1171235650 20:23522233-23522255 TTCAGGCCATGATGGAAAGGAGG - Intergenic
1171405844 20:24911973-24911995 TTCTGGCCATGATGGGAAGGTGG + Intergenic
1171807731 20:29699087-29699109 TTGAGGCCGTCGTTGGAAATTGG - Intergenic
1172796194 20:37540257-37540279 TTTGGGACGTGATGGGAAGTGGG - Intergenic
1173746349 20:45440259-45440281 TTCAGGCCATGACAGGAAGTGGG + Intergenic
1173746500 20:45441491-45441513 TTCAGGCCATGATGGGAAGGGGG - Intergenic
1173887956 20:46478608-46478630 TTCAGGCCATGATGGGAAGTGGG - Intergenic
1174296813 20:49551243-49551265 TTCAGGCCGTGGTGGGAAGTGGG + Intronic
1174519473 20:51118563-51118585 GCCAGGCAGTGGTGGGAGGTGGG - Intergenic
1174543248 20:51306292-51306314 TTCAGGCCATGATGGGAATGCGG - Intergenic
1174677770 20:52374882-52374904 TTCACTCCCTGGTGGGGAGTGGG + Intergenic
1174865766 20:54134247-54134269 TGCGGGCCATGGTGAGAAGTTGG + Intergenic
1174913867 20:54635044-54635066 TTCAGCCCATGATGGGAAGTGGG + Intronic
1175586799 20:60147633-60147655 TTCAGACCATGATGGGAAGTGGG - Intergenic
1175648594 20:60697040-60697062 CTCAGGCCTTGATGGGAAGTGGG - Intergenic
1175682219 20:60997300-60997322 TTTAGCCCTTGGTGGGAAGGTGG - Intergenic
1175734335 20:61374743-61374765 TTCAGGCCATGATGGGAAGTGGG + Intronic
1175912320 20:62410814-62410836 TCCAGGCCCTGGTGGGCAGGTGG + Exonic
1175992903 20:62798243-62798265 TGCAGGCCGTGCTGGGCAGGCGG + Intronic
1177003171 21:15638657-15638679 TTCAGGCCATGATGAGAAGTGGG + Intergenic
1177013849 21:15759763-15759785 TTCAGGCCATGACTGGAAGTGGG - Intronic
1177191843 21:17860875-17860897 TTCAGGCCATGACGGGAAGCAGG - Intergenic
1177217596 21:18150341-18150363 TTCAGGCCATAGTGGGGAGTGGG - Intronic
1177255832 21:18661917-18661939 TTCAGGCCATGACGGGAAGTGGG + Intergenic
1178134915 21:29616016-29616038 TTCAGCCCTTGTTGGGAATTGGG - Intronic
1178179634 21:30144924-30144946 TTCAGGCCATGTTGGGAAATGGG + Intergenic
1178866217 21:36329654-36329676 TTCAGGCCATGACAGGAAGTTGG + Intronic
1178897389 21:36570395-36570417 TTCAGGTCATGATGGGAAGAGGG - Intronic
1179033465 21:37740227-37740249 TTCAGGCCATTATGGTAAGTGGG + Intronic
1179169956 21:38965235-38965257 TTCAGGCCAGGACGGGAAGTGGG + Intergenic
1179400860 21:41081831-41081853 TTCAGGCCATGATGGGAAGTGGG - Intergenic
1179609982 21:42543923-42543945 TTCAGGCTGTGGTGGCAAGATGG - Intronic
1179620009 21:42607897-42607919 TTCAGGCTGTGATGGGAATCAGG + Intergenic
1179782908 21:43713853-43713875 TTCAGGCCATGATGGGAAGTGGG + Intergenic
1180796692 22:18609245-18609267 TTCAGGCCGTGCGTGGAACTTGG + Exonic
1180866762 22:19124227-19124249 TTCAGGCCGTGATAGGAAGTGGG - Intergenic
1181225032 22:21386026-21386048 TTCAGGCCGTGCGTGGAACTTGG - Exonic
1181253600 22:21548787-21548809 TTCAGGCCGTGCGTGGAACTTGG + Exonic
1182395046 22:30029170-30029192 TTCAGGCTGTAGAGGGAATTTGG + Intronic
1182501399 22:30750530-30750552 TTCAGGCAATGATGGGAAGTGGG + Intronic
1183113132 22:35667947-35667969 TTCAGGCCATGATGGGAAGTGGG + Exonic
1183113972 22:35675363-35675385 TTCAGGTCATGACGGGAAGTGGG + Intergenic
1183166789 22:36154172-36154194 TTCAGGCCATGAAGGGAAATGGG - Intronic
1184381814 22:44149495-44149517 TTCAGGCTGTGGCTGGATGTGGG - Intronic
1184986189 22:48137024-48137046 CTCAGCCCATGATGGGAAGTGGG - Intergenic
1185352831 22:50346860-50346882 TGCAGGCACTGATGGGAAGTGGG - Intronic
949227553 3:1712251-1712273 TTCAGGCCATGATGGCAAGGGGG + Intergenic
949461790 3:4302593-4302615 TTCAGGCCATGATGGGAAGGGGG - Intronic
949462605 3:4309295-4309317 TTCAGGTCATGATGGGAAGGGGG - Intronic
949811453 3:8011331-8011353 TTCAGGCCATGATGGAAAGTGGG - Intergenic
949927600 3:9054207-9054229 TTCAGGCCATGATGGGAAGGGGG + Intronic
949938798 3:9137630-9137652 TTCAGACCACTGTGGGAAGTGGG - Intronic
950125922 3:10509759-10509781 TTCAGGCCTTGGTGGGAGTGGGG - Intronic
950386219 3:12663016-12663038 TTCATTCTGTGGTGGGAAGAAGG - Intronic
950537451 3:13587609-13587631 TTCAGGCCATGAAGGGAAGTGGG + Intronic
950917370 3:16659576-16659598 TTCAGGCCATGGTAGGAAAGGGG + Intronic
951621510 3:24606741-24606763 TTCAGGGCATGGTGGGACCTTGG + Intergenic
951644150 3:24868565-24868587 TTCAGGCCATGATGGGAAGGTGG + Intergenic
951773807 3:26286469-26286491 TTCAGGCCATGGTGGGAGGTGGG + Intergenic
952033802 3:29175879-29175901 TTCAGGCCATGATGGGAACATGG - Intergenic
953167241 3:40476400-40476422 TTCAGGCCATGATGGGAAGCAGG - Intergenic
953439390 3:42905137-42905159 TTCAGGCCATAATGGGAAGGAGG + Intronic
953505402 3:43481490-43481512 TTCAGGCCATGATGGGACATGGG + Intronic
954103145 3:48393363-48393385 TTCAGGGCCTGGTGGGGAGGGGG + Intronic
954241181 3:49294839-49294861 TTGAGGCCGTGGTTGGAAGAAGG - Intronic
954606644 3:51915873-51915895 TTCAGGCCATGATGGAAAGTGGG + Intergenic
954650076 3:52155658-52155680 TTCAGGCCATGATGGGAAGTGGG + Intergenic
954651828 3:52169417-52169439 TTCAGGCCATGATGGGAAGTTGG + Intergenic
954688160 3:52381846-52381868 TCCAGGGCGTGCTGGGCAGTGGG + Intronic
954923509 3:54212645-54212667 TTCAGGCCATGATAGGAAGTGGG - Intronic
954961170 3:54566254-54566276 TCCAGGACATGGTGGGCAGTGGG - Intronic
954961715 3:54571350-54571372 TTCAGGCCGTGATGGGAAATGGG - Intronic
954969800 3:54641826-54641848 TTCAGGCCATGCCAGGAAGTGGG - Intronic
956716067 3:72081161-72081183 TTCAGGCCATGATGGGAAGAGGG - Intergenic
957165060 3:76662107-76662129 TTCAGGCCATGATGGGAAGTGGG - Intronic
957305232 3:78449283-78449305 TTCAGGCCATGGTGGGAAGTGGG + Intergenic
957965234 3:87313613-87313635 TTCAGGCTGTGATGGGAAGGGGG - Intergenic
957998983 3:87727845-87727867 TTGAGGCCATGATGGGAAGTAGG + Intergenic
959328911 3:104976903-104976925 TTGAGGAAGTGTTGGGAAGTGGG + Intergenic
959376589 3:105595194-105595216 TTCAGGCCATTATGGGAAGGTGG - Intergenic
959752856 3:109858887-109858909 TTCAGGCCATGATGGGAAGTGGG - Intergenic
960425981 3:117508475-117508497 TTCAGGCCATGATGTGAAGGGGG - Intergenic
961169231 3:124784558-124784580 TTAAGGCAGTGGAGGGAAGATGG + Intronic
961313815 3:126020627-126020649 TTCAGGCCATGACGGGTAGTGGG + Intronic
961348924 3:126286792-126286814 TTTAGGCCATGATGGGAAGAGGG - Intergenic
961706206 3:128787813-128787835 GGCAGGCCGAGGTGGGAAGATGG - Intronic
961800618 3:129446015-129446037 TTCAGGCCATGATGGGAAATGGG + Intronic
961800845 3:129447881-129447903 TTCAGGCCATGACGGGAAGTGGG - Intronic
961816954 3:129556038-129556060 TGCAGGCCGTGCTGGGCAGATGG + Exonic
961957437 3:130818520-130818542 TTCAGGCCATGATGGGAAGAGGG + Intergenic
962182838 3:133226607-133226629 CTCAGGCCATGATGGGAAGTGGG - Intronic
962272483 3:133988126-133988148 TTCAGGCCATGACAGGAAGTGGG + Intronic
962467729 3:135675757-135675779 TTCAGGCCATGATGGGAAGTGGG + Intergenic
963058099 3:141204047-141204069 TTCACGCCATGATGGGAAGGTGG - Intergenic
963601126 3:147379957-147379979 TTGAGGGCGTGGTGTGAAGTGGG + Intergenic
963790291 3:149576327-149576349 TTTGGGAAGTGGTGGGAAGTAGG - Intronic
964260365 3:154828592-154828614 TTCAGGCCATGATGGGAAGCAGG - Intergenic
964856112 3:161147673-161147695 TTCACGCCATGATGGGAAGTGGG - Intronic
965549462 3:169949581-169949603 TTGAGGCTGAGGTGGGAGGTGGG - Intergenic
966131964 3:176651557-176651579 TTCAGGCCATGGCTGGAAGTGGG - Intergenic
967408442 3:189142885-189142907 TTAATGAGGTGGTGGGAAGTAGG - Intronic
967543252 3:190693575-190693597 TCCAGGCCATGATGGGAAGGGGG + Intergenic
967710409 3:192700720-192700742 TTTAGGCCATGATGGGAAGAGGG + Intronic
968016340 3:195337797-195337819 TGCCGGCCATGGTAGGAAGTTGG - Intronic
968455125 4:693746-693768 TTCAGGCCATGAGGGGAAATGGG + Intergenic
968924518 4:3539881-3539903 TTCAGGCCATGATGGGAAGTGGG + Intergenic
969193300 4:5541599-5541621 TTCAAGCCATGGTAGGAAGGTGG - Intergenic
969198971 4:5586477-5586499 TTCAGGCCATGAAGGGAAGGGGG + Intronic
969272446 4:6112005-6112027 TTCAGGCCATGATGGGAAGCGGG + Intronic
969346320 4:6572578-6572600 TTCAGGCCATGATGGGAAGTGGG + Intergenic
969566262 4:7980189-7980211 TTCAGGCCATGAAGGGAAGAGGG + Intronic
969578389 4:8049484-8049506 TTCAGGCCATGATGGGAAGCGGG + Intronic
969661522 4:8532432-8532454 TTCAGGCCGTGATGGGAAGCGGG - Intergenic
969664141 4:8547371-8547393 TTCAGGCCATGAGAGGAAGTGGG + Intergenic
970315592 4:14825770-14825792 TGCAGGACGTGGAGTGAAGTGGG - Intergenic
971076374 4:23153755-23153777 TTCAGGCCATGAAGGGAAGGTGG + Intergenic
971250802 4:24971720-24971742 TTCAGCCCATGATGGGAAGAGGG + Intronic
971277226 4:25209871-25209893 TTCAGCCCATGATGGGAAGAGGG - Intronic
971689215 4:29811355-29811377 TTCAGGCCATGATGGGAATGAGG - Intergenic
971851866 4:31994537-31994559 TTCAGGCCATGATGGCAAGTGGG - Intergenic
971919287 4:32915619-32915641 TTCAGGCCATGGTGAGAAGTGGG - Intergenic
971970414 4:33612487-33612509 TTCACACCATGATGGGAAGTGGG - Intergenic
972322868 4:37988824-37988846 TTCAGGTCGTGATGGGAAAGGGG + Intronic
972565844 4:40268292-40268314 TTCAGGCCATCGTGGGAAAGGGG + Intergenic
972778845 4:42267528-42267550 TTCAGGCCATTATGGGAAGTGGG + Intergenic
973253137 4:48082258-48082280 TTCAGGCCACGATGGGAAGAGGG + Intronic
974878200 4:67722742-67722764 TTCAGGTCATGATGGGAAGTAGG + Intergenic
974997595 4:69180398-69180420 TTCAGACAATGATGGGAAGTGGG - Intronic
975002464 4:69241366-69241388 TTCAGACAATGATGGGAAGTGGG - Intergenic
975007433 4:69308407-69308429 TTCAGACAATGATGGGAAGTGGG + Intronic
975010569 4:69345348-69345370 TTCAGACAATGATGGGAAGTGGG - Intronic
975240356 4:72050379-72050401 TTCAGTCTGTGATGGGAAGGGGG + Intronic
975346359 4:73296547-73296569 TTCAGGCCATCATGGGAAGTGGG + Intergenic
975797643 4:78025913-78025935 TTTAGGCCATGATGGGAAGGGGG - Intergenic
976738221 4:88332486-88332508 TTCAGGCCATGACGCGAAGTGGG - Intergenic
977070054 4:92374117-92374139 TTCAGGCCATGATGGGAAGTGGG + Intronic
977610564 4:99025704-99025726 TTCAGGCCATGACTGGAAGTGGG + Intronic
978024778 4:103859952-103859974 TTCAGGCCATGATGGGAAGGGGG + Intergenic
978513073 4:109542714-109542736 TTCAGTGCTTGGTAGGAAGTCGG + Intergenic
979648003 4:123094326-123094348 TTCAAGCCATGATGGGAAATAGG - Intronic
980279422 4:130700181-130700203 TTCAGTCCATGATGGGAAGTGGG - Intergenic
980480264 4:133378702-133378724 CTCAGGCCATGATGGGAAGTGGG - Intergenic
980908703 4:138974579-138974601 TTCAGGCTATGGTGGGAAGCGGG + Intergenic
981077584 4:140606636-140606658 TTCAGGCCTTGATGGGAAGGTGG + Intergenic
981089210 4:140715255-140715277 TTCAGGCCGTGATGAGAAAGGGG - Intronic
981092304 4:140744367-140744389 TTCAGGCCATGATGGGAAGGTGG + Intronic
981490711 4:145336498-145336520 TTCAGCTCATGGTGGGAAGGGGG + Intergenic
981524732 4:145698677-145698699 TTCAGGGCATGATGGGAAGTGGG - Intronic
981546870 4:145902765-145902787 TGCTGGGCGTGGTGGGAAGGCGG + Exonic
981805992 4:148715806-148715828 TTCAGGCCATGATGTGAAGGAGG - Intergenic
981903319 4:149891576-149891598 TTAAGGCCATAATGGGAAGTAGG - Intergenic
982334929 4:154224552-154224574 TTCAGGCCATGATAGGAAGTGGG + Intergenic
982398848 4:154943458-154943480 TTCAGGCCATGGTGGGAGGTGGG + Intergenic
982793456 4:159618512-159618534 TTCATGCCATGATAGGAAGTGGG - Intergenic
982938966 4:161524006-161524028 TTCAGGCCATGATGGGAAGTGGG + Intronic
983024416 4:162715452-162715474 TTCAAGCCATGATGGGAAGGAGG + Intergenic
983343286 4:166494152-166494174 TTCAGGCCATGATGGGAAGTGGG + Intergenic
983710771 4:170712933-170712955 TTCAGGCCATGACGGGAAGTGGG + Intergenic
983781718 4:171676994-171677016 TTCAGGCCACGGCAGGAAGTGGG - Intergenic
984073784 4:175150037-175150059 TTCAGGCCGTGACGGAAAGTCGG + Intergenic
984365487 4:178793885-178793907 TTCAGGCCAAGATAGGAAGTGGG - Intergenic
984904390 4:184613304-184613326 TCCAGGCCATGATGGGAAGAGGG - Intergenic
987265825 5:16254045-16254067 TTCAGGCCATGATGGGAAGGAGG - Intergenic
987586119 5:19859183-19859205 TTCAGGCCATGATGGGAAGTAGG + Intronic
987719745 5:21618025-21618047 TTCAGGCCATGAAGGGAAGTGGG + Intergenic
987720726 5:21628745-21628767 TTCAGGCCATGAAGGGAAGCGGG + Intergenic
987965264 5:24864603-24864625 TTCAGGCCATGATAGGAAGTGGG - Intergenic
988866233 5:35338230-35338252 TTCAGGCCATGATGTGAAGGAGG - Intergenic
989564041 5:42883759-42883781 TTTAGGCCATGGTGGGAAGTGGG + Intronic
989578649 5:43011832-43011854 TTCAAGCCATGCTGGGAAGGGGG - Intergenic
991644878 5:68791826-68791848 TTCAGGCCATGATGGGAAGTGGG - Intergenic
991773027 5:70057541-70057563 TTCAAGCCATGATGGGAAGGGGG + Intronic
991852320 5:70932965-70932987 TTCAAGCCATGATGGGAAGGGGG + Intronic
992110484 5:73488058-73488080 TTCAGGCCATGATGGGAAGGAGG - Intergenic
992164798 5:74038780-74038802 TTCAGGCTATGATGGGAAGGGGG + Intergenic
992193023 5:74312668-74312690 CTCAGGCCATGATGGGAAGAGGG + Intergenic
992453454 5:76894020-76894042 TTCAGGTCATGAAGGGAAGTGGG + Intronic
992539557 5:77751120-77751142 GTCAGGCCGTAATGGGAACTGGG - Intronic
992540499 5:77759435-77759457 TTCAGACCATTATGGGAAGTAGG - Intronic
992541868 5:77774042-77774064 TTCAGGCCATGATGGGAAGAGGG + Intronic
992802327 5:80304711-80304733 TTCAGGCCGTGATGGGAAGAAGG - Intergenic
992842636 5:80711366-80711388 TTCAGTCCCTTGTGGTAAGTTGG + Intronic
992870396 5:80999679-80999701 TTCTGGGCGTGGGTGGAAGTGGG + Intronic
992930068 5:81634079-81634101 TTCAGGCCATGACAGGAAGTGGG + Intronic
995083469 5:108081244-108081266 TTCAGGCTGTTATGGGAAGGAGG - Intronic
995127904 5:108598176-108598198 TTCAGGCCATGATGGGTAGGGGG - Intergenic
995311327 5:110715713-110715735 TTCAGGCCATGATGGAAAGCAGG + Intronic
995566499 5:113436404-113436426 TTCAGGCCATGATAGAAAGTAGG + Intronic
995740786 5:115354023-115354045 TTCAGACCATGATGGGAAGTGGG - Intergenic
996063437 5:119056351-119056373 TTTAGGCCATGATGGGAAGTGGG - Intronic
996914988 5:128701866-128701888 TTCAGTCAATGATGGGAAGTAGG - Intronic
997258152 5:132445000-132445022 TTTAGGCCATGATGGGAAGGGGG - Intronic
998261822 5:140637577-140637599 TTCAGGCCATGATGGGAAGTAGG + Intergenic
998646075 5:144063793-144063815 TTCAGGCCCTGATGGGAAGTAGG - Intergenic
999555197 5:152733981-152734003 TTCAGGCCATGATGGGAAGTGGG - Intergenic
999801737 5:155044779-155044801 TTCAGGCCATGCTGGGAAGTGGG + Intergenic
999870160 5:155741634-155741656 TTCAGGCCATGATGGGAAAGTGG - Intergenic
999956722 5:156711137-156711159 TTCAGGCCATGATGGGAAGGGGG - Intronic
1000061642 5:157662678-157662700 TTCAGGCCATGAAAGGAAGTAGG + Intronic
1000363893 5:160473202-160473224 TTCGGGCCATGATGGGAAGTGGG - Intergenic
1000455653 5:161445495-161445517 TTCAGGCCATGATGGGAAGGGGG + Intronic
1000481810 5:161785956-161785978 TTCAGGCCATAATGGGAAGTTGG - Intergenic
1000601033 5:163274708-163274730 TTCAGGCCATGATGGGAAGGGGG - Intergenic
1000657118 5:163892943-163892965 TTCAGGCCATGTTGGGAAGCGGG + Intergenic
1001077013 5:168637503-168637525 TTCAGGCCATGATGGGAAGCAGG - Intergenic
1001339150 5:170827634-170827656 TTCAGGCCGCGATGGGAAGCGGG + Intergenic
1002382975 5:178843529-178843551 TTCAGGCCATCTTGGGGAGTGGG - Intergenic
1002410261 5:179069161-179069183 TTCAGGCCGTGACAGGAAGTAGG + Intronic
1002689161 5:181038291-181038313 TGCAGGCGGTGGTGGCAGGTGGG + Intergenic
1002994644 6:2271398-2271420 TTCCTGCCATGGTGAGAAGTGGG - Intergenic
1003075239 6:2977939-2977961 TTCAGGCCATGATGGGAAGAGGG - Intergenic
1003100849 6:3175547-3175569 TTCAGGCAATGATGGGAAGTGGG - Intergenic
1003196353 6:3918664-3918686 TTCAGGCCATGATGGGAAGCGGG - Intergenic
1003674809 6:8193206-8193228 CTCAGGCCATGATGGGAAGATGG + Intergenic
1003832144 6:10023180-10023202 TCAAGGGCGTGGTGGGAAGGAGG - Intronic
1005363271 6:25052994-25053016 TTCAGGCCATGATGGGAAGGGGG - Intergenic
1005423779 6:25679571-25679593 TCCAGGCAGTGGTGGCAGGTTGG - Intronic
1006679075 6:35784427-35784449 TTCAGGCCATGACGGGAAGTGGG - Intronic
1007077909 6:39079468-39079490 ATCAGGACTTGGTAGGAAGTGGG + Intronic
1007861597 6:44915523-44915545 TTCATGCCATGATGGGAAGTGGG + Intronic
1008291686 6:49723552-49723574 ATCAGGCCATGGTGGGAAGTGGG + Intergenic
1008578563 6:52884492-52884514 TTTAGGCCATGATGGGAAGTGGG - Intronic
1010304368 6:74301596-74301618 TTCAGGCCATGATGGGAAGGGGG + Intergenic
1010308189 6:74349540-74349562 TTCAGGCCATGTTGGGAAATGGG + Intergenic
1011400472 6:86955957-86955979 TTCAGGCCATGATGGGAATGGGG + Intronic
1012118142 6:95330949-95330971 TTCAGGCCATGATGGGAAAGAGG - Intergenic
1012227201 6:96717853-96717875 TTCAGGCCATGATGGGAAATAGG + Intergenic
1012650192 6:101742870-101742892 TTTAGGCCATGATGGGAAGTGGG - Intronic
1013088986 6:106882347-106882369 TTTAGGCCATGATGGGAAGGGGG - Intergenic
1013419226 6:109951061-109951083 TTCAGGCCATCATGGGAAGGGGG - Intergenic
1013512371 6:110856766-110856788 TTCAGGCTCTGGAGGGAAGAAGG + Intronic
1013607340 6:111762414-111762436 TTCAGGCCATGAAGGGAAGGTGG + Intronic
1013888191 6:114996709-114996731 TTCAGGCCATGATGGGAATGTGG - Intergenic
1014171968 6:118288714-118288736 TTCAGGGCATGATGGGAAGGGGG - Intronic
1014615075 6:123588428-123588450 TTCAGGCCATGATGGGAAGGAGG - Intronic
1014848764 6:126313753-126313775 TTTAGGCCATGATGGGAAGCAGG + Intergenic
1015332961 6:132003024-132003046 TTTAGGCCATGATGGGAAGAGGG - Intergenic
1015824429 6:137296540-137296562 TTCAGGCCACGATGGGAAGTGGG + Intergenic
1015986628 6:138891048-138891070 TTCAGGCCATGATAGGAAGGGGG + Intronic
1016100926 6:140099111-140099133 TTCAGAACGTGGTGGCCAGTTGG + Intergenic
1016295109 6:142565509-142565531 CTCAGGCCATGATGGGAAGTAGG - Intergenic
1016374107 6:143403017-143403039 TTCAGGCCATGATGGGAAGTGGG - Intergenic
1016699309 6:147035720-147035742 TCCAGGCCGTGATAGGAAGGGGG - Intergenic
1017359298 6:153547238-153547260 TTCAGGCCATGATGGGAAGTAGG + Intergenic
1017837025 6:158187942-158187964 TTCAGGCCATGATGGGAATGGGG - Intronic
1018155579 6:160982478-160982500 TTCAGGCCATGATAGGAAGTGGG + Intergenic
1018454077 6:163936613-163936635 TTCAGGCCACAGTGGGAAGTGGG + Intergenic
1018561351 6:165103687-165103709 TTCAGGCCATGATGGGAAGGGGG - Intergenic
1018759375 6:166877959-166877981 TTCAGGCCATGAGGGAAAGTGGG - Intronic
1018780387 6:167058406-167058428 TTCAGGCCATGATGTGAAGGGGG - Intergenic
1018807525 6:167272922-167272944 TTCAGGCCACGACGGGAAGTGGG - Intronic
1018866480 6:167750542-167750564 TTCAGGCTGTGATGGGAAGAGGG + Intergenic
1018897686 6:168032175-168032197 TTCAGGCCATGACGGGAAGTGGG - Intronic
1018991847 6:168679728-168679750 TTCAGGCTTTGATGGGAAGTGGG + Intergenic
1019030523 6:169006493-169006515 TTCAGCCCATGAAGGGAAGTGGG - Intergenic
1019068500 6:169322654-169322676 TTCAGGTCATGATGGGAAGCAGG - Intergenic
1019122076 6:169811692-169811714 TTGAGGCCTTGGTGGACAGTGGG - Intergenic
1019150067 6:169999570-169999592 TTCAGGCCGTGACAGGAAGTGGG + Intergenic
1019151514 6:170009303-170009325 TTCAGGCCATGATGGGAAGTGGG - Intergenic
1019156249 6:170040758-170040780 TTCAGGCCATGACGGGAAGCGGG + Intergenic
1019233152 6:170585205-170585227 TTCAGGCAATGATGGGAAGTGGG - Intergenic
1019416345 7:928517-928539 TTTAGGCCGAGGTGGGACGATGG - Intronic
1019946847 7:4336793-4336815 TTCAGGCCTTGATAGGAAGAGGG - Intergenic
1020046374 7:5043880-5043902 TTCAGGTCATGATGGGAAGGAGG + Intronic
1020363182 7:7351893-7351915 TTCAGGCCATCATGGGAAGAGGG + Intergenic
1020424292 7:8046357-8046379 TTCAGGCCATTATGGGAAGCAGG + Intronic
1020808429 7:12820863-12820885 TTCAGGCCCTGGTTGGGAGTGGG + Intergenic
1021480574 7:21111189-21111211 TTCAGGCCATGGTGGGATATAGG + Intergenic
1021572284 7:22078282-22078304 ATGGGGCCGTGGTGGGAAGGAGG + Intergenic
1021738645 7:23663383-23663405 TTCAGGCCATGATGGGAAGGGGG + Intergenic
1021978339 7:26030672-26030694 TTCAGGCCACGATGGGAAATGGG - Intergenic
1022005807 7:26264646-26264668 TTCAGGCCATGAAGGGAAGTGGG - Intergenic
1022679178 7:32527905-32527927 TTCAGGCCATGATGAGAAATAGG + Intronic
1022833121 7:34088161-34088183 GCCAGGATGTGGTGGGAAGTAGG + Intronic
1023293731 7:38693095-38693117 TTCAGGCTGTGATGGGAAGTTGG - Intergenic
1023308652 7:38858451-38858473 TTCAGGCCATGACGGGAAGGGGG - Intronic
1023773453 7:43582080-43582102 CTCAGGCCATGGTGGTAAGGTGG + Intergenic
1024122093 7:46253723-46253745 TTCAGGCCATGATGGGAAGTGGG + Intergenic
1025005890 7:55354457-55354479 TTCAGGCCATGATGGGAAGTGGG + Intergenic
1026210114 7:68296602-68296624 TTCAGGACATGATGGGAAGGGGG - Intergenic
1026247430 7:68633706-68633728 TTCAGGCCATGGTGGGAAAAGGG - Intergenic
1026583273 7:71635393-71635415 TTCAGGCCATGATGGGAAGTGGG - Intronic
1027969823 7:85064724-85064746 GTAAGGCGGTGGTGGGGAGTGGG + Intronic
1028149150 7:87352113-87352135 TTCAGGCCATGAGGGGAAGCAGG - Intronic
1028318482 7:89433878-89433900 TTCAAGCCATGAAGGGAAGTGGG - Intergenic
1028367811 7:90054749-90054771 TTCAGGCCGTAATGGCAAGGAGG - Intergenic
1028368999 7:90069675-90069697 TTCAGAGCATGGTGGGAAGCAGG - Intergenic
1028389441 7:90297293-90297315 TTCAGGCCATGATGGGAAGGAGG - Intronic
1028517289 7:91691868-91691890 TTCAGGCCGAGGTGGGTATAAGG + Intergenic
1028914355 7:96242504-96242526 TTCTGGCCATGACGGGAAGTGGG + Intronic
1029354520 7:100041937-100041959 TTCAGGCCATGATGGGAAGGGGG + Intergenic
1029379691 7:100204944-100204966 CTCAGGCCTGGGAGGGAAGTGGG + Intronic
1030190855 7:106808840-106808862 TTCAGGCCATGACAGGAAGTGGG - Intergenic
1030680266 7:112426641-112426663 TTCAGGCCATGATGGGAAGTGGG + Intronic
1030825708 7:114155245-114155267 TTCAAGCCATGATGGGAAGGGGG + Intronic
1030985087 7:116231846-116231868 TTCAGGCCATGATAGGAAATGGG - Intronic
1031227147 7:119053978-119054000 TTCAGGCCATGAAGGGAAGTGGG - Intergenic
1032523085 7:132561120-132561142 TCAAGGCAGAGGTGGGAAGTGGG - Intronic
1032674257 7:134113841-134113863 TTCAGGCCATGATGGGAAGAGGG + Intergenic
1033175801 7:139122661-139122683 TTCAGGCCATGATGGGACGGGGG - Intergenic
1033577214 7:142697012-142697034 TTCAGGTCTTAGTGGGAAGTGGG - Intergenic
1033627035 7:143120419-143120441 TTCAGGCCATGATGGGAAGTGGG - Intergenic
1033801292 7:144905532-144905554 TTCAGGCCATGACGGGAAGGGGG - Intergenic
1034060141 7:148079854-148079876 TTCAGGTCATGATGGGGAGTGGG - Intronic
1034735977 7:153429924-153429946 TTCAGGCCATGATGGGAAGTGGG + Intergenic
1035435039 7:158853299-158853321 TTCAGGACATGATGGGAAGAGGG + Intergenic
1035550165 8:517050-517072 TTCAGGCCGTGATGGGAAGGAGG + Intronic
1035556865 8:573621-573643 TTCAGGCCATGATGGGAAGCAGG - Intergenic
1035716486 8:1759195-1759217 TTCAGACCGTGATGGGAAGTGGG - Intronic
1035788796 8:2284912-2284934 TTCAGGCCGTGCCGGGAAAGGGG + Intergenic
1035804009 8:2436793-2436815 TTCAGGCCGTGCCGGGAAAGGGG - Intergenic
1035811069 8:2491624-2491646 TTCAGGCTGTGATGGCAAATGGG - Intergenic
1035835090 8:2741516-2741538 TTCAGGCCATGACAGGAAGTGGG + Intergenic
1036221438 8:6924120-6924142 TTCAGGCCATGATGGGACGTGGG + Intergenic
1036289319 8:7473502-7473524 TTCAGGCCATGAAAGGAAGTGGG - Intronic
1036332162 8:7838030-7838052 TTCAGGCCATGAAAGGAAGTGGG + Intronic
1036382126 8:8243023-8243045 TTCAGGCATTGCCGGGAAGTCGG + Intergenic
1036390765 8:8322557-8322579 TTCAGGCCATGATGGGAAGGGGG + Intronic
1037670100 8:21007571-21007593 TTCGGGCCATAGTGGGAAGTTGG + Intergenic
1038506756 8:28091339-28091361 CTCAGGCCATGATGGGAAGTGGG - Intronic
1038647035 8:29370524-29370546 TTCATGCAGTGGAGGGAGGTGGG + Intergenic
1039220088 8:35320762-35320784 TTCAGGCCATGATTGGAAGTGGG - Intronic
1039264100 8:35805892-35805914 TTCAGGCAGTGGTGGAAGATGGG + Intergenic
1039560098 8:38505717-38505739 TGGAGGCCGAGGTGGGAAGATGG - Intergenic
1039685298 8:39795282-39795304 TTCAGGCCATGATGGGAAGAGGG + Intronic
1039736181 8:40335406-40335428 TTCAGGTCATGATGGGAAGTGGG - Intergenic
1039757378 8:40538064-40538086 TTCAGGCCATGATGGGAAATAGG + Intronic
1040401918 8:47060037-47060059 TTCAGGCCATGATGGTAAGTGGG - Intergenic
1040417577 8:47208688-47208710 TTCAGGCCATGATGGGAAGCTGG + Intergenic
1041000404 8:53443989-53444011 TTCAGGCCATGCTGGGAAGGGGG + Intergenic
1041033335 8:53760759-53760781 TTCAGGCTATGATGGGAAGAGGG + Intronic
1041257357 8:55990768-55990790 TTCAGGCCATGATGAGAAGGGGG - Intronic
1041320465 8:56607182-56607204 TTCAGGCCATGATGAGAAGAAGG + Intergenic
1042184907 8:66127116-66127138 TTCAGGCCCTGGTTTGGAGTGGG - Exonic
1042199880 8:66271112-66271134 TTCAGGCCATGATGGGAAGAGGG - Intergenic
1042361228 8:67885441-67885463 TTCAAGCCATGATAGGAAGTAGG - Intergenic
1042520005 8:69701375-69701397 TTCAGACCAGGATGGGAAGTGGG + Intronic
1042820358 8:72923553-72923575 TTCAGGTCATGATGGGAAGTGGG - Intronic
1042932258 8:74025208-74025230 CCCAGGCCCTGGTGGGTAGTAGG + Intronic
1043002800 8:74780085-74780107 TTCAGGCCATGATGGGAAGAAGG + Intronic
1043163194 8:76871743-76871765 TTGAGGCTGGGGTGGGGAGTGGG + Intergenic
1043413106 8:80020335-80020357 TGCAGGCCGTGATGGGAAGGGGG - Intronic
1043535287 8:81196546-81196568 TTTAGGCCATGATGGGAAGTGGG + Intergenic
1043740744 8:83808408-83808430 TTCAGGCCATGACAGGAAGTGGG + Intergenic
1044211969 8:89561113-89561135 TTCAGGCCATGATGGGAAGAAGG - Intergenic
1044396580 8:91720451-91720473 TTCAGTCCATGATGGGAAGAGGG - Intergenic
1044593844 8:93939978-93940000 TTCATGCCATGATGGAAAGTCGG - Intergenic
1045044000 8:98257107-98257129 TTTAGGCCATGATGGGAAGTGGG + Intronic
1045253077 8:100497465-100497487 TTCAGGCCATGATGGGAAGGGGG - Intergenic
1045533528 8:103006129-103006151 TTCAGGCCATGATGCGAAGAGGG - Intergenic
1045644284 8:104284973-104284995 TTCAGGCCAGGATGGGAAGCCGG - Intergenic
1046121665 8:109855300-109855322 TTCAGGTCATGATGGGAAGGGGG + Intergenic
1046133270 8:109994543-109994565 TTCAGGCCATGATAGGAAGTGGG + Intergenic
1046271413 8:111902364-111902386 TTCAAGCTGTGGTGTGAAGAAGG - Intergenic
1048074856 8:131058564-131058586 TCCAGACAGTGGTTGGAAGTGGG + Intergenic
1049007716 8:139866264-139866286 TTCAGGCCATCATGGGACGTGGG - Intronic
1049201013 8:141340685-141340707 TTCAGGCCACGGTGGGAAGCGGG - Intergenic
1050944228 9:11498116-11498138 TTCAGGCCATGATGGGAAGTAGG - Intergenic
1052826853 9:33182953-33182975 TGCAGGAGGTGGAGGGAAGTTGG - Intergenic
1052890702 9:33696898-33696920 TTCAGTTCTTAGTGGGAAGTGGG - Intergenic
1053003680 9:34591093-34591115 CCCAGGCCGTGGCGGGAAGAAGG - Intergenic
1053799604 9:41755909-41755931 TTCAGGCCATGATGGGAAGTGGG + Intergenic
1054145615 9:61559089-61559111 TTCAGGCCATGATGGGAAGTGGG - Intergenic
1054188013 9:61967969-61967991 TTCAGGCCATGATGGGAAGTGGG + Intergenic
1054465355 9:65490193-65490215 TTCAGGCCATGATGGGAAGTGGG - Intergenic
1054608421 9:67208395-67208417 TTCAGCCCCAGGTGGGATGTGGG - Intergenic
1054650502 9:67620612-67620634 TTCAGGCCATGATGGGAAGTGGG - Intergenic
1054779971 9:69157064-69157086 TTCAGGCCATGAAGGGAAGTGGG - Intronic
1055045607 9:71920935-71920957 TTCAGGCCATGATGGGAAGTGGG + Intronic
1055708658 9:79035561-79035583 TTCAGGCCATGACAGGAAGTGGG - Intergenic
1056286407 9:85091770-85091792 TTCAGGCTGTGGTGGGTGGAAGG + Intergenic
1056715585 9:89025579-89025601 GTCAGGCCATGATGGGAAGTGGG + Intronic
1056723029 9:89087761-89087783 TTCAGGTCCTGATGGGAAGAGGG + Intronic
1056891788 9:90501284-90501306 TTCAGGCCAGAATGGGAAGTGGG - Intergenic
1056902095 9:90609376-90609398 TTCAGGCCATGATGGGAAGTGGG - Intergenic
1056983976 9:91343998-91344020 TTCAGGCCATGATGGAAAGTGGG + Intronic
1057051571 9:91928068-91928090 TGCAGGAGGTGGCGGGAAGTGGG - Intronic
1057212839 9:93209998-93210020 TCCATGCTGTGGTGGGGAGTTGG + Intronic
1057382501 9:94581775-94581797 TTCAGGCCATGGCAGGAAGCGGG + Intronic
1057943922 9:99308112-99308134 TTCAGGCCATGACGGGAAGCAGG + Intergenic
1058301077 9:103373669-103373691 TTGAGGCCATGATGGGAAGGGGG + Intergenic
1058432917 9:104934873-104934895 TTCAGGTCATGACGGGAAGTGGG - Intergenic
1058449694 9:105084463-105084485 TTCAGGCCATGAGGGGAAATGGG + Intergenic
1058462660 9:105197517-105197539 TTGAGGCCATGATGGGTAGTAGG - Intergenic
1058638851 9:107063758-107063780 TTCAGGCCACGAAGGGAAGTGGG + Intergenic
1060163285 9:121386976-121386998 TTCAGGCCATGATGAGAAGTGGG - Intergenic
1060812408 9:126617224-126617246 TGCAGGGCGTGGTGGGGAGGGGG - Intronic
1061265197 9:129500719-129500741 TTCAGGCCGTGGGAGGGAATGGG - Intergenic
1061794154 9:133074622-133074644 TTCAGGCCATGATGGGCAGTAGG + Intronic
1061950298 9:133932277-133932299 TACAGGCCGTGGCGGGGAGCAGG + Intronic
1062492317 9:136811897-136811919 TTCAGGCCATTATGGGAAGAGGG - Intronic
1185588634 X:1259112-1259134 TTCAGGCCGTCATGGAAAGTGGG + Intergenic
1185760826 X:2689203-2689225 TTCAAGCCGTGACGGGAAGCAGG + Intergenic
1185792901 X:2941081-2941103 TTCAGGCCGTGACAGGAAGCGGG + Intronic
1185849566 X:3472984-3473006 TTCAAGCCATGATGGGAAGTGGG - Intergenic
1185910581 X:3977102-3977124 TTCAGACCATGATGGGAAGTGGG - Intergenic
1186691219 X:11977987-11978009 TTCAGGCCATGATGGGAAGTGGG - Intergenic
1186718307 X:12276684-12276706 TTCAGGCCATGATGGGAATGGGG - Intronic
1186811914 X:13198626-13198648 TTCAGGCCATGATGGGAAGTGGG + Intergenic
1186820540 X:13283605-13283627 TTCAGGCCGTGATGGGAAGTAGG - Intergenic
1188156065 X:26744970-26744992 TTCTGGCCATGATGGGAAGTGGG - Intergenic
1188384029 X:29533901-29533923 TTCTGGTGATGGTGGGAAGTGGG + Intronic
1188642922 X:32528584-32528606 TTCAGGCCAAGAAGGGAAGTGGG + Intronic
1188902746 X:35754071-35754093 TTCAGGCCATGATAGGAAGGAGG - Intergenic
1188908990 X:35822609-35822631 TTCAGGCCATGACAGGAAGTGGG + Intergenic
1189176213 X:38959942-38959964 TTCAGGCCATGATGGGAAGCGGG - Intergenic
1189748299 X:44192968-44192990 TTCAAGCCATGATGGGAAGTGGG + Intronic
1189758747 X:44299242-44299264 TTCAGGCCATGATGGGAAGGGGG + Intronic
1190175488 X:48145637-48145659 TTCAGGCCATGACAGGAAGTGGG + Intergenic
1190182785 X:48207560-48207582 TTCAGGCCATGACAGGAAGTGGG + Intronic
1190185670 X:48231770-48231792 TTCAGGCCATGACAGGAAGTGGG - Intronic
1190198350 X:48339217-48339239 TTCAGGCCATGACAGGAAGTGGG - Intergenic
1190569779 X:51769422-51769444 TTCAGGCCATGACAGGAAGTAGG + Intergenic
1190604713 X:52128710-52128732 TTCAGGTCATGATGGAAAGTGGG + Intergenic
1190665112 X:52689679-52689701 TTCAGGCCATGACAGGAAGTGGG - Intronic
1190674310 X:52768740-52768762 TTCAGGCCATGACAGGAAGTGGG + Intronic
1190866940 X:54392620-54392642 TTGAGGCCATGATGGGAAGTGGG + Intergenic
1191565706 X:62526035-62526057 TTGAGGCCTTCGTTGGAAGTGGG - Intergenic
1191639868 X:63418475-63418497 TTCAGGCCATGACAGGAAGTGGG - Intergenic
1192065573 X:67881211-67881233 TTCAGGACATGATGGGAAGTGGG - Intergenic
1192453101 X:71255473-71255495 TAGGGGCTGTGGTGGGAAGTGGG - Intergenic
1192802919 X:74484580-74484602 TTCAGGCCATGATGGGAAATGGG - Intronic
1192803620 X:74491576-74491598 TTCAGGCCATGATGGGAAGTGGG - Intronic
1193485024 X:82077105-82077127 TTCAGGCCATGATGGAAAATGGG - Intergenic
1193696260 X:84710181-84710203 TTCAGGCCATGATGGGAAGCGGG - Intergenic
1193708748 X:84855417-84855439 TTTAGGCCATCATGGGAAGTAGG - Intergenic
1193709690 X:84863793-84863815 TTCAGGCCATGATAGGAAGAGGG - Intergenic
1193710523 X:84873472-84873494 TTTAGGCCATCATGGGAAGTGGG + Intergenic
1193850804 X:86535449-86535471 TTCAGGCCATGATGGGAAGCAGG + Intronic
1194014859 X:88606366-88606388 TTCAGGCCATGATGAGAAGTGGG + Intergenic
1194120712 X:89960590-89960612 TTTAGGCCATGATGGGAAGTGGG - Intergenic
1194256605 X:91643101-91643123 TTCAGGCCATGAAGGGAAGTGGG + Intergenic
1194262235 X:91710565-91710587 GTCAGGCCATGATGGGAAGGGGG - Intergenic
1194483071 X:94451106-94451128 TTTAGGCCATGATGGTAAGTAGG - Intergenic
1194485950 X:94486375-94486397 TTCAAGCCATGATGGGAAATGGG - Intergenic
1195146239 X:102019779-102019801 TTCAGGCCATGATGGGAAGTGGG + Intergenic
1195313548 X:103656549-103656571 TTCAGGCCATGATGGGAAACAGG - Intergenic
1195463478 X:105154228-105154250 TTCAGGCCATGACAGGAAGTGGG - Intronic
1195565688 X:106336706-106336728 TTCAGGCCATGATGGGAAGGGGG - Intergenic
1196072588 X:111543030-111543052 TTCAGGCCATGATGGGAAGTGGG - Intergenic
1196301988 X:114058379-114058401 TTGAGGCTGTGATGGGAAGTGGG + Intergenic
1197351377 X:125387595-125387617 ATCAGGCCATGATGGGAAGCTGG - Intergenic
1198258361 X:134944870-134944892 CTCAGGCCTTGACGGGAAGTGGG + Intergenic
1199336758 X:146627644-146627666 TTCAGGCCATGATGTGGAGTTGG + Intergenic
1199357907 X:146882781-146882803 TTCAGGCCATGATAGGGAGTGGG - Intergenic
1199381033 X:147172869-147172891 TTCATGCCATGATGGAAAGTGGG - Intergenic
1200293353 X:154892819-154892841 TTCAGGCCATGATGGGAAAGTGG + Intronic
1200383999 X:155870378-155870400 TTCAGGCCATGAAGGGAAGTGGG - Intergenic
1200473576 Y:3618094-3618116 TTTAGGCCATGATGGGAAGTGGG - Intergenic
1200575324 Y:4882379-4882401 TTCAGGCCATGAAGGGAAGTGGG + Intergenic
1200581531 Y:4955398-4955420 GTCAGGCCATGATGGGAAGTGGG - Intergenic
1201260719 Y:12156667-12156689 TTCAGGCTATGATGGGATGTAGG - Intergenic
1201280264 Y:12336321-12336343 TTCAGGCCATGATGGGAAGCAGG - Intergenic
1201348633 Y:13014109-13014131 TTCATGCCATGATAGGAAGTGGG + Intergenic
1201403288 Y:13626540-13626562 TTCAGGCCATGATATGAAGTGGG + Intergenic
1201685525 Y:16697620-16697642 TTCAGATCATGATGGGAAGTAGG + Intergenic
1201701407 Y:16886307-16886329 TTCAGGCTCTGATGGAAAGTGGG + Intergenic
1201725394 Y:17144759-17144781 TTCAGGCCATGATAGGAAGTTGG - Intergenic
1201891617 Y:18948853-18948875 TTCAGACCACGATGGGAAGTGGG + Intergenic